Download Functional consequences of the human DMT1 (SLC11A2) mutation

RED CELLS
Brief report
Functional consequences of the human DMT1 (SLC11A2) mutation on protein
expression and iron uptake
Monika Priwitzerova, Guangjun Nie, Alex D. Sheftel, Dagmar Pospisilova, Vladimir Divoky, and Prem Ponka
We have previously described a case of
severe hypochromic microcytic anemia
caused by a homozygous mutation in the
divalent metal transporter 1 (DMT1
1285G > C). This mutation encodes for an
amino acid substitution (E399D) and
causes preferential skipping of exon 12
during processing of the DMT1 mRNA. To
examine the functional consequences of
this mutation, full-length DMT1 transcript
with the patient’s point mutation or a
DMT1 transcript with exon 12 deleted was
expressed in Chinese hamster ovary
(CHO) cells. Our results demonstrate that
the E399D substitution has no effect on
protein expression and function. In contrast, deletion of exon 12 led to a decreased expression of the protein and
disruption of its subcellular localization
and iron uptake activity. We hypothesize
that the residual protein in hematopoietic
cells represents the functional E399D
DMT1 variant, but because of its quantitative reduction, the iron uptake activity of
DMT1 in the patient’s erythroid cells is
severely suppressed. (Blood. 2005;106:
3985-3987)
© 2005 by The American Society of Hematology
Introduction
Divalent metal transporter 1 (DMT1) protein (also called Nramp2,
DCT1, and SLC11A2) plays a crucial role in intestinal iron (Fe2⫹)
absorbtion1,2 and iron transport across the membrane of acidified
endosomes.3 DMT1 is an integral membrane protein composed of
12 predicted transmembrane domains (TM) and containing 2
putative glycosylation sites in an extracytoplasmic loop, membrane
targeting motifs, and a consensus transport motif.4,5 Recently,
Touret et al6 demonstrated that the G185R DMT1 mutant protein
found in microcytic anemia (mk) mice7 and the Belgrade (b) rats8 is
abnormally processed, less stable, and displays decreased transport
activity. We previously reported a Czech female with severe
hypochromic microcytic anemia and iron overload caused by a
homozygous mutation in the DMT1 gene (1285G ⬎ C) that
changes Glu 399 to Asp (E399D).9,10 This single nucleotide
substitution also causes preferential skipping of exon 12 during
mRNA processing. As a consequence, there are 2 different DMT1
transcripts present in the patient’s cells: a full-length transcript
containing the point mutation and that missing exon 12; the later
version comprising 90% of the total DMT1 mRNA. This shorter
transcript is in low levels present also in normal control erythroid
cells, but it was not detected in duodenum of control subjects.10
Here, we show that DMT1 protein levels in the patient’s peripheral
blood cells and in her burst-forming unit erythroid (BFU-E)
colonies are markedly decreased. Additionally, we investigate the
functional consequences of the patient’s mutation by expressing
From the Departments of Biology, Pediatrics and Hemato-oncology, Faculty of
Medicine Palacky University, Olomouc, Czech Republic; and Lady Davis
Institute for Medical Research, Jewish General Hospital, Montreal, QC,
Canada.
Submitted April 15, 2005; accepted July 31, 2005. Prepublished online as
Blood First Edition Paper, August 9, 2005; DOI 10.1182/blood-2005-04-1550.
Supported by the Canadian Institutes for Health Research (M.P., G.N., A.D.S.,
and P.P.) and by the Czech Republic Ministry of Health grant NR/7799-3 and
Ministry of Education grant MSM 6198959205 (M.P., D.P., and V.D.).
M.P. conducted and designed the experiments and wrote the report; G.N.
initiated and designed a part of the experiments; A.D.S. helped with confocal
microscopy and the iron uptake study and contributed to the editing of the
BLOOD, 1 DECEMBER 2005 䡠 VOLUME 106, NUMBER 12
different versions of DMT1 in cultured cells and thereby show that
both the expression and function of DMT1 protein are disturbed by
this mutation.
