Download accelerated atherosclerosis in apoE2/2 mice

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Monoclonal antibody wikipedia , lookup

Molecular mimicry wikipedia , lookup

Polyclonal B cell response wikipedia , lookup

Phagocyte wikipedia , lookup

Adaptive immune system wikipedia , lookup

T cell wikipedia , lookup

Lymphopoiesis wikipedia , lookup

Psychoneuroimmunology wikipedia , lookup

Cancer immunotherapy wikipedia , lookup

Innate immune system wikipedia , lookup

Immunosuppressive drug wikipedia , lookup

Immunomics wikipedia , lookup

Adoptive cell transfer wikipedia , lookup

Atherosclerosis wikipedia , lookup

Transcript
Cardiovascular Research (2009) 84, 155–163
doi:10.1093/cvr/cvp182
Regulatory T cells ameliorate hyperhomocysteinaemiaaccelerated atherosclerosis in apoE2/2 mice
Juan Feng1,2, Zhenmin Zhang1,2, Wei Kong1,2, Bo Liu1,2, Qingbo Xu3, and Xian Wang1,2*
1
Department of Physiology and Pathophysiology, School of Basic Medical Science, Peking University, Beijing 100191, PR China;
Key Laboratory of Molecular Cardiovascular Science, Ministry of Education, Beijing 100191, PR China; and 3Cardiovascular
Division, Kings College London BHF Centre, London SE5 9NU, UK
2
Received 16 November 2008; revised 7 May 2009; accepted 29 May 2009; online publish-ahead-of-print 5 June 2009
Time for primary review: 36 days
KEYWORDS
Regulatory T cells;
Atherosclerosis;
Hyperhomocysteinaemia;
Immunoinflammatory
diseases;
T lymphocytes
Aims Atherosclerosis is an inflammatory disease with T cell-driven immunoinflammatory responses contributing to disease initiation and progression. We investigated the potential role of regulatory T cells
(Tregs) in hyperhomocysteinaemia (HHcy)-accelerated atherosclerosis in apoE2/2 mice.
Methods and results apoE2/2 mice were fed normal mouse chow supplemented with or without a high
level of homocysteine (Hcy) (1.8 g/L) in drinking water for 2, 4, and 6 weeks. Atherosclerotic lesion area
was slightly increased at 2 weeks and substantially elevated at 4 and 6 weeks in HHcy apoE2/2 mice.
Cotransfer of normal Tregs significantly attenuated atherosclerotic lesion size and infiltration of T cells
and macrophages into plaque. Furthermore, Treg cotransfer reversed HHcy-accelerated proliferation of
T cells, -increased pro-inflammatory, and -decreased anti-inflammatory cytokine secretion from activated splenic T cells. With a clinically relevant level of plasma Hcy, the proportion of Tregs and suppressive activity in splenic T cells were reduced in HHcy apoE2/2 mice, which was associated with reduced
mRNA and protein expression of Foxp3, a factor governing mouse Treg development and function. In
addition, Hcy significantly attenuated the proportion and suppressive effects of Tregs in vitro.
Conclusion HHcy suppresses the function of Tregs, which may be responsible for HHcy-accelerated
atherosclerosis in apoE2/2 mice.
1. Introduction
Atherosclerosis is known as a chronic inflammatory disease
in which T lymphocytes play an important role.1–3 Atherosclerotic lesions contain T cells, macrophages, and smooth
muscle cells, which produce cytokines, growth factors, and
other pro-inflammatory mediators in response to hypercholesterolaemia. T cells, including Th1, Th2, or natural killer
T cells, may contribute to the development and/or progression of atherosclerosis. Most CD4þ T cells of murine
and human atherosclerotic plaques are the Th1-cell type,
producing interleukin 2 (IL-2) and interferon g (IFN-g).4
Several experimental studies have clearly shown a critical
pathogenic role for Th1-mediated responses in atherosclerosis.5–8 However, a subtype of T cells, regulatory T cells
(Tregs, CD4þCD25þ), have recently been shown to play a
critical role in maintaining immunological tolerance
against self and non-self antigens and preventing the
development of various immunoinflammatory diseases.
Transcription factor Foxp3 governs mouse CD4þCD25þ Treg
development and function. Emerging data have revealed
that Tregs can exert their suppressive role on atherosclerosis
* Corresponding author. Tel/fax: þ86 10 82801443.
E-mail address: [email protected]
in mouse9,10 and human.11 During this process, an imbalance
between number of pathogenic T cells and Tregs in response
to ‘altered’ self antigens may lead to reciprocal and mutual
amplification of the innate and adaptive immune responses
responsible for plaque development.4,12–15
Homocysteine (Hcy) is a sulfur-containing amino acid
formed during the metabolism of methionine. Hyperhomocysteinaemia (HHcy) has been implicated as an independent
risk factor for atherosclerosis.16,17 HHcy as a potent
