* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Protein export elements from Lactococcus lactis
Non-coding DNA wikipedia , lookup
DNA vaccination wikipedia , lookup
Primary transcript wikipedia , lookup
Microevolution wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Genetic code wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Genomic library wikipedia , lookup
History of genetic engineering wikipedia , lookup
Protein moonlighting wikipedia , lookup
Expanded genetic code wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Point mutation wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Helitron (biology) wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Mol Gen Genet (1992) 234:401-411 MGG <9 Springer-Verlag Protein export elements from Lactococcus 1992 lactis Gaspar Perez-Martinez*, Jan Kok, Gerard Venerna, Jan Maarten van Dijl, Rilde Srnith**, and Sierd Bron Departmentof Genetics,Centreof Biological Sciences,Kerklaan 30, 9751NN Haren, The Netherlands Received November 21, 1991 / Accepted Apri114, 1992 Summary. Broad-host-range plasmids carrying a-amylase or 13-lactamasereporter genes lacking a signal sequencewereusedto selectexport elementsfrom Lactococcuslactis chromosomal DNA that could function as signal sequences.Fragments containing such elements were identified by their ability to direct the export of the reporter proteins in Escherichiacoli. Severalof the selected export elements were also active in Bacillus subtilis and L.lactis, although the efficienciesdependedstrongly on the host organism and reporter geneused.The export elementsAL9 and BLl were highly efficient in L. lactis in the expressionand secretion of at least two heterologous proteins (Bacil/us licheniformis a-amylase and E. coli TEM-13-lactamase).AL9 even permitted growth of this organism on starch as the sole carbon source. Nucleotide sequenceanalysis of five selectedfragments indicated that theseencodeoligopeptides with the major characteristics of typical signal peptides. The putative expressionsignals had a limited similarity to previously described expression signals for E. coli, B. subtilis and L. lactis. Differences in both expressionand export efficiency are likely to underlie the host-specific effects. Key words: Lactococcus protein export -Expression nals -Signal peptide -a-amylase -13-lactamase sig- Introduetion Knowledge of the geneticsand physiology of lactic acid bacteria has rapidly increasedduring the last few years. In particular, the availability of molecular genetictechniques has contributed in a major way to our knowledge of theseindustrially important bacteria, which are widely .Present Alimentos address; Instituto de Agroquimica y Technologia (C.S.I.C.), Jaime Roig 11,46010 Valencia, Spain ..Present address; Central Veterinary 8219 PH Lelystad, The Netherlands Correspondence to; S. Bron Institute, Edelhertweg de 15, used in the food industry .Potential new applications of these organisms are the production of (heterologous) extracellular proteins and pharmaceuticals.Although, so far, the natural protein export capacity of lactic acid bacteria has scarcely been studied, these bacteria are known to export several proteins, some of which are secretedinto the growth medium. Thus, lactococci export a cell wall-associatedserine proteinase essentialfor rapid growth in milk (Kok and Venerna 1988),and they secrete Usp45, a protein of unknown function (van Asseldonk et al. 1990). With respect to heterologous proteins, it has been shown that Lactobacillusplantarum is able to secreteBacillus stearothermophilusa-amylase and Clostridium thermocellumcellulase A, using the native signal peptides of these proteins (Scheilink et al. 1989). The secretion by Lactococcus lactis of Bacillus subtilis neutral protease fused to a lactococcal promoter was demonstrated by van de Guchte et al. (1990). Escherichia coli TEM-13-lactamase,when joined to lactococcal expression/exportsignals, can also be secretedby L. lactis (Sibakov et al. 1991). Exported proteins are initial1y synthesizedas precursors with an N-terminal extension, the signal peptide. The signal peptide is required to guide the protein into the export pathway by interacting with components of the cel1ular export machinery and the membrane (for reviewsseeSaier et al. 1989; Wickner et al. 1991).Moreover, the presenceof the signal peptide retards the folding of the precursor (Laminet and Pliickthun 1989; Park et al. 1988), which appears to be important for export competence (Saier et al. 1989; Wickner et al. 1991). Although signal peptides from different exported proteins have little sequencehomology , they have a tripartite structure in common: a short (5-8 amino acids) positiveIy charged amino-terminus (n-region) ; a central hydrophobic core (R-region; 8-15 amino acids); and a short (5-8 amino acids) more polar c-region that contains the cleavagesite for signal peptidase (SPaseI; von Heijne 1986,1990).A comparison ofsignal peptidesfrom E. coli and bacil1i was made by von Heijne and Abrahmsén (1989). On average, signal peptides from bacil1i are 402 slightly longer in the n-, h- and c-regions than those from E. coli, and the n-region in bacilli is generally more highly charged. Analyses of signal peptides from lactic acid bacteria have only recently begun. In addition to signal sequences of L. lactis proteinase genes (Kok et al. 1988), a number of randomly selected lactococcal DNA fragments have recently beeen described that direct the export of proteins (Sibakov et al. 1991). The primary aim of the studies reported here was to isolate and characterize DNA fragments from the L. lactis chromosome that could function as signal sequences. Such export elements are valuable for the construction of efficient expression/export vectors for L. lactis. A considerable number of export elements with signal sequence function were selected from L. lactis in a similar way to that described previously for Bacillus (Smith et al. 1987, 1988, 1989). For this purpose plasmids were used that encode mature parts of exoproteins but not the signal peptides. Some of these export elements wer highly efficient in L. lactis. The selected fragments permitted a comparison of expression/secretion efficiencies in E. coli, L. lactis and B. subtilis. Matcrials and mcthods Bacterial strains, plasmids and media. Table 1 