Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Virus Genes DOI 10.1007/s11262-008-0299-9 Recombinant core proteins of Japanese encephalitis virus as activators of the innate immune response Shu-O Chen Æ Shih-Hua Fang Æ Dien-Yun Shih Æ Tien-Jye Chang Æ Jau-Jin Liu Received: 11 July 2008 / Accepted: 27 October 2008 Ó Springer Science+Business Media, LLC 2008 Abstract Nitric oxide (NO) has been shown to suppress Japanese encephalitis virus (JEV) RNA synthesis, viral protein accumulation, and virus release from infected cells. In this article, the potential viral structural proteins as the activators of NO product were studied at the molecular level. First, the genomic region encoding the JEV structural proteins was cloned into a prokaryotic expression vector pET for high-level expression. After purification, these JEV recombinant proteins were added to macrophages to examine the productions of NO and pro-inflammatory mediators. In this study, the recombinant core protein, but not envelope (E), could trigger NO and pro-inflammatory mediators (TNF-a, IL-6, and IL-12) productions on macrophages. And their effects were about 85–95% relative to LPS-stimulated macrophages in a dose-dependent manner. Meanwhile, the rCore-2D could up regulate promoters of IL-8 and TNF-a via EGFP expression in reporter plasmid (IL-8p–EGFP and TNF-ap–EGFP)-transfected cells by flow cytometric analysis. These results suggest that JEV core protein could regulate pro-inflammatory mediators and NO production, and may play a crucial role in the innate immunity for the host to restrict the initial stage of JEV infection. S.-O. Chen T.-J. Chang (&) Department of Veterinary, College of Veterinary Medicine, National Chung-Hsing University, Taichung 402, Taiwan S.-H. Fang Institute of Athletics, National Taiwan Sport University, Taichung 404, Taiwan D.-Y. Shih J.-J. Liu (&) Department of Microbiology, China Medical University, Taichung 404, Taiwan e-mail: [email protected] Keywords Japanese encephalitis virus Core protein Nitric oxide Introduction Japanese encephalitis virus (JEV), a member of the family Flaviviridae, causes acute encephalitis with a mortality rate up to one-third of infected patients, and nearly half of the survivors suffer neurological or mental sequelae in humans [1, 2]. During JEV infection, there is no established antiviral treatment for JEV, and the recovery from viral infection mainly depends upon host immunity. The antiJEV effect of nitric oxide (NO) has been suggested to be one of the important factors of innate immunity in controlling the initial stages of JEV infection [2, 3]. However, recent reports on Japanese encephalitis (JE) show the elevated levels of cytokines and chemokines in hosts are associated with a poor outcome during JEV infection [4] and pro-inflammatory mediators released by activated microglia induce neuronal death in JE [2]. The mechanisms of JE viral replication have been extensively studied; nevertheless, little is known about the molecular mechanisms by which viral components modulate host innate immune responses. The genome of JEV is a single-stranded positive-sense RNA of approximately 11 kb and contains a single open reading frame with the potential to encode a large polyprotein. The JEV polyprotein is cleaved by both host and viral proteases to yield at least 10 distinct products in the order of three structural proteins (core, M, and E), and seven nonstructural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5) [5, 6]. The envelope glycoprotein (E), with the presence of a hypervariable region, appears to play a major role in inducing protective immunity and determining viral 123 Virus Genes (405 bp) was cut from plasmid pJE-S with restriction enzymes Nco I and Hind III, and then inserted into the prokaryotic expression vector pET32a. The other deleted clones which contained 375 and 209 bp of core gene were subcloned into pET32a vectors individually by restriction enzymes (BamH I, Bgl II, or Xho I) digestion and named, pCore/D and pCore/2D, respectively. The 1,500 bp cDNA fragment containing full-length E gene of JEV was cloned into pET32c vector and named pET32/E as described in our previous study [6]. In this study, JEV recombinant proteins (rCore, rCore/D, rCore/2D, and rE) expressed by prokaryotic expression pET system are schematically represented in Fig. 1. Furthermore, the derived cDNA fragments of Core/ 2D and E genes were re-subcloned into eukaryotic