pro-inflammatory factor might accelerate the development
of atherosclerosis.18,19 We previously demonstrated that
pathophysiological levels of Hcy could interfere with
human monocyte function by up-regulating monocyte chemoattractant protein 1 and IL-8 expression and secretion
via oxidative stress.20 Hcy potentiates mitogen-induced proliferation of mouse T lymphocytes, in which reactive oxygen
species (ROS) generated by the thiol (–SH) of Hcy autooxidation are involved.21
HHcy accelerates atherosclerosis development in the
immunoinflammatory mechanism of apoE2/2 mice.21,22
However, whether Tregs participate in HHcy-accelerated
atherogenesis is unknown. In the present study, we aimed
to investigate the contribution of Tregs to atherosclerotic
lesion development and Th1-mediated response in an HHcy
Published on behalf of the European Society of Cardiology. All rights reserved. & The Author 2009.
For permissions please email: [email protected].
156
apoE2/2 mouse model. Treg proportion was reduced and
function was impaired in HHcy-induced atherosclerotic
animals. Adoptive transfer of normal Tregs into HHcy
apoE2/2 mice significantly attenuated T-cell hyperresponsiveness, T-cell and macrophage infiltration, and lesion formation in aortas.
2. Methods
2.1 Animals and treatments
Female apoE2/2 and C57BL/6J mice, 6 weeks old, were provided
by the Animal Center of Peking University Health Science Center
(Beijing, China). apoE2/2 mice were fed normal mouse chow supplemented with or without 1.8 g/L DL-Hcy (Sigma Chemical Co.,
St Louis, MO, USA) in drinking water for 2, 4, and 6 weeks, as we
previously reported22 with some modifications. The treatment of
the laboratory animals and experimental protocol followed
the guidelines of Peking University and were approved by the
Institutional Authority for Laboratory Animal Care.
2.2 Cell isolation and flow cytometry
Splenocytes were collected from mouse spleens, and cell suspensions were prepared by passing cells through a nylon mesh after
removal of erythrocytes by ACK lysing buffer (155 mM NH4Cl,
0.1 mM EDTA.Na2, and 10 mM KHCO3, pH7.5). T cells were purified
by positive immunomagnetic cell sorting with use of standard protocols and CD90 microbeads (Miltenyi Biotech, Bergisch Gladbach,
Germany). The sorted cell populations were .98% pure on FACS reanalysis. For FACS assay, T cells were co-stained with the following
antibodies: fluorescein-isothiocyanate-labelled anti-CD4 (GK1.5),
phycoerythrin-labelled anti-CD25 (7D4, both Miltenyi Biotech),
fluorescein-isothiocyanate-labelled rat IgG2b isotypic control
(A95-1), and phycoerythrin-labelled rat IgM isotypic control
(R4-22, both BD Pharmingen, USA). Stained cells were analysed by
FACScan flow cytometry with Cell QuestPro software (BD Biosciences, USA).
CD4þCD25þ cells from murine spleen were isolated by use of a
CD4þCD25þ regulatory T-cell isolation kit (Miltenyi Biotech) according to the manufacturer’s instructions. The CD4þCD252 cells, which
did not bind to the beads, were harvested from the flow-through.
The purity of all cell subsets processed by this method was determined by FACS analysis (data not shown).
2.3 Western blot analysis of Foxp3
A total of 3 107 purified T cells were lysed. Proteins underwent
SDS–PAGE with a 10% running gel and were electrophoretically
transferred onto a nitrocellulose membrane. The membrane was
incubated with 5% skim milk in Tris Tween-buffered saline at room
temperature for 1 h, with polyclonal anti-Foxp3 antibody
(eBioscience, San Diego, CA, USA) at a dilution of 1:500 at 48C for
12 h and then with IRDyeTM -conjugated secondary antibody for 1 h
successively. Immunofluorescence bands were detected by the
Odyssey infrared imaging system (LI-COR Biosciences, Lincoln, NE,
USA).
2.4 RNA extraction and RT–PCR for Foxp3
Total RNA from primary mouse T cells from spleens was isolated by
use of TRIzol reagent (Promega, Madison, WI, USA) and reverse transcribed by the reverse transcription system (Promega), then the
reaction mixture underwent real-time PCR. The amount of PCR products formed in each cycle was evaluated by SYBR Green I fluorescence. Primers for mouse Foxp3 were as follows: sense,
CACTCACCCACAACATCTGG; antisense, GTATCCGCTTTCTCCTGCTG.
All amplification reactions involved use of the Mx3000 Multiplex
J. Feng et al.
Quantitative PCR System (Stratagene, La Jolla, CA, USA). Results
were analysed with use of Stratagene Mx3000 software.
2.5 Cell culture and cytokine assays
For co-culture experiments, 96-well plates (Nunc) were coated with
anti-CD3 monoclonal antibody (145-2C11, BD Pharmingen) 0.5 mg/
mL overnight at 48C and washed with phosphate-buffered saline