lists the bacterial strains and plasmids used. TY medium was used for culturing E. coli and B. subtilis (Bron and Luxen 1985), and MI7 medium supplemented with 0.5% glucose for culture of L.lactis (Kok et al. 1984). Ifrequired, I % starch was added to the media. Erythromycin was used at 5 ~g/ml for L. lactis and B. subtilis, and at 200 ~g/ml for E. coli. To score for ~-lactamase export in E. coli, 5 ~g/ml of ampicillin (Amp) (plus 100 ~g/ml erythromycin to select for the plasmid) were used in the initial screening. E. coli was transformed using standard procedures (Maniatis et al. 1982), B. subtilis by the competent cell procedure (Bron and Luxen 1985), and pGB14 pGBl8 pGAL(9, 39) pGBL(I, 11, 13) L. lactis 1988). by electrotransformation (van der ,elie et al DNA techniques. General procedures for tbe manipulation of DNA were carried out essentially as described by Maniatis et al. (1982). Restriction enzymes and T4 DNA ligase, obtained from Boebringer (Mannbeim, FRG), or New England BioLabs (Beverly, Mass.), were used as specified by tbe suppliers. Nucleotide sequences of botb strands of DNA were determined by tbe dideoxy cbaintermination metbod (Sanger et al. 1977) using tbe T7 DNA polymerase sequencing kit (Pbarmacia LKB, Uppsala, Sweden). Eitber M 13mp 1O/mp 11 subclones or pGA1 4/pGB14 derivatives were used in sequencing. Mapping oftbe 5' termini ofmRNA by primer extension witb reverse transcriptase was performed as described by Calzone et al. (1987). mRNA was isolated from L. lactis MG 1363 carrying tbe appropriate plasmids as previously described (van der Vossen et al. 1987). Enzymatic assays. AII enzymatic activities were determined in exponentially growing cells at an optical density of 0.6 at 600 nm. 13-Lactamase and isocitrate dehydrogenase activities were measured as described by Smith et al. (1987). 13-Galactosidase was determined by the method of Milier (1972), phosphoglucose isomerase by that of Michal (1984) and a~amylase activity was determined using the procedure of Spiro (1966). Spheroplasting. The contens of the periplasmic space were released from E. coli cells by treatment for 30 min at 37° C with 5 mg/ml of lysozyme in 0.1 M potassium phosphate buffer, pR 7.5 plus 10 mM EDT A and 0.3 M sucrose. Under these conditions no /3-galactosidase activity was released into the medium, indicating that the E. coli cells remained intact during spheroplasting. 803supE supF met rk-mkRNAse Ith, leu thi lac y tonA phx supE vt, lac p,tP his np,R2 np,El8 ap,AJ a-Amylase negative derivative of strain DBIO4 K. Murray de Vrije et al. (1987) Raleigh et al. (1988) Laboratory collection Kawamura and Doi (1984) Laboratory collection a-Amylase-based vector for selection of export elements; pWVOI replicon; contains SPO2 promoter; Emr ~-Lactamase-based vector for selection of export elements; pWVOI replicon; Emr pGBI4 containing the SPO2 promoter pGAI4 derivatives containing the AL9 (AL39) inserts directing export of a-amylase pGBl4 derivatives containing the BLI (BLil, BLI3) inserts directing export of ~-Iactamase This work This work This work This work This work 403 Results We define stages in protein export according to Pugsley and Schwartz (1985): export, the translocation ofprecursor proteins to an extracytoplasmic location, including the cytoplasmic membrane; processing, the removal of the signal peptide by signal peptidase; secretion, the special case of export that results in the extracellular accumulation of exported proteins. In the context of the present studies, we define export elements as signal sequence-like functions enabling the export (translocation) of reporter exoproteins across the cytoplasmic membrane. As discussed in the following section, the presence of a processing site for signal peptidase was not required for all of the export elements described here. Selection of protein export elements from L. lactis DNA Two plasmids (Fig. I) were constructed that carried either the Bacillus licheniformis a-amylase gene (pGAI4), or the E. coli TEM-13-lactamase gene (pGBI4). The reporter genes were 5'-terminally truncated and lacked their transcription/translation initiation signals and the signal sequence, which were replaced by a multiple cloning site (Smith et al. 1987). Consequently, the reporter proteins are not expressed from these plasmids. The selection vectors are based on the broad-host-range lactococcal plasmid pWV01 (Kok et al. 1984), which enabled the comparison of the effects of cloned DNA fragments in different bacteria without subcloning. The copy numbers of this plasmid per chromosome equivalent are about 5 for B. subtilis and L. lactis and about 50 for E. coli (Kok et al. 1984). Cloned DNA fragments that restore the export of the reporter proteins can be selected with these plasmids, provided that they are placed in frame with the reporter genes. In addition, the selection of export elements with pGB14 requires the cloning of expression signals. With pGA14, carrying the SPO2 promoter, which is functional in all three bacteria used in these studies, the cloning of a promoter is not essential. The initial selection of export elements was carried out in E. coli. Since resistance to Amp can only develop when 13-lactamasehas been translocated into the periplasm (Kadonaga et al. 1984), this provides a positive assay for pGB14 clones containing export elements. We have shown before (van Dijl et al. 1991b) that translocated 13-lactamase that is not processed also renders E. coli cells resistant to Amp. As a consequence, the presence of a signal peptidase cleavage site on the selected export elements is not required in this assay. With pGA14, halo formation around E. coli colonies on starch-containing plates was used to monitor a-amylase export. Since this assay requires the diffusion of a-amylase into the agar, processing of the a-amylase precursor is required in this case. Chromosomal DNA from L. lactis MG1363 was digested with the restriction enzymes Rsal plus HaeIIl, or Alul, to obtain fragments of about 0.3 to 1.5 kb. The digested DNA was ligated into the Smal site of pGA14 and pGB14 and the ligation mixtures were used to transform E. coli BHB2600. Among approximately 50000 erythromycin-resistant E. coli transformants obtained with pGB14, 12 were resistant to > 5 ~g/ml Amp. The selected fragments were designated BL. From approximately 50000 erythromycin-resistant transformants obtained with pGA14, 48 exported a-amylase. The selected fragments were designated AL. XboI ~ ~dm pWW1 \lndm SocIl Emr pGB14 5900bps 1'1 BclI-\ , --"f Hi1d m SalI \ XboI SmoI BomHI SocI EcoRI 13-1actamase +1 +2 a.