Study design
Processing of peripheral blood cells
Blood samples of the patient, her heterozygous parents, and healthy donors
were obtained with informed consent. The ethics committee of the Palacky
University Hospital approved the study. Peripheral blood was collected in
heparinized tubes and processed for in vitro colony-forming assay9 and for
Western blot analyses. Red blood cells were removed by treatment with
NH4Cl. After 2 washes with phosphate-buffered saline (PBS), the protein
extracts were prepared by resuspending the cells in 200 ␮L TNE buffer11
(100 mM NaCl; 10 mM Tris [tris(hydroxymethyl)aminomethane]-Cl, pH
7.0; 10 mM EDTA [ethylenediaminetetraacetic acid]) containing a cocktail
of protease inhibitors (Sigma, Oakville, Canada) followed by centrifugation
at 13 800g for 10 minutes. Protein concentration was determined by
Bradford assay.
Cell culture and transfection
Chinese hamster ovary LR73 (CHO LR73) cells and the Caco-2 cells were
grown as described.6,12 The human DMT1 cDNA (non-IRE isoform,
generous gift from Dr J. T. Prchal, Baylor College of Medicine, Houston,
TX) was tagged by C-terminal HA epitope and inserted into the expression
report; D.P. was responsible for the treatment of the patient and collection of the
samples and contributed to the editing of the report; V.D. conceived the study,
contributed to ideas in this report, and contributed to the writing of the report;
P.P. conceived and designed the study and contributed to the writing of the
report.
Reprints: Prem Ponka, Lady Davis Institute for Medical Research, Jewish
General Hospital, 3755 Cote Ste-Catherine Rd, Montreal, H3T 1E2, Quebec,
Canada; e-mail: [email protected].
The publication costs of this article were defrayed in part by page charge
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734.
© 2005 by The American Society of Hematology
3985
3986
PRIWITZEROVA et al
BLOOD, 1 DECEMBER 2005 䡠 VOLUME 106, NUMBER 12
plasmid pcDNA3.1(⫺) (Invitrogen, Burlington, Canada). Site-directed
mutagenesis was performed using the QuikChange and ExSite kits (Stratagene,
La Jolla, CA) and allele-specific oligonucleotides: 5⬘GGCCAGTTTGTCATGGACGGATTCCTGAACCTA3⬘, 5⬘TAGGTTCAGGAATCCGTCCATGACAAACTGGCC3⬘ to create E399D DMT1; 5⬘CCCTTTGTAGATGTCCACAGCCAGTGT3⬘, 5⬘GGATTCCTGAACCTAAAGTGGTCACGC⬘3 to create
DEL DMT1. Transfections of CHO cells with WT DMT1, E399D DMT1, DEL
DMT1, and empty vectors were performed using lipofectamine reagent (Invitrogen). Clones of stable transfectants were selected as previously described.13
Immunoblot analysis
Total cell lysates from CHO-transfected cells were prepared as described
for peripheral blood cells (see “Processing of peripheral blood cells”).
Crude membrane fractions were isolated as previously described.11 Protein
lysates were separated by sodium dodecyl sulfate–polyacrylamide gel
electrophoresis (SDS-PAGE) (10%) and transferred to nitrocellulose membranes (Bio-Rad, Hercules, CA). Immunoblots were incubated with primary antibodies: goat anti-Nramp2 antibody (N-20, Santa Cruz Biotechnology, Santa Cruz, CA) or mouse anti-HA antibody (F-7; Santa Cruz
Biotechnology). The immune complexes were visualized using Super
Signal West Dura Chemiluminescent Substrate (Pierce, Rockford, IL).
Immunofluorescence
Harvested BFU-Es were cytospun, and CHO-transfected cells were seeded
in 60-mm plates containing coverslips. The cells were fixed and permeabilized using ice-cold methanol-acetone (1:1) solution. The protein expression
was analyzed using goat anti-Nramp2 (N-20) or mouse anti-HA (F-7)
antibody. For the subcellular localization experiments, these primary
antibodies were used: rabbit anti–early endosomal antigen 1 antibody
(EEA1; Alexis, Montreal, Canada) and rabbit anti–calnexin antibody
(Stressgen, Victoria, Canada). The slides were analyzed by immunofluorescence or confocal microscopy.