three times. CD4þCD252 (effector) and CD4þCD25þ (regulatory) T
cells (5 104 cells/well) were cultured in RPMI1640 medium supplemented with 10% foetal bovine serum at different ratios of regulatory to effector cells (1:1, 1:2, and 1:4). All cells were cultured in
a final volume of 200 mL at 378C in a humidified atmosphere of 5%
CO2 for 72 h. [3H]-thymidine (TdR) (1 mCi/well) was added for 16 h
before proliferation was assayed. The cells were then harvested
onto glass filter paper, and radioactivity was assayed with the use
of a liquid scintillation counter and presented as counts per
minute (CPM).
For lymphocyte proliferation assays, we cultured purified T cells
at 3 105 cells/well with or without Hcy for 48 h in
anti-CD3-antibody-coated (0.5 mg/mL) microplates. All cultures
were performed in triplicate. [3H]-TdR (1 mCi/well) was added to
each culture 6 h prior to analysis by liquid scintillation counter
and presented as CPM. ELISA assays (JingMei Biotech, Shenzhen)
were used to measure the secretion of IL-2, IFN-g, IL-17, IL-10,
and transforming growth factor b (TGF-b) in supernatant.
2.6 In vivo adoptive transfer study
CD4þCD25þ Tregs (1 106) were purified from C57BL/6J mice, suspended in saline, and successively transferred into 6-week-old
female apoE2/2 mice by injection through the tail vein. A total
volume of 200 mL saline with or without cells was injected per
animal. Mice were euthanized 2, 4, and 6 weeks after the initial
injection. Splenocytes were obtained for further experiments.
Plasma was obtained for assessment of lipid profiles, and aortic
roots were frozen for morphology analysis by Oil red O staining.
For quantification of atherosclerotic lesion area, the aortic root
was cross-sectioned serially at 7 mm intervals, with every other
section collected on glass slides. Six sections, spaced 70 mm apart
and thus spanning 350 mm of the aortic root starting at the level
where the aortic valve leaflets were joined and upwards, were
stained with Oil red O to visualize lesion areas. Atherosclerotic
lesion areas were measured blindly by one observer using Quantity
One software, and the mean lesion areas from six sections for
each mouse were calculated.22 In addition, we studied the presence
of macrophages and T lymphocytes in plaque using specific
anti-Mac-3 (Santa Cruz Biotechnology, USA) and anti-CD4 (BD Pharmingen) antibodies, respectively. Collagen content in lesion was
determined on Sirius red staining.
2.7 Lipid profile
Total plasma Hcy level was quantified by means of gas chromatography–mass spectrometry. Plasma total triglyceride and cholesterol levels were assayed by the use of kits from Zhong Sheng
Bio-technology (Beijing, China).
2.8 Statistical analysis
All data are reported as mean + SEM unless otherwise stated. Data
were analysed by the use of GraphPad Prism software. Statistical
analysis involved one-way ANOVA for multiple comparisons and
the Student’s unpaired t-test for comparisons between two
groups. A value of P , 0.05 was considered statistically significant.
Regulatory T cells and atherosclerosis
3. Results
3.1 Adoptive transfer of Tregs reduced
atherosclerotic plaque size and infiltration
of macrophages and T cells into plaque
We have previously shown that HHcy accelerates atherosclerosis development during the early stages in apoE2/2
mice, and T lymphocytes and macrophages may be
involved.21,22 Oil red O staining was used to examine the
lipid composition in root areas of aortas with adoptive
Treg cell transfer to explore the role of Tregs during this
process. apoE2/2 mice with a clinically relevant level of
plasma Hcy (see Supplementary material online, Table S1),
showed slight development of atherosclerotic lesions at 2
weeks and substantial elevated at 4 and 6 weeks
(Figure 1A and Supplementary material online, Figure
S1A–C). These alterations were associated with increased
infiltration of T cells (Figure 1B) and macrophages
(Figure 1C) into the plaque. The groups did not differ in
body weight (data not shown) or plasma triglyceride or
total cholesterol levels (see Supplementary material
online, Table S1). Cotransfer of normal Tregs from C57BL/
6J mice significantly attenuated atherosclerotic lesion size
(Figure 1A) and infiltration of T cells (Figure 1B) and macrophages (Figure 1C) into plaque in HHcy apoE2/2 mice.
However, the collagen content in lesions was not affected
by Treg transfer (Figure 1D).
157
3.2 Adoptive transfer of Tregs reversed the
HHcy-accelerated proliferation of T cells
T cells can be polyclonal activated, regardless of specificity.
Anti-CD3 antibody and concanavalin A (ConA) are commonly
used as polyclonal T-cell activators. Our previous work