expression vector pLNCX2 (Clontech) by restriction enzymes, and named pLN-Core/2D and pLN-E, respectively (Fig. 7a). The expression of inserted gene in each construct was controlled by of CMVIE promoter. In this study, EGFP reporter plasmids (IL-2p-EGFP, IL-8p-EGFP, and TNF-ap-EGFP), each containing promoter (IL-2, IL-8, or TNF-a) linked to EGFP (enhanced green fluorescent protein), were constructed from chloramphenicol acetyltransferase (CAT) reporter DNA (sIL-2CAT, sIL-8-CAT, and sTNF-a-CAT) which had been built in our laboratory previously, and the CAT gene was replaced with EGFP gene derived from pEGFP-N1 (Clontech) (Fig. 1b). All the inserted sequences of constructed plasmids were confirmed by automated DNA sequencing. pathogenicity by defining cellular tropism and triggering apoptosis in infected cells [6–8]. By contrast, the wellconserved core is a small protein (14 kDa) and possesses multiple functions involved in the formation of the viral nucleocapsid as well as affliction of viral RNA replication [9]. West Nile virus (WNV) is a flavivirus that is genetically related very closely to JEV, its capsid protein causing neuronal death and the release of neurotoxic factors by infected astrocytes, coupled with pro-inflammatory gene induction [10]. As regards JEV, which viral protein plays the role as an activator of innate immune response and neurovirulence is not determined yet. In this study, we constructed and expressed recombinant JEV core and E proteins to investigate whether JEV core or E proteins can modulate inflammatory components release by activated macrophages in the absence of the intact virus. Materials and methods Plasmid constructs Prokaryotic expression system, pET-32 series vectors and Escherichia coli BL21 (DE3) (Novagen) were used for expression. For cloning core and E genes of JEV, at first cDNA of structure genes was generated from RNA genome of JEV with primers JE1F and JE1R by RT-PCR and cloned into pGEM-T-Easy, named pJE-S [5, 6]. Second, the cDNA fragment which encoded full-length of JEV core protein Fig. 1 a Schematic representation of JEV recombinant proteins (rCore, rCore/D, rCore/2D, and rE) constructed and expressed by prokaryotic expression pET system. The gray box indicates JEV’s protein and the dot line represents deleted region. b Three reporter plasmids (IL-2p– EGFP, IL-8p–EGFP, and TNFap–EGFP) each containing promoter (IL-2p, IL-8p, or TNF-ap) linked to EGFP gene (A) Structural genes 5’ C prM Nonstructural genes E NS1 NS2 NS3 5’CGGAAGATAACCATGGCTA3’ 5` CGGAAGATAACCATGGCTA 3` Nco I 3’ Sph I 5` AAACATCAACCCAATCTGCC 3` Nco I prM Cathepsin L NLS E 295 137 a.a. (rCore) 1 1 NS5 JE1R primer JES1R primer 5’CCAGTGTCAGCATGCACAT 3` JE1F primer JES1F primer C NS4 794 a.a. (rE) 115 a.a. (rCore/D) 1 27 81 115 a.a. (rCore/2D) (B) Promoter-EGFP reporter IL-2p IL-8p TNF-αp 123 IL-2p-EGFP EGFP IL-8p-EGFP EGFP EGFP TNF-αp-EGFP Virus Genes Protein expression and purification Cell culture Growth and induction of E. coli were performed essentially according to the recommendations by Studier et al. [11]. E. coli transformant cells were induced with 1 mM isopropyl b-thiogalactoside (IPTG) for 5 h. Then bacterial lysates in 10 mM Tris-Cl, pH 8.0 and 150 mM NaCl were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and stained with Coomassie brilliant blue. Furthermore, the six-histidine residues (His-Tag) at N-terminus of expressed products could be used for affinity chromatography purification by cobalt-based immobilized affinity chromatography according to TALONTM Metal Affinity Resins User Manual (Clontech). The cell extract was isolated from a 100 ml bacterial culture, and the insoluble fraction was dissolved in lysis buffer (8 M urea, 100 mM NaH2PO4, 10 mM Tris, pH 8.0) and then loaded on an equilibrated Talon resin column (Clontech). The eluted fraction was rapidly desalted with PBS exchange by repeated centrifugations at 14,0009g using protein desalting spin columns (NanosepÒ 10 K Centrifugal Filter Devices). Then, these purified recombinant proteins were analyzed by 10% SDS-PAGE and further identified by Western blotting analysis. Peritoneal exudate macrophages were obtained from mice by lavage with 10 ml of cold HBSS per mouse at 3 days after intraperitoneal (i.p.) injection of 2 ml 3% thioglycollate in saline (1.5 ml per mouse, Difco, Detroit, MI) [12]. Cells were seeded in 96-well cluster plates at a density of 2 9 106 cells/ml and incubated at 37°C in humidified 