59Fe
uptake by CHO cells
The reduction of 59Fe(III) to 59Fe(II) was accomplished by addition of
56FeSO (10-fold excess) to 59FeCl in 0.1 M HCl. Thirty-six hours after
4
3
transfection cells were washed twice with PBS prewarmed to 37°C and
incubated in 2 mL of prewarmed incubation buffer (25 mM Tris, 25 mM
4-morpholineethanesulfonic acid [MES], 140 mM NaCl, 5.4 mM KCl,
5 mM glucose, 1.8 mM CaCl2, pH 6.0) containing 10 ␮M 59Fe(II) and
0.44 mM sodium ascorbate at 37°C for 5, 20, and 60 minutes. The 59Fe
uptake was terminated by 3 washes with ice-cold PBS. Cells were detached
and membrane-associated 59Fe was removed using 30 minutes’ incubation
(4°C) in 2 mL PBS containing 1 mg/mL pronase plus 5 mM EDTA.14
After 2 additional washes with PBS, the 59Fe radioactivities were
measured in a gamma counter (Packard Cobra II auto-gamma; PerkinElmer, Wellesley, MA).
Results and discussion
The effect of the DMT1 1285G ⬎ C mutation on the level of
protein expression was initially studied in peripheral blood cells.
Immunoblotting with an anti-Nramp2 antibody revealed a 64-kDa
protein band (Figure 1A), which corresponded to a band seen in the
protein extract of Caco-2 cells. The level of DMT1 expression in
the patient’s cells was clearly decreased compared to her heterozygous parents. Subsequent immunofluorescence analysis on cytospun BFU-Es revealed decreased abundance of DMT1 on the
surface of the patient’s erythroblasts compared to normal control
BFU-E–derived erythroblasts (Figure 2A). These findings suggest
that the mechanism of the patient’s hypochromic microcytic
anemia involves quantitative DMT1 protein reduction.
To evaluate the consequences of the patient’s mutation on the
functional properties of the DMT1 protein, CHO cells were
Figure 1. Expression of DMT1 and iron uptake study. (A) Western blot analysis of
peripheral blood cell lysates (90 ␮g) and Caco-2 cells lysate (30 ␮g) with primary goat
anti-Nramp2 antibody (1/1000, 16 hours, 4°C) and peroxidase-conjugated secondary
antibody (Pierce; 1/1000, 90 minutes, room temperature). The 64-kDa band represents the DMT1 protein; lane 1, Caco-2; lane 2, patient’s father; lane 3, patient’s
mother; lane 4, patient. (B-C) Western blot analysis of total cell lysates (30 ␮g) and
crude membrane extracts (50 ␮g) from CHO cells expressing the empty vector
(CHO), WT, E399D, and DEL forms of HA-tagged DMT1 with mouse anti-HA antibody
(1/1000, 1 hour, room temperature) and peroxidase-conjugated secondary antibody
(1/1000, 90 minutes, room temperature). Mature complex-glycosylated DMT1 form
(90 to 100 kDa; ) and the core-glycosylated form of DMT1 (66 kDa; Š) are indicated.
Equal loading of proteins was assessed by probing with an antibody against ␤-actin
or ␣-tubulin (1/1000, 1 hour, room temperature). Representative immunoblots of
3 separate experiments are illustrated. (D) Iron transport activities of WT, E399D, and
DEL DMT1 incubated in pH 6.0 incubation buffer with 59Fe(II)-ascorbate (10 ␮M
59Fe). Iron uptake is expressed as intracellular 59Fe (cpm per 106 cells). “CHO empty”
represents iron uptake by cells transfected with empty vector. Data shown are the
means ⫾ SD of duplicate determinations from a typical experiment that was
performed 3 times.
transiently transfected with HA-tagged expression constructs encoding WT DMT1, E399D DMT1, or DEL DMT1. Western blotting
with mouse anti-HA antibody revealed 2 bands in CHO cells
expressing WT or E399D DMT1 (Figure 1B), representing the
mature complex-glycosylated form (90 to 100 kDa) and the
core-glycosylated form (66 kDa) of DMT1 as it has previously
been shown for HA-tagged mouse Nramp2.13 In CHO cells
expressing the DEL DMT1, only the core-glycosylated form of the
protein was detectable (Figure 1B). The absence of complex
glycosylation of this protein product is not unexpected since
deletion of exon 12 removes TM domain 8; the 2 putative
glycosylation sites in DMT1 are present in an extracytoplasmic
loop between TM7 and TM8.4 To assess the possibility that the
mutation can interfere with the membrane targeting of the protein,
crude membrane extracts from CHO-transfected cells were prepared. Subsequent immunoblot analysis revealed the same 2
DMT1 species as detected in total cell lysates (Figure 1C). These
results demonstrate that the E399D substitution has no effect on
protein expression, its glycosylation, or membrane targeting. A
very weak band of core-glycosylated protein also was present in the
membrane extract from CHO cells transfected with DEL DMT1.