suggested that HHcy may be involved in the pathogenesis of
atherosclerosis by enhancing ConA-induced T-cell proliferation.21 In the present study, we used anti-CD3 antibody to activate Tcells and found that Hcy increased the proliferation of T
lymphocytes in vitro as well (data not shown). Since Tregs negatively regulate the function of Th1 and Th2 effector cells,23 we
performed an in vivo adoptive cell transfer study to determine
whether Treg transfer could attenuate HHcy-increased T-cell
proliferation. T-cell proliferation rate was significantly
increased in apoE2/2 mice with HHcy at 2 (Figure 2A), 4
(Figure 2B), and 6 weeks (Figure 2C). However, T-cell proliferation was significantly lower in HHcy apoE2/2 mice receiving
normal Tregs from C57BL/6J mice than in those receiving
saline, at 2 (Figure 2A), 4 (Figure 2B), and 6 weeks (Figure 2C).
3.3 HHcy decreased the proportion of Tregs
in splenic T cells in vivo
Since adoptive transfer of Tregs could reduce atherosclerotic plaque size and reverse the HHcy-promoted proliferation
of T cells, we hypothesized that Hcy treatment might alter
Treg frequency and accelerate atherosclerosis. In agreement
Figure 1 Adoptive transfer of Tregs reduced atherosclerotic plaque size and infiltration of macrophages and T cells into plaque. apoE2/2 mice, 6 weeks old,
were fed normal mouse chow with or without water supplemented with Hcy (1.8 g/L DL-Hcy) for 2, 4, and 6 weeks. Serial sections of dissected aortic roots were
stained with Oil red O (magnification 100), anti-Mac-3 antibody, anti-CD4 antibody, and Sirius red (magnification 200). (A) Quantification of the mean aortic
root lesion areas in each group. (B) Representative photomicrographs of T-cell infiltration in lesions. Arrows indicate CD4þ T cells. (C) Representative photomicrographs of macrophage infiltration in lesions. (D) Representative photomicrographs of collagen in lesions. *P , 0.05 compared with control. #P , 0.05 compared
with HHcy group.
158
J. Feng et al.
Figure 3 HHcy decreased the proportion of Tregs in splenic T cells in vivo.
Flow cytometry analysis of spleen-derived T cells obtained from apoE2/2
mice with and without (control) HHcy at 2 (A), 4 (B), and 6 weeks (C ). T
cells were stained with specific antibodies to CD4þ and CD25þ as outlined
in Section 2. Results are mean + SEM of six mice per group. *P , 0.05 compared with control.
Figure 2 Adoptive transfer of Tregs reversed HHcy-accelerated proliferation
of T cells. Spleen-derived T lymphocytes obtained from HHcy apoE2/2 mice
with or without normal Treg transfer and apoE2/2 mice alone (control) at 2
(A), 4 (B), and 6 weeks (C ). T lymphocytes were incubated in the presence of
anti-CD3 antibody (0.25–1 mg/mL) for 48 h, and proliferation was assayed by
[3H]-TdR incorporation. The data are expressed as CPM. *P , 0.05 compared
with control. #P , 0.05 compared with HHcy þ saline group.
with this hypothesis, the proportion of CD4þCD25high T cells
in splenic T cells was reduced, by 41.4, 60, and 27.7%, at 2
(Figure 3A), 4 (Figure 3B), and 6 weeks (Figure 3C), respectively, in HHcy apoE2/2 mice.
3.4 Foxp3 mRNA and protein levels were
down-regulated in HHcy apoE2/2 mice
Since Foxp3 is not only a faithful marker for CD4þCD25þ Tregs
but also is necessary and sufficient for their development and
function,24,25 we tested the effect of HHcy on Foxp3 mRNA
expression by real-time PCR and protein expression by
western blot analysis in T cells from murine spleens both
in vitro and in vivo. Foxp3 mRNA and protein expressions in
T cells were reduced at 2 (Figure 4A and E), 4 (Figure 4B
and F), and 6 weeks (Figure 4C and G) in apoE2/2 mice
treated with HHcy. In addition, Foxp3 mRNA and protein
expressions in Tcells were significantly decreased after treatment with Hcy 30 mM for 48 h in vitro (Figure 4D and H ). These
results suggest that reduced Foxp3 expression is responsible
for HHcy-induced Treg down-regulation in apoE2/2 mice,
and the decreased Foxp3 protein expression was due, at
least in part, to reduced mRNA expression.
3.5 HHcy impaired the suppressive function
of Tregs in vitro and in vivo
To investigate the HHcy effect on the suppressive function of
Tregs, we mixed sorted CD4þCD25þ Tregs and CD4þCD252
effector T cells (Teffs) in different ratios in the presence
or absence of Hcy 30 mM. The co-culture assay, which has
been well validated to assess Treg function, showed that
Teff proliferation was greater in apoE2/2 mice treated
with HHcy than in controls at 2 (Figure 5A), 4 (Figure 5B),
and 6 weeks (Figure 5C), which suggests that the function
of Tregs was impaired in HHcy apoE2/2 mice. The