5% CO2 to allow macrophages adherence. Two hours later, the non-adherent cells were removed by washing with warmed PBS and the remaining cells (90% macrophages, judged by non-specific esterase stain) were incubated with medium containing various concentrations of JEV recombinant proteins. Control cells were grown under identical conditions but were not exposed to recombinant proteins or lipopolysaccharide (LPS, E. coli 055: B5). RPMI-1640 medium, Hank’s balanced salt solution (HBSS), penicillin, streptomycin, L-glutamine, and fetal calf serum used above were purchased from Invitrogen. Western blotting Western blotting analysis was conducted as previously described [6]. In brief, proteins were separated by 10% SDS-PAGE and then transferred to nitrocellulose membranes by electrotransfer (Bio-Rad). The monoclonal antihistidine tag antibody was used as first antibody at 1:1000 dilution, and the HRP-goat anti-mouse IgG conjugate (Zymed) at 1:1000 dilution was used as secondary antibody. Finally, the DAB substrate (GERBU Biotechnik GmbH, Gaiberg, Germany) was used for color development to reveal the signal. Mice Female BALB/c mice were bought from the Animal Center of the College of Medicine, National Taiwan University and maintained in the Animal Center of China Medical University. The animal room was maintained on a 12-h light-and-dark cycle with a constant temperature and humidity. All mice were 8 weeks old, sacrificed under anesthesia, and used to obtain cells from peritoneal exudates. All procedures adhered to the Guide for the Care and Use of Laboratory Animals (NRC, USA) and were approved by the laboratory animals committee of China Medical University. Cell viability Mitochondrial respiration-dependent MTT assay was employed to determine their cytotoxicity [15]. MTT (Sigma) was a pale yellow substance that was reduced by living cells to yield a dark blue formazan product. This process requires active mitochondria, and even fresh dead cells do not reduce significant amount of MTT. Recombinant proteins (2 lg/ml) were incubated in a 96-well plate (2 9 106 cells/ml) for 24 h. MTT in PBS (0.1 mg) was added into each well and then incubated at 37°C for 4 h. The MTT formazan (1-(4,5-dimethylthiazol-2-yl)-3,5diphenylformazan) crystals formed due to dye reduction by viable cells were dissolved using acidified isopropanol (0.1 M HCl) and mixed well at room temperature. After 20 min, index of cell viability was calculated by measuring the optical density (OD) of color produced by MTT dye reduction with a microplate reader (BIO-RAD, model 3550, U.S.A.) at 570 nm (OD570-620). The mean OD value of the content of four wells was used for assessing the cell viability expressed as percentage of control. NO determination The production of NO was estimated from the accumulation of nitrite (NO2-), which is the end product of NO metabolism. This was achieved by using Griess reagent (Sigma) in the medium as described by Green et al. [13]. Cells were incubated with medium containing 2 lg/ml of recombinant protein for 24 h. Equal volumes of culture supernatant and Griess reagent (1:1 mixture of 1% sulfanilamide in 5% phosphoric acid, and 0.1% a-naphthylethylenediamine 123 Virus Genes dihydrochloride in distilled water) were mixed and incubated for 15 min at room temperature. Then the absorbance was measured at 540 nm in a spectrophotometer and referred to NaNO2 standard curve to determine the nitrate concentration in supernatants. systems (BDIS), San Jose, CA) and Modfit LT (Verity Software House, Topsham, ME). Cytokine assay Construction of JEV expression plasmids Peritoneal exudate macrophages were treated with various concentrations (4, 2, 1, 0.5 lg/ml) of rCore/2D and LPS for 48 h, following which the cell supernatants were analyzed for various secreted cytokines using enzyme-linked immunosorbent assay (ELISA) as previously established in our laboratory [12]. Serial dilutions of recombinant mouse tumor necrosis factor (TNF)-a, interleukin (IL)-6, and IL12 (PharMingen, San Diego, CA) were used as the standard. The sensitivity of ELISA of TNF-a, IL-6, and IL-12 is as low as 15.6 pg/ml. Cell viability was assessed by trypan blue dye exclusion method and was always greater than 95%. In order to obtain a high-level expression of JEV structural proteins, we cloned core and E genes into a prokaryotic expression system (pET32 vectors), individually. In this study, three different deleted clones of core genes (pCore, pCore/D, and pCore/2D) were constructed and their relative positions of amino acids of expression products (rCore, rCore/D, and rCore/2D) were delineated as shown in Fig. 1a. The resultant plasmids were described briefly as follows: the first plasmid, pCore, encoded 137 amino acids (a. a.) of full-length JEV core protein; the second plasmid, pCore/D, lacked hydrophobic sequences (116–137 a. a) at the C-terminus of core protein; the third plasmid, pCore/ 2D, had extra-deleted the hydrophobic region (28–80 a. a.) in the middle of core protein than pCore/D. The cathepsin L may be capable of cleaving amino acid residues between Lys18 and arg19 at the N-terminus of capsid protein [14]. The JEV capsid protein possesses two conserved hydrophobic sequences: one is in the center, an internal sequence of hydrophobic residues surrounded by charged residues which contain a nuclear localization signal (NLS) and may have a role in flavivirus capsid protein dimerization [9, 15]; the other is at the carboxyl-terminus which serves as a signal sequence of prM in most flaviviruses [16] and ubiquitin-proteins and is likely to bind specifically at the region to degrade capsid protein in coordination with Jab1 [17]. The pET32/E which encoded full length of JEV E protein (rE, 295–794 a. a.) was constructed and is also shown in Fig. 1a. Statistics Experiments were repeated independently for three times. All experimental data are shown as mean ± SD and statistical analysis was performed using a one-way Analysis of Variance (ANOVA) followed by Dunnett’s post-hoc test. In all cases, a probability (P) value of the significant difference was set at *P \ 0.05; **P \ 0.01. Flow cytometry GP2-293 cells were seeded in 12-well dish for 1 day and then transfected with EGFP reporter plasmid (IL-2p-EGFP, IL-8p-EGFP and TNF-ap-EGFP) by using Qiagen EffectenceTM (New England BioLab, Beverly, MA) according to the manufacturer’s instructions (BioLab). Briefly, 0.3 lg plasmid DNA is added with EC buffer to 75 ll and mixed with 2.4 ll Enhancer at room temperature for 5 min. Then, the mixture was added 6 ll EffectenceTM reagent and 800 ll culture medium into cells for 10 min at room temperature. After 24 h transfection, cells were washed with 19 PBS and added 2 lg rCore/2D then maintained in culture medium at 37°C, 5% CO2. Further incubation for 48 h, cells were resuspended in PBS and analyzed by flow cytometry immediately. For each analysis, 5,000–10,000 gated events were collected from both the EGFP (?) and EGFP (-) cells subpopulation. The EGFP fluorescence was directly emitted by 488-nm argon-ion laser, and fluorescence emission was read with a 515/40 band pass filter. Data analysis was performed using CellQuest software (custom product; Becton Dickinson Immunocytometry 123 Results Purification and identification of recombinant core proteins These plasmids above were transformed into E. coli, BL21 (DE3) for expression. After 5 h of 1 mM IPTG induction, the cell lysates were analyzed by 10% SDS-PAGE (Fig. 2). The results show cell lysates of pCore, pCore/D, and pCore/ 2D transformants possess prominent stained bands which correspond to approximate molecular masses of 34, 31, and 25 kDa, respectively (Fig. 2). It was obviously observed that these recombinant core products which increased gradually accompanied by hydrophobic region deletions, particularly in pCore/2D which retain antigenic regions and absence of all hydrophobic regions of core protein, have high-level production in prokaryotic system (Fig. 2, lane 8). Perhaps, this hydrophobic region of core might have a toxic Virus Genes 1 2 3 4 5 6 7 8 NO concentration (µM per 10^5 cells) M kDa 39 34 kDa 31 kDa 25 kDa 26 19 70 57.84 54.68 60 50 40 30 20.13 20 10 5.12 1.03 1.26 0 cell LPS rCore rCore/D rCore/2D rE Treatment Fig. 2 Expressed core proteins from E. coli transformants are analyzed by SDS-PAGE and Coomassie brilliant blue staining. Lanes 1 and 2: pET-32a as vector control; Lanes 3 and 4: pCore; Lanes 5 and 6: pCore/D; Lanes 7 and 8: pCore/2D. Lanes 1, 3, 5, 7: cell lysates without IPTG induction and lanes 2, 4, 6, 8: cell lysates with 1 mM IPTG induction for 5 h at 37°C. M: protein molecular weight makers. Arrowheads indicate expressed recombinant core proteins effect on the host cells. Further processed by affinity column purification, desalting and PBS exchange, these recombinant core proteins (rCore, rCore/D, and rCore/2D) were separated with SDS-PAGE (Fig. 