This could either indicate that a small fraction of the protein is
targeted to the membrane, or it may represent a fraction of the
immature protein present in the endoplasmic reticulum (ER).15 The
cellular distribution of the proteins revealed the same pattern of
DMT1 staining for WT and E399D DMT1 transfectants (Figure
BLOOD, 1 DECEMBER 2005 䡠 VOLUME 106, NUMBER 12
Figure 2. Immunofluorescence analysis of DMT1 in BFU-E–derived erythroblasts and transfected CHO cells. (A) Day 14 healthy control and the patient’s
BFU-Es were harvested, cytospun, and stained using goat anti-Nramp2 antibody
(1/50, 3 hours, room temperature) and fluorescein isothiocyanate (FITC)–conjugated
secondary antibody (Molecular Probes, Eugene, OR; 1/1000, 90 minutes, room
temperature). (B) Immunostaining of WT (i-ii), E399D (iii-iv) and DEL (v-vi) DMT1 in
transiently transfected CHO cells with mouse anti-HA antibody (1/200, 1 hour, room
temperature) and FITC-conjugated secondary antibody (1/1000, 1 hour, room
temperature). (C) Subcellular localization of E399D DMT1 in early endosomes (i-iii)
and DEL DMT1 in the endoplasmic reticulum (iv-vi) in stably transfected CHO cells.
Cells immunostained with mouse anti-HA antibody and with FITC-conjugated
secondary antibody were subsequently stained either with anti-EEA1 antibody
(1/200, 1.5 hours, room temperature) or anti–calnexin antibody (1/200, 1.5 hours,
room temperature) followed by incubation with red-fluorescent–conjugated secondary antibody (Alexa Fluor 594, Molecular Probes; 1/1000, 1.5 hours, room temperature). In panels A and C the cells were visualized on an Olympus BX 50 fluorescence
microscope (Olympus, Hamburg, Germany) using a 100 ⫻/1.3 numeric aperture
(NA) oil immersion objective. Digital images were acquired with an Olympus DP
50 camera driven by the software Viewfinder Lite version 1.0.135 (Pixera, Los
Gatos, CA). Original magnifications, ⫻ 1000. In panel B the cells were examined
on a Zeiss Pascal 5 confocal microscope (Carl Zeiss, Jena, Germany) using a
40 ⫻/0.75 NA objective (i, iii, v) and a 63 ⫻/1.4 NA oil immersion objective (ii, iv,
vi). The Zeiss LSM Browser version 3.2.0 115 was used for handling pictures.
Images were cropped, assembled, and labeled using Adobe Photoshop software
(Adobe Systems, San Jose, CA).
2Bi-iv), suggesting that the E399D amino acid substitution has no
effect on the protein cellular targeting. On the other hand, only a
faint signal was observed in CHO cells transfected with DEL
DMT1 (Figure 2Bv-vi). These expression patterns were not unique
to CHO cells, as the same results were obtained using H1299 cells
expressing WT, E399D, and DEL DMT1 (data not shown).
FUNCTIONAL CONSEQUENCES OF HUMAN DMT1 MUTATION
3987
To evaluate the iron uptake properties of the E399D and DEL
DMT1 proteins, CHO transfectants were exposed to 59Fe(II) and
the internalized radioactivity evaluated. The capacity of WT DMT1
and E399D DMT1 to transport iron was comparable (Figure 1D).
In contrast, DEL DMT1–transfected CHO cells exhibited no
increase in iron uptake, suggesting that deletion of exon 12
abolishes the iron transport function of DMT1.
The absence of the complex-glycosylated form of DEL DMT1
together with the immunofluorescence analysis and the iron uptake
experiments in the transiently transfected cells suggested that the
cellular trafficking of DEL DMT1 could be erroneous. To determine the subcellular protein localization and to overcome the DEL
DMT1 borderline level of expression, stable transfectants expressing WT, E399D, and DEL DMT1 were selected and subjected to
immunofluorescence analyses. The observed punctate intracellular
staining for WT (not shown) and E399D DMT1 is consistent with
the localization of these proteins in early endosomes, which was
confirmed using an antibody against EEA1 (Figure 2Ci-iii). In
contrast, the DEL DMT1 subcellular localization exhibited overlapping pattern with calnexin, an ER marker (Figure 2Civ-vi). These
data show that disrupted complex glycosylation of DEL DMT1
results in retention of the immature form of this protein in the ER.