in vitro co-culture assay revealed Teff proliferation
enhanced by 30 mM Hcy treatment for 72 h, which indicates
that the suppressive activity of CD4þCD25þ Treg was
decreased as well (Figure 5D). In addition, CD4þCD252
Teffs showed normal proliferation and CD4þCD25þ Tregs
Regulatory T cells and atherosclerosis
159
Figure 4 Foxp3 mRNA and protein level were down-regulated in HHcy apoE2/2 mice. Quantitative Foxp3 mRNA expression (relative to that of GAPDH) of T
lymphocytes purified from murine spleens using specific magnetic beads in apoE2/2 mice with and without (control) HHcy at 2 (A), 4 (B), and 6 weeks (C ). (D)
Effect of Hcy (with or without 30 mM Hcy treatment for 48 h) on Foxp3 mRNA expression in primary T lymphocytes from C57BL/6J mice by real-time PCR (n ¼ 3).
Western blot analysis of Foxp3 protein expression was determined in splenic T lymphocytes from apoE2/2 mice with and without (control) HHcy at 2 (E), 4 (F ),
and 6 weeks (G). (H ) Western blot analysis of Foxp3 protein expression was determined in splenic T lymphocytes from C57BL/6J incubated with Hcy (30 mM) in
the presence of anti-CD3 antibody for 48 h. Densitometric analysis of Foxp3 protein expression (relative to eIF5) is shown in the right panel. *P , 0.05 compared
with control.
160
J. Feng et al.
Figure 5 HHcy impaired the suppressive function of Tregs in vitro and in vivo. Magnetic bead-sorted Tregs were co-incubated at different ratios with Teffs from
apoE2/2 mice with and without (control) HHcy at 2 (A), 4 (B), and 6 weeks (C ). (D) Tregs were co-incubated at different ratios with Teffs from C57BL/6J spleens
with or without Hcy (30 mM) in the presence of anti-CD3 antibody for 72 h (n ¼ 3). Proliferation was assessed by [3H]-TdR incorporation. *P , 0.05 compared with
control.
showed lower proliferation than did controls after treatment with 30 mM Hcy for 72 h (Figure 5D), which indicates
that Hcy directly inhibits Treg but not Teff function in
vitro. In vivo, HHcy treatment attenuated Treg activity
and promoted Teff proliferation (Figure 5A–C).
3.6 HHcy increased pro-inflammatory and
decreased anti-inflammatory cytokine production
from activated splenic T cells in early
atherosclerosis
To further study the mechanisms of the HHcy-induced inflammatory responses, we investigated whether Hcy could affect
the secretion of cytokines from activated T cells. ELISA assay
revealed significantly increased IL-2, IFN-g, and IL-17 levels
(Figure 6A–C) but decreased IL-10 and TGF-b levels at 2
(Figure 6E and I), 4 (Figure 6F and J ), and 6 weeks
(Figure 6G and K) in activated splenic T cells from apoE2/2
mice with HHcy. In response to anti-CD3-antibody stimulation,
purified splenic T cells from mice treated with normal Tregs
showed lower levels of IL-2, IFN-g, and IL-17 (Figure 6A–C)
and higher levels of IL-10 (Figure 6E–G) and TGF-b
(Figure 6I–K) than did T cells from mice without Treg cotransfer. In vitro, Hcy treatment resulted in enhanced IL-2, IFN-g,
and IL-17 secretion by Tcells (Figure 6D), but IL-10 production
by activated Tcells was not affected (Figure 6H). Within a concentration range of 30–300 mM Hcy, TGF-b production by activated T cells was slightly reduced (Figure 6L).
4. Discussion
As a potent pro-inflammatory factor, HHcy accelerates the
development of atherosclerosis by promoting inflammation
both in vitro and in vivo.20,22 T-cell- and macrophageproduced cytokines may play an important role in this
process. However, how different subsets of T cells exert
their effect on the initiation of HHcy-accelerated atherosclerosis is unknown. In the current study, we demonstrated
that HHcy leads to reduced proportion and suppressive function of Tregs, with increased atherosclerotic lesion area and
accumulation of macrophages and T cells in plaques of
apoE2/2 mice. Importantly, the adoptive transfer of
Tregs from age-matched normal C57BL/6J mice to HHcy
apoE2/2 mice significantly abrogated the atherosclerotic
lesions and attenuated the HHcy-induced infiltration of
macrophages and T cells in plaques. Our data demonstrate
for the first time that HHcy-induced Treg reduction in proportion and function may be responsible, at least in part,
for HHcy-accelerated atherosclerosis in apoE2/2 mice.
Atherosclerosis is a chronic inflammatory disease.1 As a
potent pro-inflammatory factor, HHcy can accelerate atherosclerotic development in the early stages of hypercholesterolaemia.22 In the process, HHcy causes significant
promotion of ConA-induced proliferation of T lymphocytes21
and lipopolysaccharide-induced proliferation of B lymphocytes.26 An increasing body of evidence suggests that
Tregs, which control immunological tolerance, suppress