3a) and identified by Western blotting analysis (Fig. 3b). In addition, the rCore/ 2D production (25 kDa) also increased with time after IPTG induction in time course analysis (Fig. 3c). Effects of core protein on the activation of murine peritoneal excluded macrophages For investigating the effects of core protein on macrophages, the peritoneal excluded macrophages were cultured with the same concentration (2 lg/ml) of LPS, rCore, rCore/D, rCore/2D, and rE proteins, separately. After 24-h treatment, the NO level in the culture supernatant was (A) Fig. 4 Effects of different JEV recombinant proteins on NO synthesis. Murine peritoneal macrophages were stimulated without or with 2 lg/ml LPS, rCore, rCore/D, rCore/2D, and rE, as indicated. Supernatants were collected after 24 h, and NO release was determined by the method of Griess. The data represent the mean ± SD of triplicate cultures determined by Griess method. The results show NO concentrations released from macrophages by PBS, LPS, rCore, rCore/D, rCore/2D, and rE proteins stimulation are 1.26 lM, 57.84 lM, 20.13 lM, 5.12 lM, 54.68 lM, and 1.03 lM, respectively (Fig. 4). Especially for rCore/2D (94.5%), the effect of induced macrophages to secrete a high level of NO is almost the same as LPS (100%). By contrast, the effect of rE-triggered NO release on macrophages is as low as the basal level of PBS control (Fig. 4). In this prokaryotic system, the recombinant JEV protein is produced with a His-tag on its N-terminus. In order to examine the interference with His- tag, the purified protein (His-tag, no insert) derived from pET32a (?) transformant was used as vector’s protein control, and there is no NOresponse in this test (data not shown). Macrophages activities by rCore/2D One of the major players of innate immunity is macrophage, and LPS is a potent activator of macrophages and (B) (C) kDa kDa M 1 2 3 4 M 1 2 3 4 M 1 2 3 39 26 26 19 Fig. 3 Purification, Western blotting, and time course analysis of recombinant core proteins. a Affinity column purification of recombinant core proteins by SDS-PAGE analysis. Lanes 1–4: pET TrxA-Tag no insert protein as control, rCore (34 kDa), rCore/D (31 kDa), and rCore/2D (25 kDa) in order. b Western blotting analysis of recombinant core proteins with His-Tag monoclonal Ab. Lanes 1–4: the same as figure A. c Time course analysis of rCore/2D. Lanes: 1–3, cells with 1 mM IPTG induction for 1, 3, and 5 h, respectively, at 37°C. M: protein molecular weight makers. The position of rCore/2D is indicated by arrowhead 123 Virus Genes 100 1600 80 70.38 57.84 54.68 60 40 25.79 21.97 20 13.46 12.68 10.45 0 4 2 1 0.5 1200 1006 1000 952 768 600 548 438 400 244 200 4 2 1 0.5 cell 1200 LPS rCore/2D 1529 1400 1253 1200 1126 1000 842 800 698 600 512 465 372 400 200 0 4 2 1 0.5 cell Concentration (µg/ml) may stimulate, through Toll-like receptor (TLR) signaling for inducing pro-inflammatory cytokine and chemokines production [18, 19]. In order to estimate the macrophages activities by rCore/2D, macrophages were treated with various concentrations (0.5, 1, 2 and 4 lg/ml) of rCore/2D and LPS separately. Supernatants were collected to determine the release of NO, TNF-a, IL-6, and IL-12 after 24and 48-h cultures. The results reveal that rCore/2D-stimulated macrophages secreted NO as well as proinflammatory cytokines (TNF-a, IL-6 and IL-12) of about 85–95% relative to LPS-stimulated cells in a dose-dependent manner (Fig. 5). Regulation of cytokine/chemokine promoter by recombinant JEV proteins In order to examine whether the recombinant JEV proteins possess regulatory activity on cytokine/chemokine promoters, we constructed three promoter–EGFP reporter plasmids (IL-2p–EGFP, IL-8p–EGFP, and TNF-ap–EGFP) to detect EGFP expression cells by flow cytometric analysis in this study. If promoter was activated by recombinant JEV protein, the EGFP would be expressed in transfected cells and detected under continuous high-intensity 488-nm irradiation. The results showed the rCore/2D and rCore/D could induce EGFP expression in reporter plasmid-transfected cells (IL-8p–EGFP and TNF-ap–EGFP, but not IL2p–EGFP), and the significant numbers of EGFP-expressing cells were 13.4% (rCore/2D: IL-8p–EGFP), 5.3% (rCore/D: IL-8p–EGFP), 12.2% (rCore/2D: TNF-ap– EGFP), and 4.1% (rCore/D: TNF-ap–EGFP), respectively, The level of IL-12 (pg/m The level of IL-6 (pg/m 895 800 Concentration (µg/ml) 1846 1800 1600 rCore/2D 1260 0 cell LPS 1400 Concentration (µg/ml) 2000 123 1438 rCore/2D The level of TNF-a (pg/m LPS 79.22 The level of NO (µM) Fig. 5 Comparison of macrophage activation between rCore/2D and LPS. Murine peritoneal macrophages were stimulated with various concentrations of rCore/2D and LPS as indicated. Supernatants were collected after 24 h for NO detection. IL-6, IL-12, and TNF-a levels were determined after 48 h. The data represent the mean ± SD of triplicate cultures 1000 LPS 1003 rCore/2D 852 800 729 622 600 438 400 358 315 298 200 0 143.4 4 2 1 0.5 cell Concentration (µg/ml) with curves of EGFP(?) cells (excited at 488 nm) being slightly more shifted to the right than the EGFP-negative population (absorbed at 475 nm) (Fig. 6). As to rE, it does not induce EGFP expression through up-regulation of cytokine/chemokine promoters in this experiment (Fig. 6). In prokaryotic expression system, the recombinant JEV E protein may not possess properly folding and glycosylation statuses. Therefore, we reconstructed JEV eukaryotic expression vectors to examine the effect of regulation of cytokine/chemokine promoter by core and E gene of JEV. In this study, GP2-293 cells were co-transfected with eukaryotic vector (pLN-Core/2D and pLN-E) and promoter–reporter plasmid (IL-2p–EGFP, IL-8p–EGFP, and TNF-ap–EGFP), respectively, to examine the effects of regulation of cytokine/chemokine promoter by flow cytometric analysis. The results also showed that the core gene could activate promoters of IL-8 and TNF-a but not IL-2; by contrast, E gene did not possess the ability to activate the promoters used in this study (Fig. 7). Discussion Japanese encephalitis (JE) is the most common form of viral encephalitis in Asia, and there is no antiviral treatment [1, 2]. The major players of innate immunity are macrophages and natural killer cells, which could produce NO and various cytokines for an efficient host defense response. NO has been suggested to be an important antiviral factors of innate immunity in controlling the initial stages of JEV infection and shown to inhibit JEV–RNA Virus Genes (A) IL-2p TNF-α p IL-8p PBS vector rE rCore/D rCore/2D EGFP EGFP EGFP (B) 16 14 EGFP-cells (%) Fig. 6 Regulation of cytokine/ chemokine promoters by JEV recombinant proteins. a JEV recombinant proteins (rCore/2D and rE) were added to GP2-293 cells which had transfected with promoter–EGFP reporter plasmids (IL-2p–EGFP, IL-8p– EGFP, and TNF-ap–EGFP), respectively, then EGFPexpressing cells were detected by flow cytometry after 48 h incubation. PBS added to test cells was as PBS control, and the purified protein (Trx-tag no insert) derived from pET vector transformants was as vector control. b The quantitation of relative percentage of EGFPexpressing cells presented in panel a. Results are shown as mean ± SD of triplicate cultures 13.4 12.2 12 PBS vector 10 rE 8 rCore/D 6 rCore/2D 5.3 4.1 4 2 15. 16. 1.6 1.5 1.4 1.5 1.7 1.6 1.5 1.6 1.6 0 IL-2p (A) pLN-E Core/2D (209 bp) CMVIE (B) TNF-α p E (1,500 bp) CMVIE pLN-Core/2D IL-2p IL-8p TNF-α p vector pLN-E pLN-Core/2D EGFP EGFP (C) 20 18 17.3 16.1 16 EGFP-cells (%) Fig. 7 Regulation of cytokine/ chemokine promoters by JEV eukaryotic plasmids, pLN-Core/ 2D or pLN-E. a Schematic presentation of two constructs (pLN-E and pLN-Core/2D) containing the JEV core and E genes and which are controlled by CMVIE promoter. b GP2293 cells were co-transfected with JEV eukaryotic construct (pLN-Core/2D and pLN-E) as well as promoter–EGFP reporter plasmid (IL-2p–EGFP and IL-8p-EGFP and TNF-apEGFP, respectively). After 48 h incubation, EGFP-expressing cells were analyzed by flow cytometry. Plasmid pLNCX2 (no insert) was used as vector control. c The quantitation of relative percentage of EGFPexpressing cells presented in panel b. Results are shown as mean ± SD of triplicate cultures IL-8p EGFP vector pLN-E pLN-Core/2D 14 12 10 8 6 4 2 0 1.7 1.6 0.5 0.5 0.7 0.4 0.6 IL-2p IL-8p TNF-α p synthesis, protein accumulation, and virus release in infected cells [2, 3, 20]. The synthesis of antiviral cytokines and chemokines, not only provides a first line of host defense against infection by generating an intracellular environment that restricts virus replication, but also signals the presence of viral pathogens to the adaptive immune 123 Virus Genes system [21]. Pro-inflammatory mediators (IL-6, IL-12, and TNF-a) are typical examples of multifunctional cytokines involved in the regulation of the immune response, hematopoiesis, and inflammation [4]. Although innate immunity can be mobilized to combat invading microorganism during the initial phase of infection, an unregulated pro-inflammatory response could be detrimental in flavivirus encephalitis [22]. The patients with clinical signs of brain swelling had significantly higher levels of NO, and there were correlations between levels of pro-inflammatory cytokines/chemokines (IL-6, IL-8, TNF-a) and fatal outcome during JE, but whether these are simply a correlate of severe disease or actually contribute to pathogenesis remains to be determined [4]. Many previous researches on neurovirulent flaviviruses suggest that the viral envelope (E) and capsid (core) proteins play important roles in neuropathogenesis [2, 10, 23]. In this study, we cloned and expressed JEV structural genes (core and E) to determine whether above viral proteins can directly trigger innate immune response by cytokines release from macrophages. It has been reported that JEV core protein was detected in both the cytoplasm and nucleoli of the infected cells, and that the mutant virus defective in the nuclear localization of capsid protein exhibited impaired viral growth in mammalian cells and neuroinvasiveness in mice [9]. The expressed WNV capsid protein, which localized to the nucleolus, was capable of binding to cellular Jab1 protein and translocating from nucleus to cytoplasm. The C-terminus of capsid protein would allow the ubiquitination process to occur in the presence of Jab1 and subsequently induce the degradation of capsid protein [17]. The aminoterminal region of capsid protein including Jab1-binding motif is well conserved between JEV and WNV, and it has been shown that JEV capsid protein can be cleaved of the amino-terminal 18 amino acids by cathepsin L. And this processing plays important roles in the viral replication in mouse neuroblastoma and macrophages and in the pathogenesis of encephalitis [14]. In our study, recombinant core proteins could be cleaved with cathepsin L at the N-terminal region of the capsid protein in the lysosome during uptake by macrophages through phagocytosis (Fig. 1) and escape from Jab1-facilitated degradation. Moreover, rCore/ 2D lacking NLS in the middle hydrophobic region, almost remained in cytoplasm rather than in nucleus (data not shown). Toll-like receptors (TLRs) have a crucial role in the detection of microbial infection in mammals. Activation of TLR may be involved in protecting the host from viruses. TLR-activated transcription factors cooperate to induce a huge number of effector genes, many of which have been shown to have roles in anti-viral innate immunity. Several reports reveal that many viral macromolecules can activate macrophages through TLRs, leading to induction of pro-inflammatory cytokines such as 123 TNF-a, IL-6, IL-8, IL-12 etc. [24–26]. Our results showed that recombinant JEV core protein, particularly rCore/2D but not E protein, could trigger a significant increase the production of IL -6, IL-8, IL-12, TNF-a, and NO in macrophages. Infection with WNV, the major structural protein E blocks the production of antiviral and pro-inflammatory cytokines triggering by TLR signaling, and impairs the innate immune response [27]. Recently, van Marle et al. reported that WNV core protein plays an important role in induction of neuroinflammatory genes by activation of glial cells and leads to neuronal injury and death [10]. These data show that JEV structural protein (core and E) may have similar effects as WNV in innate immune response. Because of JEV replication, products will accumulate in the cytosol during replication, and the endosomal TLR in phagocytic cells can detect viral products by phagocytosis of infected cell or debris from lysed cells. Our previous study has shown that the transient-expressed JEV E protein induced apoptosis in Vero cells [6–8] and that the core protein could cause cells to undergo necrosis (data not shown). In this study, the recombinant capsid protein may play as a ligand of TLR and trigger the pro-inflammatory mediators release in the absence of viral infection or cause necrotic cells to yield endogenous host-derived products such as heat shock proteins, and initiate inflammation and immune response, in contrast to apoptotic cell death, which does not trigger inflammation. Moreover, the pathway(s) responsible for activation of macrophages that are dependent and/or independent of TLR signaling by JEV core protein needs