-amylase +1 GDPLESTAAAA GAA TTC GAGC TC GCC C GGGGATC C TC T AGAGTC GACCGCAGC GGCGGCA ~~~ ~RI ~~~~~~ Fig. I. Plasmids from the used Lactococcus 5'-terminally Escherichia the selection Plasmids truncated genes the were and licheniformis genes, described bacteriophage of protein pGA14 Bacillus coli TEM-[3-lactamase ed reporter contains for lactis. by SPO2 Smith elements pGB14 contain a-amylase respectively. promoter export et al. and The truncat(1987). upstream pGA14 of the ~I GDPLESTAQACPP TCC~~CGCC~GCCCCCCA ~i-~~I ~I ~III truncated a-amylase gene. Both plasmids contain the replication functions of the broad-host-range plasmid pWVOl (Kok et al. 1984). The plasmids contain the erythromycin resistance marker from plasmid pE194. The sequencesbelow the plasmids show the regions of the fusions between the multiple cloning sites and the reporter genes 404 Table 2. 13-Lactamase activities Export function Escherichia Ampr (~g/ml) BLl BL4 BLS BLlO BLll BLl2 BLl3 BLl4 AL9 None (pGBl4) obtained with export elements from Lactococcus coli Activitya (U/ml) Exportedb (%) 10 40 100 10 30 35 53 10 130 100 1580 110 1785 420 10 nd nd < 10 nd 5 10 75 30 500 48 26 45 18 16 lactis Bacillus subtilis Activitya Exportedb (U/ml) (%) 880 700 150 0 3480 620 1660 730 nd <10 100 100 100 0 69 100 100 100 nd nd Lactococcus /actis Activitya (U/ml) Exportedb (%) 18700 160 570 80 1270 160 3660 90 38850 <10 92 100 100 100 24 100 65 100 98 nd Size insert (hp) 300 800 750 900 720 800 1300 360 720 One unit of activity (seeMaterials and methods) was defined as the amount of J:I-lactamasethat in l ml samples raised the absorbance at 486 nm by 0.001/min at room temperature. Resistance to ampicillum (Amp) was expressed as the maximal concentration of Amp (in J.lg/ml) at which growth to colonies occurred. AL9, which had been selected with plasmid pGA14, was inserted into plasmid pGB14 a Total amount of J3-lactamaseactivity. In the case of E. coli this Two assays were used to obtain information about the relative efficiencies of the selected export elements. The first was the measurement of the levelof resistance to Amp in E. coli. Since only exported (periplasmic) ~-lactamase causes resistance to Amp (Kadonaga et al. 1984), this is a measure of export efficiency in E. coli. This assay cannot be used for the Gram-positive bacteria, because with TEM-~-lactamase, these do not develop resistance to Amp. The second assay involved measurement of export and secretion of a-amylase and ~-lactamase in the three organisms tested. We have shown previously (Smith et al. 1988) that not only mature, processed forms, but also precursor forms of the a-amylase reporter protein are enzymatically active. Therefore, determination of the activities in cell-associated and extracellular fractions ( B. subtilis and L. lactis) , or those of cell-associated and periplasmic fractions (export in E. coli), allows a comparison of the efficiencies of selected export elements, and a comparison of effects associated with the host bacteria. Although quantitative data are lacking, we assume that the same holds for ~-lactamase. Since pre-~lactamase (Laminet and Pliickthun 1989) and hybrid pre-~-lactamases are active (van Dijl et al. 1991a), activity measurements give information about amounts of protein. A potential problem with this assay is instability of the hybrid proteins in the three hosts. This would reduce the enzymatic activities, as has been shown for hybrid ~-lactamase in B. subtilis (Smith et al. 1987). This problem was avoided by using exponentially growing cultures. Prolonged incubation of cell extracts indicated that no losses of a-amylase and ~-lactamase activity occurred as a function of time (all three bacterial species were tested; results not shown). in E. coli (Table 2). BLl3 and BLll were exceptions: compared with export elementsisolated from B. subtilis, the first conferred high levels and the second moderate levels of resistance.Plasmids containing the BL inserts were transferred to B. subtilis DBl04 and L. lactis MG1363, and the total /3-lactamaseactivities were determined. In addition, the fractions of the activities exported into the periplasm ( E. coli) or culture supernatant ( B. subtilis and L.lactis) were determined. Controls with the intracellular enzymes/3-galactosidase( E. coli) , isocitrate dehydrogenase ( B. subtilis) , or phosphoglucose isomerase( L. lactis) indicated that in none ofthe species were detectable amounts of intracellular proteins releasedby cel11ysis(data not shown). In E. coli the total activities of /3-lactamasevaried greatly, indicating that different export elements had been selected. In B. subtilis and L. lactis al1 selected elements (except BLIO in B. subtilis) directed the expression of /3-lactamase.However, the relative levels of the activities were different in the three bacterial species. For instance, BLll was the most efficient in B. subtilis, BLl3 in E. coli, and BLl in L. lactis. BLll and BLl3 were moderately active in L. lactis, and BLl had only a low activity in B. subtilis and E. coli. These and other data from Table 2 indicate that the host had a drastic effect on the total /3-lactamaseactivity. Depending on the selectedfragment, the fraction of exported /3-lactamasealso varied considerably. In E. coli, BLl was efficient in directing export: all /3-lactamase activity was located in the periplasm. With all other elements50% or more ofthe /3-lactamaseremained associated with the cells. In spite of this, some of these elements were so highly efficient in expression (BLll and BLI3) that, as compared with BLl, large amounts of /3-lactamaseaccumulatedin the periplasm. A remarkable observation was that with BLl3 a very high levelof resistanceto Amp (500 I.1g/ml)was obtained. Since only periplasmical1y localised /3-lactamasecan cause resis- Export elements selected with the p-Iactamase gene Most of the DNA fragments selected with pGB14 conferred rather low levels of Amp resistance ( < 30 ~g/ml) represents the total activity in pelleted cells; in the caseof B. subtilis and L. lactis this