The observed quantitative DMT1 protein reduction in the patient’s
bone marrow erythroblasts9 and in the patient’s BFU-Es indicates
that the stability of DEL DMT1 protein might be reduced. As only
10% of the total DMT1 transcript in the patient’s erythroid cells
encodes for a fully functional E399D protein, it is likely that the
erythroid iron use is severely suppressed. The definite cause of the
patient’s concomitant liver iron overload remains elusive. Our
group has previously shown that the total mRNA level of DMT1 in
the patient’s duodenum are probably not affected and that DMT1
protein expression might even be increased.10 However, it is
difficult to make definitive conclusions as both intra-individual and
inter-individual differences in the level of DMT1 expression in the
duodenum, reflecting the body iron stores and recent iron content in
the diet, may exist. Nevertheless, we believe that the liver
hemosiderosis evolved as a result of the alteration of a few
processes, including activation of heme absorption9 and increased
activity of the basolateral iron transport.10
References
1. Gunshin H, Mackenzie B, Berger UV, et al. Cloning
and characterization of a mammalian proton-coupled
metal-ion transporter. Nature. 1997;388:482-487.
2. Canonne-Hergaux F, Gruenheid S, Ponka P,
Gros P. Cellular and subcellular localization of the
Nramp2 iron transporter in the intestinal brush
border and regulation by dietary iron. Blood.
1999;93:4406-4417.
3. Canonne-Hergaux F, Zhang AS, Ponka P, Gros P.
Characterization of the iron transporter DMT1
(NRMAP2/DCT1) in red blood cells of normal and
anemic mk/mk mice. Blood. 2001;8:3823-3830.
4. Lee P, Gelbart T, West C, Halloran C, Beutler E.
The human Nramp2 gene: characterization of the
gene structure, alternative splicing, promoter region and polymorphisms. Blood Cells Mol Dis.
1998;24:199-215.
5. Picard V, Govoni G, Jabado N, Gros P. Nramp 2
(DCT1/DMT1) expressed at the plasma membrane transports iron and other divalent cations
into a calcein-accessible cytoplasmic pool. J Biol
Chem. 2000;275:35738-35745.
6. Touret N, Martin-Orozco N, Paroutis P, et al. Molecular and cellular mechanisms underlying iron
transport deficiency in microcytic anemia. Blood.
2004;104:1526-1533.
7. Fleming MD, Trenor CC 3rd, Su MA, et al. Microcytic anaemia mice have a mutation in Nramp2, a
candidate iron transporter gene. Nat Genet.
1997;16:383-386.
8. Fleming MD, Romano MA, Su MA, Garrick LM,
Garrick MD, Andrews NC. Nramp2 is mutated in
the anemic Belgrade (b) rat: evidence of a role for
Nramp2 in endosomal iron transport. Proc Natl
Acad Sci U S A. 1998;95:1148-1153.
9. Priwitzerova M, Pospisilova D, Prchal JT, et al.
Severe hypochromic microcytic anemia caused
by a congenital defect of the iron transport pathway in erythroid cells. Blood. 2004;103:39913992.
10. Mims MP, Guan Y, Pospisilova D, et al. Identification of a human mutation of DMT1 in a patient
with microcytic anemia and iron overload. Blood.
2005;105:1337-1342.
11. Lam-Yuk-Tseung S, Govoni G, Forbes J, Gros P.
Iron transport by Nramp2/DMT1: pH regulation of
transport by 2 histidines in transmembrane domain 6. Blood. 2003;101:3699-3707.
12. Elisma F, Jumarie C. Evidence for cadmium uptake through Nramp2: metal speciation studies
with Caco-2 cells. Biochem Biophys Res Commun. 2001;285:662-668.
13. Touret N, Furuya W, Forbes J, Gros P, Grinstein
S. Dynamic traffic through the recycling compartment couples the metal transporter Nramp2
(DMT1) with the transferrin receptor. J Biol Chem.
2003;278:25548-25557.
14. Graham RM, Morgan EH, Beker E. Ferric citrate
uptake by cultured rat hepatocytes is inhibited in
the presence of transferrin. Eur J Biochem. 1998;
264:272-274.
15. Tabushi M, Tanaka N, Nishida-Kitayama J, et al.
Alternative splicing regulates the subcelluar localization of divalent metal transporter 1 isoforms.
Mol Biol Cell. 2002;13:4371-4387.