further investigation. In summary, this is the first study to report that the recombinant JEV core protein, but not envelope protein, could trigger the production of pro-inflammatory mediators on macrophages in the absence of the intact virus. The E protein appears to play a dominant role in generation of neutralizing antibodies and induction of adaptive immune response [28], whereas the core protein initiates the innate immune response and provides the first line of host defense in JEV infection. Further understanding of the role played by viral proteins during JEV infection may lead to new treatment of JEV-induced immune-mediated encephalitis. Acknowledgments We thank Professor Min-Liang Wong (Department of Veterinary Medicine, National Chung-Hsing University) for critical reading of our manuscript, and Dr. Chia-Hsien Chang for expert technical assistance. This study was supported by CMU95-084 and CMU94-104 of China Medical University, Taiching, Taiwan. References 1. D.W. Vaughn, C.H. Hoke Jr., Epidemiol. Rev. 14, 197 (1992) 2. A. Ghoshal, S. Das, S. Ghosh, M.K. Mishra, V. Sharma, P. Koli, E. Sen, A. Basu, Glia 55, 483 (2007). doi:10.1002/glia.20474 Virus Genes 3. Y.L. Lin, Y.L. Huang, S.H. Ma, C.T. Yeh, S.Y. Chiou, L.K. Chen, C.L. Liao, J. Virol. 71, 5227 (1997) 4. P.M. Winter, N.M. Dung, H.T. Loan, R. Kneen, B. Wills, T. Thu le, D. House, N.J. White, J.J. Farrar, C.A. Hart, T. Solomon, J. Infect. Dis. 190, 1618 (2004). doi:10.1086/423328 5. J.J. Liu, T.H. Tsai, T.J. Chang, M.L. Wong, Virus Genes 26, 193 (2003). doi:10.1023/A:1023443631659 6. S.O. Chen, T.H. Tsai, T.J. Chang, M.L. Wong, H.P. Su, J.J. Liu, Virus Genes 28, 215 (2004). doi:10.1023/B:VIRU.0000016861. 78378.9b 7. L.K. Chen, Y.L. Lin, C.L. Liao, C.G. Lin, Y.L. Huang, C.T. Yeh, S.C. Lai, J.T. Jan, C. Chin, Virology 223, 79 (1996). doi: 10.1006/viro.1996.0457 8. S.O. Chen, T.J. Chang, G. Stone, C.H. Chen, J.J. Liu, Intervirology 49, 346 (2006). doi:10.1159/000095154 9. Y. Mori, T. Okabayashi, T. Yamashita, Z. Zhao, T. Wakita, K. Yasui, F. Hasebe, M. Tadano, E. Konishi, K. Moriishi, Y. Matsuura, J. Virol. 79, 3448 (2005). doi:10.1128/JVI.79.6.34483458.2005 10. G. van Marle, J. Antony, H. Ostermann, C. Dunham, T. Hunt, W. Halliday, F. Maingat, M.D. Urbanowski, T. Hobman, J. Peeling, C. Power, J. Virol. 81, 10933 (2007). doi:10.1128/JVI.02422-06 11. F.W. Studier, A.H. Rosenberg, J.J. Dunn, J.W. Dubendorff, Methods Enzymol. 185, 60–89 (1990). doi:10.1016/0076-6879 (90)85008-C 12. S.H. Fang, Y.C. Hou, W.C. Chang, S.L. Hsiu, P.D. Chao, B.L. Chiang, Life Sci. 74, 743 (2003). doi:10.1016/j.lfs.2003.07.017 13. L.C. Green, D.A. Wagner, J. Glogowski, P.L. Skipper, J.S. Wishnok, S.R. Tannenbaum, Anal. Biochem. 126, 131 (1982). doi:10.1016/0003-2697(82)90118-X 14. Y. Mori, T. Yamashita, Y. Tanaka, Y. Tsuda, T. Abe, K. Moriishi, Y. Matsuura, J. Virol. 81, 8477 (2007). doi:10.1128/ JVI.00477-07 15. C.T. Jones, L. Ma, J.W. Burgner, T.D. Groesch, C.B. Post, R.J. Kuhn, J. Virol. 77, 7143 (2003). doi:10.1128/JVI.77.12.71437149.2003 16. H.N. Tseng, C.C. Lee, M.L. Wong, S.O. Chen, J.J. Liu, Virus Genes 35, 483 (2007). doi:10.1007/s11262-006-0075-7 17. W. Oh, M.R. Yang, E.W. Lee, K.M. Park, S. Pyo, J.S. Yang, H.W. Lee, J. Song, J. Biol. Chem. 281, 30166 (2006). doi: 10.1074/jbc.M602651200 18. S. Akir, Adv. Immunol. 78, 1 (2001). doi:10.1016/S00652776(01)78001-7 19. A.G. Bowie, Clin. Exp. Immunol. 147, 217 (2007) 20. S.K. Saxena, A. Singh, A. Mathur, Int. J. Exp. Pathol. 81, 165 (2000). doi:10.1046/j.1365-2613.2000.00148.x 21. T. Akaike, H. Maeda, Immunology 101, 300 (2000). doi: 10.1046/j.1365-2567.2000.00142.x 22. V. Ravi, S. Parida, A. Desai, A. Chandramuki, M. Gourie-Devi, G.E. Grau, J. Med. Virol. 51, 132 (1997). doi:10.1002/(SICI) 1096-9071(199702)51:2\132::AID-JMV8[3.0.CO;2-8 23. D.W. Beasley, M.C. Whiteman, S. Zhang, C.Y. Huang, B.S. Schneider, D.R. Smith, G.D. Gromowski, S. Higgs, R.M. Kinney, A.D. Barrett, J. Virol. 79, 8339 (2005). doi:10.1128/JVI.79.13. 8339-8347.2005 24. S. Akira, H. Hemmi, Immunol. Lett. 85, 85 (2003). doi: 10.1016/S0165-2478(02)00228-6 25. S. Akira, Curr. Top. Microbiol. Immunol. 311, 1 (2006). doi: 10.1007/3-540-32636-7_1 26. M. Majewska, M. Szczepanik, Postepy Hig. Med. Dosw. 60, 52 (2006) 27. A. Arjona, M. Ledizet, K. Anthony, N. Bonafe, Y. Modis, T. Town, E. Fikrig, J. Immunol. 179, 8403 (2007) 28. S.C. Chia, P.S. Leung, C.P. Liao, J.H. Huang, S.T. Lee, Microb. Pathog. 31, 9 (2001). doi:10.1006/mpat.2001.0442 123