represents the activities in cells plus culture supernatants b Fraction (in %) ofthe J3-lactamaseactivity present in the periplasmic space ( E. coli) , or in the culture supernatant ( B. subtilis and L. lactis ) ; nd, not determined 405 tance (Kadonaga et al. 1984), this suggestedthat, in E. coli, BL13 permits efficient translocation of /3-1actamase into the periplasm. The low percentage of free /3-1actamase in the periplasm (18%) may indicate that pre-(BLI3)-/3-1actamase was poorly processedby SPaseI. Most of the BL elementscausedsecretionof nearly all /3-1actamase into the extracellular medium of B. subtilis and L. lactis. BLll and BL13 were exceptions:with these export elementsconsiderableamounts of the /3-1actamase activity were associatedwith the cell fraction. For comparison, the results obtained with AL9 (see following paragraph) are also shown in Table 2. When placed in plasmid pGBI4, this fragment appeared to be the most efficient of all in L. lactis (38850 U/ml /3-1actamase; 98% secreted). Export elements selected with the a-amylase gene Twenty-three of the AL export elements selected with pGA14 in E. coli were transferred to B. subtilis DBIO4( amy ) and L.lactis. The total a-amylase activities were determined, as well as the fractions of the activity that were exported (Table 3). With these element also, a considerable variation in total amount of activity was observed in E. coli, indicating that, again, many different elements had been selected. The majority of the AL Table 3. a-Amylase activities obtained with export Export Escherjchja function A CtiVlty. .. E xporte (U/ml) (%) (J.lg/ml) 33 62 75 52 73 48 49 66 30 50 85 78 56 44 50 56 71 22 32 27 46 62 55 nd nd nd 10 AL6 AL9 ALl2 ALl4 AL24 AL25 AL27 AL29 AL30 AL31 AL32 AL33 AL35 AL36 AL37 AL39 AL40 AL41 AL42 AL43 AL46 AL47 AL48 None (pGAI4) BLI BLl3 44.9 16.0 20.2 11.9 81.0 10.6 24.6 46.2 84.0 87.4 42.2 106.0 6.8 86.0 >126 >126 63.0 29.8 18.1 31.7 122 63.0 118 <2 nd nd colj elements from Lactococcus Bacjllus db AmA pr 10 elements directed low a-amylase production in the Gram-positive bacteria: in B. subtilis, a-amylase activity could be measured only with AL9, AL14, AL3l, AL39, and AL40, while in L. lactis only AL9 was active. This demonstrates that there is a drastic host-specific effect on a-amylase production. The fraction of the a-amylase released into the periplasm of E. coli varied from 22% to 85%. In B. subtilis, AL9 and AL39 appeared to be more efficient in directing export of a-amylase ( > 88% secreted) than in E. coli (about 60% exported). AL14, AL31 and AL40 were moderately efficient in both E. coli and B. subtilis (50%-70% exported). As in B. subtilis, AL9 was also efficient in the secretion of a-amylase by L. lactis (90% in the supernatant). The host-specific effects on the amounts of exported a-amylase are illustrated in Fig. 2, which shows halo formation on starchcontaining plates by various E. coli, B. subtilis, and L. lactis clones. Several of the DNA fragments selected with the aamylase gene were transferred as SacI-XbaI fragments into the corresponding sites in pGB18. This placed the export elements downstream of the SPO2 promoter, in frame with the 13-lactamasereporter gene. The levels of resistance to Amp were measured in E. coli (Table 3 column 4). Although all AL elements caused resistance to Amp, little correlation was observed between a-amylase accumulation in the periplasm ad the levelof Amp CtlVrty. .. lactjs subtjlis Lactococcus E xporte lactis db Activitya Exportedb (U/ml) (%) (U/ml) (%) + 13.6 95 11.7 90 9.6 5.0 77 65 nd 200 200 4.2 + 62 3.2 62 10 200 200 20 10 200 10 nd + nd 10 200 10 1.4 2.2 88 48 200 10 10 + + 75 nd + 100 nd nd + + Units of activity (seeMaterials and methods) are given in rnillimoles of glucose equivalents released from starch per hour and per millititre culture. nd, not determined; + , halo formation on starch plates, but activity too low to be measurable; -, no activity detectable Size insert (bp) 300 720 300 720 300 300 300 <300 1200 750 <300 650 600 <300 <300 <300 <300 1200 <300 <300 <300 490 400 300 1300 a. b See Table 2 (here a-amylase activities) c Levels ofresistance to ampicillin (Amp) (in E. coli) obtained with pGBI8 plasmids into which the AL fragments had been introduced 406 DNA sequences and expression signals Fig. 2. Differences in relative a-arnylase activities in Escherichia coli, Bacillus subtilis, and Lactococcus lactis. Colonies of the three bacterial strains that carried identical pGAL plasmids were toothpicked onto an agar plate containing M 17 medium plus glucose and 1% starch. The plates were first incubated for 18 h at 300 C to permit growth of L. lactis, foliowed by 24 h at 37° C to provide optimal growth conditions for E. coli and B. subtilis. Halo formation was subsequently visualized by staining with iodine solution (Smith et al. 1988). Upper row, E. coli; middle row, B. subtilis; bottorn row, L.lactis. Frorn left to right, AL48, AL39, AL37, AL31, AL24, AL9, and AL6 resistance. For instance, AL37 and AL39 were equally efficient in the export of a-amylase Cabout 50% in the periplasm), but only AL39 caused high levels of resistance to Amp. This suggested that, in contrast to preCAL37)-a-amylase, preCAL37)-!3-lactamase was translocated inefficiently in E. coli. Since in this case identical expression signals were compared, these results indicated that the translocation efficiencies were also affected by the mature part of the reporter proteins. Growth of L. lactis on starch Of the selected export elements, AL9 and HL 1 were the most efficient in the production and secretion of both reporter proteins in L. lactis (Tables 2 and 3). HL I should contain a promoter, since it was selected in the absence of the SPO2 promoter. The removal of the SPO2 promoter from plasmid pG-AL9 did not affect halo formation on starch-containing plates (data not shown), also indicating that AL9 carries transcription/translation signals. AL9 directed such high levels of a-amylase synthesis and secretion (Table 3) that L. lactis could grow weil (OD6oo values of at least 1.2 could be obtained) in M17 medium containing 1% starch as the sole carbon source. With the aim of identifying expression signals and export signal functions, five of the fragments were sequenced : B LI (efficient in L. lactis); AL39 (efficient in E. coh); BLll