both Th1 and Th2 immune responses and prevent the development of various immunoinflammatory diseases and may
play an important role in controlling atherosclerosis development. Treg depletion by the use of an anti-CD25 antibody
also enhances atherosclerosis in apoE2/2 mice.9 de Boer
et al.11 recently reported low levels of Tregs in all developmental stages of human plaques, which highlight the relevance of this T-cell subset in human atherosclerosis.
Regulatory T cells and atherosclerosis
161
Figure 6 HHcy increased pro-inflammatory and decreased anti-inflammatory cytokine production from activated splenic T cells in early atherosclerosis. In lymphocyte proliferation assays, IL-2, IFN-g, IL-17, IL-10, and TGF-b production in the supernatant was measured by ELISA, respectively. Purified spleen-derived T
cells were isolated from apoE2/2 mice with and without (control) HHcy at 2 (A, E, and I ), 4 (B, F, and J ), and 6 weeks (C, G, and K ). Purified T cells from C57BL/
6J mice (D, H, and L) were cultured with or without Hcy (30–300 mM) for 48 h in anti-CD3 antibody-coated microplates (n ¼ 3 for each). All cultures were performed in triplicate. *P , 0.05 compared with control. #P , 0.05 compared with HHcy group.
162
Both the number and functional properties of Tregs are
important in mediating immune and inflammatory
responses.27 Experimental models revealed an impaired
Treg-regulated immune mechanism in atherosclerosis.28 We
hypothesize that HHcy may alter the number and function
of Tregs, thus leading to accelerated atherosclerosis. In
support of this hypothesis is our finding that transfer of
Tregs from normal age-matched C57BL/6J mice significantly
reduced atherosclerotic lesion area in HHcy apoE2/2 mice
and reversed the HHcy-enhanced proliferation of T cells.
Notably, cotransfer of Tregs resulted in a marked reduction
in infiltration of T cells and macrophages into plaques,
which suggests reduced plaque inflammation. This finding,
validated by measuring plaque size in the aortic roots and
analysis of lesion macrophage and T-cell infiltration,
suggests that the normal function of Tregs may be essential
for maintaining the homeostasis of different subsets of T
cells in the vessel wall.
In agreement with our findings that HHcy treatment significantly reduced the proportion of Tregs in splenic T cells
of apoE2/2 mice, others have reported on a low number
of Tregs in human atherosclerotic lesions.11 However, how
the number and function of Tregs are regulated during
atherosclerosis is unclear. Because Foxp3 expression is
strongly associated with a Treg phenotype and is pivotal
for the acquisition of regulatory properties,29 we reasoned
that HHcy-induced Treg reduction in number and function
might be mediated by Foxp3. HHcy indeed down-regulated
the mRNA and protein expression of Foxp3 in murine
splenic T cells, which suggests that reduced Foxp3
expression is responsible for HHcy-induced Treg reduction
in apoE2/2 mice.
apoE2/2 mice usually have hypercholesterolaemia. We
wondered whether the effect of HHcy on Tregs was influenced by a hypercholesterolaemic environment. We found
the concentration of total plasma cholesterol significantly
elevated in apoE2/2 mice, regardless of Hcy supplementation (see Supplementary material online, Table S1).
However, total cholesterol levels were not changed among
all groups. So the effect of HHcy was not associated with
severe hypercholesterolaemia. Furthermore, we investigated the HHcy effect on Tregs in C57BL/6J mice with
normal plasma total cholesterol level and found the Treg
number reduced and suppressive activity impaired in such
mice (data not shown). These data indicate that Hcy alone
inhibited the number and function of Tregs and the
HHcy-induced Treg suppressive function in apoE2/2 mice
may not be associated with hypercholesterolaemia.
Several experimental studies have clearly shown a critical
pathogenic role for a Th1-cell-mediated response in atherosclerosis by their secreting pro-inflammatory cytokines such
as IL-2 and IFN-g.5–8 IL-10 and TGF-b can mediate the Treg
suppressive function in pathogenic T cells in vivo, although
other cell–cell contact mechanisms of suppression have
been identified in vitro.30 The adoptive transfer of Tregs
with specific deletion of TGF-b fails to inhibit T-cell-induced
colitis in vivo.31 Disruption of TGF-b signalling in T cells
accelerates atherosclerosis.32 In addition, stimulation of
peripheral CD4þCD252 T lymphocytes with TGF-b can
up-regulate Foxp3 expression and result in a suppressive
function in vitro, 33,34 which indicates that TGF-b is required
for Treg activation/induction. In our study, incubation of