and BLl3 (efficient in both E. coli and B. subtilis) ; and AL9 (efficient in both L. lactis and B. subtilis). The data (Fig. 3A-E) indicated in all sequenced fragments the presence of: (1) an open reading frame (ORF) fused in frame to the reporter gene; and (2) promoter-like sequences upstream of the ORFs. The similarity of the putative promoters to previously described lactococcal promoters (de Vos 1987; Koivula et al. 1991a; van de Guchte et al 1992 ; van der Vossen et al. 1987) was rather limited, however. None of the putative promoters described here had a perfect match with the consensus -35 (TTGACA) and -10 sequences (TATAAT). We consider the sequence denoted b in AL9 as the best candidate for a functional promoter (spacing 19 bp). In fragment B LI, the sequences denoted a and al are likely -35 and -10 promoter sequences (spacing 15 bp). Primer extension assays with mRNA extracted from L. lactis were used to map the start sites of transcription (results not shown) in the two most efficient export elements in L. lactis (AL9 and B LI). These start sites fitted weIl with the promoter regions deduced from the sequence. The -35 region ofthe putative promoter on B LI is contained within a 19 b p (imperfect) inverted repeat sequence, which can potentially form a stem-loop structure (L1G = -14.8 kCal/mol). In AL9, B LI and BLI3, which contain the most efficient expression signals for L. lactis (Tables 2 and 3), the region preceding the putative promoters is extremely A/T rich. In addition, in B LI (position 25 to 50, Fig. 3B) and BL13 (position 24 to 76, Fig. 30), stretches of three or more As are present with a helical periodicity (about 10 bp). These regions might facilitate ONA bending. In four of the fragments (AL9, AL39, BLll, and BLI3) potential translation signals are present: a start codon (AUG), preceded at a short distance (less than 12 bp) by a Shine-Oalgarno (SO) sequence. Some support for the assignment of the translation start sites was obtained by estimating from SOS-polyacrylamide gel electrophoresis the actual sizes of ~-lactamase precursors synthesized in vitro. These corresponded weIl with those predicted from the sequences (results not shown). The high levelof expression by BLI in L. lactis was surprising, since no SO-like sequence is present in the region preceding the single AUG codon (Fig. 3B; position 117) in frame with the reporter gene. Moreover, this codon is directly adjacent to the transcription start site (position 116; Fig. 3B), which makes the assignment of the translational start at position 117 doubtful. However , no obvious alternative start codon nor SO sequence is present downstream from the transcription start point. Characteristics of the export elements The hydrophobicity profiles of the five oligopeptides encoded by the selected fragments are shown in Fig. 4. AL9 A BL11 10 20 30 40 50 60 TCGCCCCTTATTTATAATAAGCAAAAATCCATCTTCTGATTTGTTGGGTATCTTTAAAAC 70 80 90 100 110 120 CATATTTTTTIGATAAGGAATGATAACCAGTTCTCTTGTCAAGATACTCTTTAACAATCT 130 140 150 160 170 180 TTAGTTTAAATTCAAATGTATATTTTGTCATAAAAMATTGACCTCCATTAACTAGACTT 190 200 210 220 230 240 TTTAGTCTAACTTATGGGGGTCATATCATTTTATAGAGGTTTrTTGGTATCTAMAAAGC 250 260 270 280 290 300 CAATGGCATTTATTTTTTATATTGCGATTGATAAAAATAATATAAGTGAAAATACAAATT -a 310 bi 330 320 --a-340 ~ 10 20 30 40 50 60 GGAAMG AAATAAAAA TT CGTGTT ATTG CTGCCAA TAAACGAAM GGAACAGTAGATITT 70 80 90 100 110 120 GAACAAAT CGCTCCTGAAAAAAACTA GCAATTTG CTAGTTTTTTT CTGTATGTTTTTTA T 130 140 150 160 170 180 TAGCTAATATCGTCTTTACAGTATATTTTACATAACATAAATTATGTTAGCTGTGTTATT 190 200 210 220 230 240 TTGAGTATAAGGGAGCCTTATTTTTGATTACGAATTGATTTAGGCACGGATATCAGTAGA 250 260 270 280 290 300 AAAATGAAATCAAAGTTTGGTTGATAAAAGATTGTTACTATTTAAATTAAGTTATATAGT ---0--350 360 TATCAATTTTTGTTAGAATAGAGACTATAAATG~AATACATTGACAATTCAAGGAGCGA C- ( a- ~ --a-- ---6-- 310 320 330 340 350 360 TATCAAGCGAATATGCTAGCTTAACAAACTATTTATGTAATAATATAGGTATGGTAATCA ---(-- 370 380 390 400 410 420 AAATGGCTACACTTGAATTAAAGTCTTCAGTGGCGATTGAAGATAAAGAGATCTCAAAGG 370 380 390 400 410 420 AAAAAACGCATACATAGATTTAGGGAGGGAACGTATCACTAGTAAAATAAAATCATTGAC MTSKIKSLT 430 440 450 460 470 480 AGTCAACCTAGTCATCAATACCAATGAAATTCATGCAATTATGGGACCTAACGGAACTGG 430 y 490 500 510 520 530 560 570 580 590 610 620 630 640 650 670 680 690 460 470 480 L F I V G I 500 E I I 510 G G L 520 S G F F 530 A 540 I I K E I 550 y N N 560 L I L P P L A P P D y 570 TTTATTTGGAATTGTTTGGGGGGATCCTCTA L AAATGAGAGCATTMTGT1"rCTACMCGCTTTTTAGCMCMTMTTGAT1"rMTCATTG M R A L M F L Q R F L A T I I D L 490 600 GTTCTTTTTGATGGTCAAAATGTTTTAGAGATGGAAGTTGATGAAAGAGCTGGAGGGAGA 450 GGGAATTATCAAGGAAATTTATAATAATCTCATACTTCCGCCGCTGGCTCCGCCAGATTA G 550 L 540 TAAATCGACTTTATCGGCAGCGATTATGGGGAACCTAATTATACCGTCACTGAGGGAGAA 440 ATATCTTCTATTATTTATTGTGGGAATCGAAATTATTGGTGGCTTATCTGGTTTCTTTGC F G I V W "g"""!1,PL 660 L I I BL13 D 10 20 30 40 50 60 GGTTAAAGGGGTTTTTGGCMCTAAAAGTAAAAAAACACTGAAAATATGATAAAATATGA 700 T1"rAT1"rACCAGTT1"rACTTCTTGTTCAGGGGGATCCTCTA VYLPVLLLVQGDPL «««,«««««««««," 70 T AAAA BL1 B 10 20 30 4() 50 80 TT AA GAA G AAA 190 I 7() 80 TT C TTTTTG A TTT 90 C G TGAA TTTTTT 100 110 C A TT AA TTTTG 100 AAG A C AAAAA 110 G AA C TT AAAGM 120 T AAAGA TAG 130 140 150 160 170 180 AAATCGAGAAGGAAAATCAAGCGTTACGTCACAGGTTTTAATGGATTACGGACTATTGGA MKRYVTGFNGLRTIG -60 CTAAAGAACTTCTAAAGATGAACTAAAACAAAATACAAAAAAATAAGAAAGAGCCTATTG G C TTT 90 G C G TAG T A G TTTT ~120 200 210 220 GTTTTAACGGTTATTCTTTATCACCTCTGGGGGGATCCTCTA CT A T AA TT AA TC TT AATGA V L T V I L y H L W ,9,0,!!,0,~~ M a a1 130 ACTT N CTTT F 140 AAAAA F K C ACGA N T 190 150 160 T AA TTTTT1-rAAAAACAA I a2 I F 200 L K T 170 T AAAAA C GAAA I T 210 K K 220 180 C CG CTT GA TTTTG p L D 230 F AL39 E 10 20 30 40 50 60 TTGCTACCGCCAGCGGGTTCTAATCGGCAACTATGCCAAAGTGCTCGGCCTGGGCAAAAC 240 TTATCGTTTTCGTGTTATTTCTTGCTTCCTTTTCAACGATATTCCTTTTCGCCACTGGTT V I V F 250 V L F L 260 A S F S T I F L F A T G 70 80 90 100 110 120 TATCTCTTCACCTGGTTGCGTGATAACGGAATTCGAGGCTCGCCCCCATATACTCACGTT 270 CTACTGGAGCCAAAGCCGAGGGGGATCCTCTA STGAKAEGDPL ili:ili;;::::1ii*t:::\::\:)\t;: 130 140 150 160 170 180 TAGGAAATCCAACCAACGATGTTTTTGAAGCACGCATCGCAGCTCTTGAAGGTGGGAGTG MFLKHASQLLKVGV 190 200 210 220 CAGCGCTTGGTGTTGGTTCTGGCTGTGCGGGGGGATCCTCTA Q p L V L V L A L R "g»»»~»w»r",,"~,," Fig. 3A-E. Nucleotide sequenceand deduced amino acid sequence of fragments AL9 (A); BL1 (B); BLl1 (C); BL13 (D); and AL39 (E). Putative promoter sequencesare underlined ( -35 regions) or indicated with interrupted lines ( -10 regions); Shine-Dalgarno sequences are indicated with dots underneath the nucleotides. Heavy arrows show the transcription start sites in AL9 (position 334) and BLl (position 116). An inverted repeat in BLl is indicated by overlining arrows. Amino acids encoded by the multiple cloning site are given in boldface (stippling) 408 Fig. 4. Hydrophobicity profiles of peptides encoded by fragments BLl, BLll, BLl3, AL9, and AL39. Hydrophobicities were predicted according to Kyte and Doolittle (l982). Hydrophobic and hydrophilic regions are indicated below and above the dotted lines, respectively. Vertical arrows indicate potential cleavage sites for SPase I (according to von Heijne 1986; heavy arrows indicate the most likely sites). Charged amino acids are indicated by + (arg and lys), or (glu and asp) These show the tripartite structure typical of natural signal peptides(von Heijne and Abrahmsén 1989): (1), a short n-region containing two or three positive1ycharged amino acid residues; (2), an h-region varying from 14 (BL13) to 24 amino acids (BL11); and (3), potential SPaseI cleavage sites C-terminally from the h-region, usually at 4 to 8 amino acids distance (von Heijne 1986). AL9- and AL39-encoded peptides lack potential SPase I cleavagesjtes.This does not representa problem, however, since such sites are present in the amino acids specifiedby the multiple cloning site at a short distance from the cloned fragments. Three export elements,AL9, BLI and BL11, appearedto contain a negatively charged amino acid residue in or near the h-region. Discussion In previous work (Smith et al. 1987, 1988, 1989) the selection of a great variet y of B. subtilis DNA fragments that directed the export of the reporter proteins a-amylase (fiom B. licheniformis) and TEM-/3-1actamase (from E. coli) was described. In the present work we extended this approach to L. lactis in order to study properties of export signal functions frorn this organisrn and to exploit its potential for the production of extracellular (heterologous) proteins. The initial selection of L. lactis export elernents was carried out in E. coli. Although a possible lirnitation of this procedure is that sorne functional export elernents for L. lactis and B. subtilis rnay not be active in E. coli and, therefore, rnay not be selected, several functional export elernents for the two Grarnpositive bacteria were obtained. Several of the protein export elernents selected frorn B. subtilis (Srnith et al. 1987, 1988, 1989) appeared to contain highly efficient expression/secretion functions for (heterologous) proteins. In addition, this set of export elernents proved to be extrernely valuable in the cloning of the B. subtilis SPase 1 gene and studies on the properties of its product (J.M. van Dijl, G. Venerna, S. Bron; to be published). In the present study a great variet y of protein export elernents was sirnilarly selected frorn L. lactis. The large nurnber of different export elernents obtained could weIl rnean that functions other than natural signal peptides, such as rnernbrane insertion signals 409 of integral membrane proteins, have also been selected. Such functions could be active as export elementsin the present study since, particularly in assaysinvolving the /3-lactamasereporter protein, the presenceof an SPaseI processing site was not required. Several of the export elements selectedin E. coli (AL9 and most of the BL elements)appearedto be active in B. subtilis and L. lactis. In addition, the B. subtilis export function A2 (Smith et al. 1987, 1988) was also efficient in L. lactis (data not shown). These results indicate that the protein export machinenes of E. coli, B. subtilis and L. lactis are sufficiently similar to enable the export of at least a number of the hybnd proteins in an active form. This conclusion is supported by the observation that in L. lactis the hybrid pre(AL9)-a-amylase precursor was processedin vivo to a mature product of the expectedsize. This was demonstrated by pulse-labelling and subsequent immunoprecipitation with specific antibodies (results not shown). Another indication that the export machineries of L. lactis, B. subtilis, and E. coli share similanties was also obtained by Koivula et al. (1991b). These authors demonstrated that L. lactis contains a genehomologous to the secy gelles of B. subtilis and E. coli. The E. coli SecY protein forms part of the protein translocase (Wickner et al. 1991). Most of the selectedlactococcal export elementshad the typical tripartite structure of natural signal peptides (von Heijne and Abrahmsén 1989).However, in someof the hybrid export proteins the most likely processingsite for SPaseI was present in the amino acids specified by the multiple cloning site. All peptides encoded by the sequencedfragments were different from known natural lactococcal signal peptides and also from the export elements selected by Sibakov et al. (1991). Whereas about half of the export elements selectedby the latter authors contain potential lipoprotein signal peptidase cleavage sites, such sites were not found in the export elementsstudied in the present work. The length of the h-regions (12 to 24 amino acids) of the selectedexport signals was relatively large. A similar conclusion can be drawn from the work of Sibakov et al. (1991). These observationsare in accordancewith the view (von Heijne and Abrahmsén 1989) that h-regions in signal peptides from Gram-positive bactena are generally larger than those from E. coli (average 12 amino acids). A negative chargewas presentin or near the h-region of three of the export signals. Whether this is related to signal peptide function in lactococci is not known. Negative chargesat these positions are rare in signal peptides from other bacteria that have been analysed so far . The present results indicated that, in addition to the selectedexport elements,at least two other factors affected the production of exported proteins, namely the nature of the mature part of the reporter proteins and the host bacterium used. Effects of the mature part of a protein on its export have also been reported for E. coli (Lehnhardt et al. 1988; Park et al. 1988), and were also observedwith export elementsfrom B. subtilis (Smith et al. 1989; van Dijl et al. 