Tregs with Teffs at different ratios revealed that HHcy
J. Feng et al.
significantly reduced the suppressive properties of Tregs,
as evidenced by enhanced proliferation of effector
CD4þCD252 cells both in vitro and in vivo. In addition, the
production of the anti-inflammatory cytokines TGF-b and
IL-10 in the culture by activated T cells was decreased but
that of the pro-inflammatory cytokines IL-2, IFN-g, and
IL-17 was increased in HHcy apoE2/2 mice. Therefore,
our data indicate that decreased Treg function may be
responsible for the initiation of atherosclerosis in the early
stage of the disease. Our data provide an explanation for
HHcy attenuating Treg activity and accelerating atherosclerosis by inhibiting TGF-b and IL-10 secretion and promoting IL-2, IFN-g, and IL-17 production from activated T cells
in vivo.
Superoxide anions are present in the aortic wall of HHcy
mice.35 Our group has reported that Hcy increases the production of ROS from T lymphocytes. The potential effect
of Hcy on ConA-induced T-cell proliferation is significantly
reduced by antioxidants.21 Furthermore, increased ROS
level generated by the thiol (–SH) of Hcy auto-oxidation
can damage and modify proteins, for example, by inducing
the production of oxidized-LDL, which results in activation
of specific T cells and contributes to the development of
atherosclerosis.36 Recent studies have shown that the
effect of oxidized-LDL on atherosclerosis is associated with
reduced frequency and compromised suppressive function
of Tregs.10 Induced oral tolerance to oxidized-LDL resulted
in the suppression of early atherosclerosis, which may be
explained by a significant increase in Treg level.37,38 Thus,
oxidative stress may be one of the mechanisms of
HHcy-induced reduction in Treg level and accelerated atherosclerosis. Our laboratory is working on further understanding the mechanism of HHcy-induced Treg reduction in
atherosclerosis.
In summary, a specific subset of CD4þ T cells, Tregs, play
an important role in the initiation of HHcy-accelerated
atherosclerosis. The proportion and suppressive function of
Tregs are reduced in HHcy aopE2/2 mice, which suggests
that HHcy modulates atherosclerosis through its effect on
Treg responses. Transfer of normal Tregs in an atherosclerotic model results in significant attenuation of atherosclerosis. These studies suggest novel potential therapeutic
avenues for atherosclerosis in terms of modulation of
Treg response. As is known, regulatory pathways are
likely to be complex. Further investigations are needed to
clarify the exact mechanism by which Tregs ameliorate
HHcy-accelerated atherosclerosis.
Supplementary material
Supplementary material is available at Cardiovascular
Research online.
Acknowledgements
The authors wish to thank Prof. Yang Liu and Prof. Weiping Zou at
the University of Michigan School of Medicine for their discussions
and comments, and Ms Li Chen from Peking University Health
Science Center for her excellent technical assistance.
Conflict of interest: none declared.
Regulatory T cells and atherosclerosis
Funding
This work was supported by the National Natural Science
Foundation of the PR China [30730042, 30570714, and
30821001] and the National Basic Research Program of the
PR China [2006CB503802] to X.W., and the Chang Jiang Scholars Program to Q.X.
References
1. Hansson GK, Robertson AK, Soderberg-Naucler C. Inflammation and
atherosclerosis. Annu Rev Pathol 2006;1:297–329.
2. Nilsson J. Regulating protective immunity in atherosclerosis. Circ Res
2005;96:395–397.
3. Hansson GK, Nilsson J. Introduction: atherosclerosis as inflammation: a
controversial concept becomes accepted. J Intern Med 2008;263:
462–463.
4. Mallat Z, Ait-Oufella H, Tedgui A. Regulatory T-cell immunity in atherosclerosis. Trends Cardiovasc Med 2007;17:113–118.
5. Hansson GK. Inflammation, atherosclerosis, and coronary artery disease.
N Engl J Med 2005;352:1685–1695.
6. Binder CJ, Chang MK, Shaw PX, Miller YI, Hartvigsen K, Dewan A et al.
Innate and acquired immunity in atherogenesis. Nat Med 2002;8:
1218–1226.
7. Hansson GK, Berne GP. Atherosclerosis and the immune system. Acta Paediatr Suppl 2004;93:63–69.
8. Nilsson J, Hansson GK. Autoimmunity in atherosclerosis: a protective
response losing control? J Intern Med 2008;263:464–478.
9. Ait-Oufella H, Salomon BL, Potteaux S, Robertson AK, Gourdy P, Zoll J
et al. Natural regulatory T cells control the development of atherosclerosis in mice. Nat Med 2006;12:178–180.
10. Mor A, Planer D, Luboshits G, Afek A, Metzger S, Chajek-Shaul T et al.
Role of naturally occurring CD4þ CD25þ regulatory T cells in experimental atherosclerosis. Arterioscler Thromb Vasc Biol 2007;27:893–900.