1991a).Severalexplanations for these observations can be entertained. First, the signal peptide is involved in maintaining an export-competent state of the precursor (Park et al. 1988; Saier et al. 1989 ; Wickner et al. 1991). In that respect, different signal peptides may have different efficiencies. Second, the signal peptide and the mature part have to interact correctly with the components of the cellular export machinery (Cunningham and Wickner 1989; Lill et al. 1990; Wickner et al. 1991). Third, in several of the hybrid proteins the likely SPase I cleavage site was located in the amino acids specified by the multiple cloning sites, which are different in pGA14 and pGBI4. At least three factors could be involved in the phenomenon of host-specific efficiency of the selected DNA fragments. The first is a species-specific requirement for transcription/translation initiation signals. L. lactis promoters generally have the same consensus sequence as that used by the major RNA polymerase of E. coli and B. subtilis (de Vos 1987; Koivula et al. 1991a ; van de Guchte et al. 1992; van der Vossen et al. 1987). Several putative promoter sequences from the present work had, however, only a limited similarity with previously described lactococcal promoters. Since, in general, E. coli exhibits less stringent requirements for promoter specificity than B. subtilis (Hager and Rabinowitz 1985) and L. lactis (de Vos 1987; van de Guchte et al. 1992; van der Vossen et al. 1987), differences in transcription efficiencyare likely to occur in the three hosts. Of special interest are the promoters on AL9 and BL1, which have low activity in E. coli but are efficient in L. lactis. These fragments appeared to be extremely A/T-rich in the sequence upstream ofthe -10 promoter box, a property commonly observed with promoters from Gram-positive bacteria (Moran et al. 1982; van der Vossen et al. 1987). Fragment BLl showed two other properties that can explain its host dependence. First, it contains a region potentially capable of bending, and second, part of its putative promoter is contained within an inverted repeat sequence. Both regions could be under regulatory control of functions specific for L. lactis. Appropriate translation initiation signals could be detected in fragments AL9, BL11, BL13, and AL39. BLl was an exception: no SD sequence could be found and transcription appeared to start one nucleotide upstream ofthe AUG codon fused in frame with the reporter gene. Although examples offlanking transcription and translation start sites in the absence of SD sequences are known for the Gram-positive bacterium Streptomyces (Horinouchi et al. 1987; Lopez-Cabrera et al. 1989), this phenomenon has not yet been reported for L. lactis. The second factor possibly, involved in the observed host-specific effects is a difference in export efficiency. As already discussed, the h-region and the c-region (containing the SPase I cleavage site), are in general shorter in E. coli than in the Gram-positive bacteria (von Heijne and Abrahmsén 1989). Moreover, we have recently shown (J.M. van Dijl, G. Venema, S. Bron to be published) that the B. subtilis SPase I is rather different from its E. coli counterpart. This and other host-specific properties of the host export machinery are likely to affect host-specific export efficiencies. The third possible factor determining host-specific export efficiency is a difference in the stabilities of the 410 exported products. With regard to this factor, it is noteworthy that proteolytic degradation of exported heterologousproteins, such as TEM-~-lactamase (Smith et al. 1987), is a serious problem in B. subtilis. In the present experiments, proteolytic degradation has not played an important role, however, since exponentially growing cells were used to avoid this problem. At present, little is known about product stabilities in L. lactis. Our data (not shown) and those presentedby Sibakov et al. (1991) suggestthat TEM-~-lactamase is relatively stabIe in this organism. In summary, we have shown that a great variety of protein export elementscan be selectedfrom the L. lactis chromosome.Thesemay have useful applications and be of value in fundamental studies. Two of the export elements (AL9 and BLI) are ofparticular interest, as these were highly efficient in directing the export of at least two heterologous proteins in L. lactis. The export element AL9 fused to a-amylase is an example of a potential application: the large amounts of secreted a-amylase causeda change in the growth requirements of this fastidious bacterium so that it can grow on starch as the sole, cheap, carbon source. Acknowledgements. This work was partially financed by a Senior Scientist Training Contract from the European Commission to G.P.M. We thank Anne de Jong for skilful technical assistanceand Henk Mulder for preparing the photographs. References Bron S, Luxen E (1985) Segregationa1 instability of pUBl10derived recombinant plasmids in Bacjllus subtjljs. Plasmid 14:235-244 Calzone FJ, Britten RJ, Davidson EH (1987) Mapping ofthe gene transcripts by nuclease protection assays and cDNA primer extension. Methods Enzymol152:611-632 Cunningham K, Wickner W (1989) Specific recognition of the leader region of precursor proteins is required for the activation oftranslocation ATPase of Escherjchja colj. Proc Natl Acad Sci USA 79:5582-5586 de Vos WM (1987) Gene cloning and expression in lactic streptococci. FEMS Microbiol Rev 46:281-295 de Vrije T, Tommassen J, de KruijffB (1987) Optimal post-translational translocation of the precursor of PhoE protein across Escherjchja colj membrane vesicles requires both ATP and the proton motive force. Biochim Biophys Acta 900:63-72 Hager PW, Rabinowitz JC (1985) Translational specificity im Bacjllus subtjljs. In: Dubnau D (ed) The molecu1ar biology of the bacilli. Academic Press, New York, pp 1-31 Horinouchi S, Furuya K, Nishiyama M, Suzuki H, Beppu T (1987) Nucleotide sequence of the streptothricin acetyl-transferase gene from Streptomyces lavendulae and its expression in heterologous hosts. J Bacteriol169: 1929-1937 Kadonaga JT, Gautier AE, Straus DR, Charles AD, Edge MD, Knowles JR (1984) The role ofthe 13-lactamasesignal sequence in the secretion of proteins by Escherjchja colj. J Biol Chem 259:2149-2154 Kawamura F, Doi RH (1984) Construction of a Bacjllus subtjljs double mutant deficient in extracellu1ar alka1ine and neutral proteases. J Bacteriol160:442-444 Koivu1a T, Sibakov M, Palva I (1991a) Isolation and characterization of Lactococcus lactjs subsp. lactjs promoters. Appl Environ Mierobiol 57: 333-340 Koivu1a T, Palva I, Hemilii H (1991b) Nucleotide sequence ofthe secY gene from Lactococcus lactjs and identification of con- served regions by comparison of four SecY proteins. FEBS Letters 288: 114-118 Kok J,Venema G (1988) Genetics of proteinases of lactic acid bacteria. Biochemie 70:475-488 Kok J, van der Vossen JMBM, Venema G (1984) Construction of plasmid cloning vectors for lactic streptococci which also replicate in Bacjllus subtjljs and Escherjchja colj. Appl Environ Microbio148:726-731 Kok J, Leenhouts KJ, Haandrikman AJ, Ledeboer AM, Venema G (1988) Nucleotide sequenceofthe cell wall proteinase gene of Streptococcus cremorjs Wg2. Appl Environ Microbiol 54:231-238 Kyte J, Doolittle RF (1982) A simple method for displaying the hydropathic character of a protein. J Mol Biol157: 105-132 Laminet AA, Pliickthun A (1989) The precursor of p-lactamase: purification, properties and folding kinetics. EMBO J 8:1469-1477 Lehnhardt S, Pollitt S, Goldstein J, Inouye M (1988) Modulation ofthe effects ofmutations in the basic region ofthe OmpA signal peptide by the mature portion of the protein. J Biol Chem 263:10300-10303 Lill R, Dowham W, Wickner W ( 1990)The A TPase activity of SecA is regulated by acidic phospholipids, SecY, and the leader and mature domains ofprecursor proteins. Cell60:271-280 Lopez-Cabrera M, Perez-Gonzalez JA, Heinzei P, Piepersberg W, Jimenez A (1989) Isolation and nucleotide sequencing of an aminocyclitol acetyltransferase gene from Streptomyces rjmosus forma paramomjcjnus. J Bacteriol171 : 321-328 Maniatis T, Fritsch EF, Sambrook J (1982) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press,Cold Spring Harbor, New York Michal G (1984) D-g1ucose 6-phosphate and D-fructose 6-phosphate. In: Bergmeyer HU (ed) Methods of enzymatic analysis, vol VI. Verlag Chemie, Weinheim, FRG, pp 191-198 Miller JH (1972) Experiments in molecular genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York Moran CP Jr, Lang N, LeGrice SFJ, Stephens M, Sonenshein AL, Pero J, Losick R (1982) Nucleotide sequences that signal the initiation of transcription and translation in Bacjllus subtjljs. Mol Gen Genet 186:339-346 Park S, Liu G, Topping TB, Cover WH, Randall LL (1988) Modulation of folding pathways of exported proteins by the leader sequence. Science 239: 1033-1035 Pugsley AP, Schwartz M (1985) Export and secretion of proteins by bacteria. FEMS Microbiol Rev 32:3-38 Raleigh EA, Murray NE, Revel H, Blumenthal RM, Westaway D, Reith AD, Rigby PJW, Elhai J, Hanahan D (1988) McrA and McrB restriction phenotypes of sóme E. colj strains and implications for gene cloning. Nucleic Acids Res 16: 1563-1575 Saier MH Jr, Werner PK, Milller M (1989) Insertion of proteins into bacterial membranes: mechanisms, characteristics and comparisons with the eucaryotic process. Microbiol Rev 53:333-366 Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain terminating inhibitors. Proc Natl Acad Sci USA 74:5463-5467 Scheilink T, Mahillon J, Joos H, Dhaese P, Michels P (1989) Integration and expression of a-amylase and endog1ucanasegenes in the Lactobacjllus plantarum chromosome. Appl Environ Microbiol 55: 2130-2137 Sibakov M, Koivula T, von Wright A, Palva I (1991) Secretion of TEM p-lactamase with signal sequencesisolated from the chromosome of Lactococcus lactjs subsp. lactjs. Appl Environ MicrobioI57:341-348 Smith H, Bron S, van Ee J, Venema G (1987) Construction and use of signal sequence selection vectors in Escherjchja colj and Bacjllus subtjljs. J Bacteriol 169: 3321-3328 Smith H, de Jong A, Bron S, Venema G (1988) Characterization of signal-sequence-encodingregions selectedfrom the Bacjllus subtjljs chromosome. Gene 70: 351-361 411 Smith H, de Jong A, van Dijl JM, Bron S, Venerna G (1989) Protein secretion in Bacillus subtilis: characterization of randomly selected signal sequencecoding regions. In: Butler LO, Harwood CR, Moseley BEB (eds) Genetic transformation and expression. Intercept, Andover, UK, pp 519-527 Spiro RG (1966) The Nelson-sornogyi copper reduction rnethod. Analysis of sugars found in glycoprotein. Methods Enzymol 8:3-26 van Asseldonk M, Rutten G, Oteman M, Siezen RJ, de Vos WM, Simons G (1990) Cloning of usp45, a gene encoding a secreted protein frorn Lactococcus lactis susp. lactis MG1363. Gene 95:155-160 van de Guchte M, Kodde J, van der Vossen JMBM, Kok J, Venerna G (1990) Heterologous gene expression in Lactococcus lactis subsp. lactis: synthesis, secretion, and processing of the Bacillus subtilis neutral protease. Appl Environ Microbiol56: 2606-2611 van de Guchte M, Kok J, Venerna G (1992) Gene expression in Lactococcus lactis. FEMS Microbiol Rev 88:73-92 van der Lelie D, van der Vossen JMBM, Venerna G (1988) Effect of plasmid incompatibility on DNA transfer to Streptococcus crernoris. Appl Environ Microbiol 54: 865-871 van derVossen JMBM, van der Lelie D, Venerna G (1987) Isolation and characterization of Streptococcus crernoris Wg2-specific promoters. Appl Environ Microbiol 53: 2452-2457 van Dijl JM, Bron S, Venerna G, de Jong A, Smith H (199Ia) Protein export in Bacillus subtilis and Escherichia coli. In: Heslot H, Davies J, Florent J, Bobichon L, Durand G, PenasseL (eds) Proceedings of the 6th international symposium on genetics of industrial microorganisms. Strasbourg, Société Fran~aise de Microbiologie, pp 679--{)90 van Dijl JM, deJong A, Smith H, Bron S, Venerna G (199Ib) Signal peptidase loverproduction results in increased efficiencies of export and maturation of hybrid secretory proteins in Escherichia coli. Mol Gen Genet 227:40-80 von Heijne G (1986) A new method for predicting signal sequence cleavage sites. Nucleic Acids Res 14:4683-4690 von Heijne G (1990) The signal peptide. J Membr Bio1115: 195-201 von Heijne G, Abrahmsén L (1989) Species-specific variation in signal peptide design. Implications for protein secretion in foreign hosts. FEBS Lett 244:439--446 Wickner W, Driessen AJM, Hartl F-U (1991) The enzymology of protein translocation across the E. coli plasma membrane. Annu Rev Biochem 60: 101-124 Communicated bv C.A.M.J van den Hondel