11. de Boer OJ, van der Meer JJ, Teeling P, van der Loos CM, van der Wal AC.
Low numbers of FOXP3 positive regulatory T cells are present in all developmental stages of human atherosclerotic lesions. PLoS ONE 2007;2:
e779.
12. Mallat Z, Tedgui A. Immunomodulation to combat atherosclerosis: the
potential role of immune regulatory cells. Expert Opin Biol Ther 2004;
4:1387–1393.
13. Wick G, Knoflach M, Xu Q. Autoimmune and inflammatory mechanisms in
atherosclerosis. Annu Rev Immunol 2004;22:361–403.
14. Xu Q. Role of heat shock proteins in atherosclerosis. Arterioscler Thromb
Vasc Biol 2002;22:1547–1559.
15. Chyu KY, Nilsson J, Shah PK. Immunization for atherosclerosis. Curr
Atheroscler Rep 2007;9:104–109.
16. McCully KS. Homocysteine and vascular disease. Nat Med 1996;2:
386–389.
17. Guthikonda S, Haynes WG. Homocysteine as a novel risk factor for atherosclerosis. Curr Opin Cardiol 1999;14:283–291.
18. McCully KS. Hyperhomocysteinemia and arteriosclerosis: historical perspectives. Clin Chem Lab Med 2005;43:980–986.
19. Carson NA, Neill DW. Metabolic abnormalities detected in a survey of
mentally backward individuals in Northern Ireland. Arch Dis Child 1962;
37:505–513.
163
20. Zeng X, Dai J, Remick DG, Wang X. Homocysteine mediated expression
and secretion of monocyte chemoattractant protein-1 and interleukin-8
in human monocytes. Circ Res 2003;93:311–320.
21. Zhang Q, Zeng X, Guo J, Wang X. Oxidant stress mechanism of homocysteine potentiating Con A-induced proliferation in murine splenic T lymphocytes. Cardiovasc Res 2002;53:1035–1042.
22. Dai J, Li W, Chang L, Zhang Z, Tang C, Wang N et al. Role of redox factor-1
in hyperhomocysteinemia-accelerated atherosclerosis. Free Radic Biol
Med 2006;41:1566–1577.
23. Mallat Z, Ait-Oufella H, Tedgui A. Regulatory T cell responses: potential
role in the control of atherosclerosis. Curr Opin Lipidol 2005;16:518–524.
24. Williams LM, Rudensky AY. Maintenance of the Foxp3-dependent developmental program in mature regulatory T cells requires continued
expression of Foxp3. Nat Immunol 2007;8:277–284.
25. Walker MR, Kasprowicz DJ, Gersuk VH, Benard A, Van Landeghen M,
Buckner JH et al. Induction of FoxP3 and acquisition of T regulatory
activity by stimulated human CD4þCD252 T cells. J Clin Invest 2003;
112:1437–1443.
26. Zhang Q, Zeng X, Guo J, Wang X. Effects of homocysteine on murine
splenic B lymphocyte proliferation and its signal transduction mechanism. Cardiovasc Res 2001;52:328–336.
27. Walker LS. Regulatory T cells overturned: the effectors fight back. Immunology 2009;126:466–474.
28. Gotsman I, Grabie N, Gupta R, Dacosta R, MacConmara M, Lederer J et al.
Impaired regulatory T-cell response and enhanced atherosclerosis in the
absence of inducible costimulatory molecule. Circulation 2006;114:
2047–2055.
29. Wan YY, Flavell RA. Regulatory T-cell functions are subverted and converted owing to attenuated Foxp3 expression. Nature 2007;445:
766–770.
30. von Boehmer H. Mechanisms of suppression by suppressor T cells. Nat
Immunol 2005;6:338–344.
31. Li MO, Wan YY, Flavell RA. T cell-produced transforming growth factorbeta1 controls T cell tolerance and regulates Th1- and Th17-cell differentiation. Immunity 2007;26:579–591.
32. Robertson AK, Rudling M, Zhou X, Gorelik L, Flavell RA, Hansson GK. Disruption of TGF-beta signaling in T cells accelerates atherosclerosis. J Clin
Invest 2003;112:1342–1350.
33. Wan YY, Flavell RA. Identifying Foxp3-expressing suppressor T cells with a
bicistronic reporter. Proc Natl Acad Sci USA 2005;102:5126–5131.
34. Chen W, Jin W, Hardegen N, Lei KJ, Li L, Marinos N et al. Conversion of
peripheral CD4þCD25- naive T cells to CD4þCD25þ regulatory T cells
by TGF-beta induction of transcription factor Foxp3. J Exp Med 2003;
198:1875–1886.
35. Au-Yeung KK, Woo CW, Sung FL, Yip JC, Siow YL, O K. Hyperhomocysteinemia activates nuclear factor-kappaB in endothelial cells via oxidative
stress. Circ Res 2004;94:28–36.
36. Zhou X, Robertson AK, Hjerpe C, Hansson GK. Adoptive transfer of CD4þ
T cells reactive to modified low-density lipoprotein aggravates atherosclerosis. Arterioscler Thromb Vasc Biol 2006;26:864–870.
37. van Puijvelde GH, Hauer AD, de Vos P, van den Heuvel R, van
Herwijnen MJ, van der Zee R et al. Induction of oral tolerance to oxidized
low-density lipoprotein ameliorates atherosclerosis. Circulation 2006;
114:1968–1976.
38. van Puijvelde GH, van Es T, van Wanrooij EJ, Habets KL, de Vos P, van der
Zee R et al. Induction of oral tolerance to HSP60 or an HSP60-peptide
activates T cell regulation and reduces atherosclerosis. Arterioscler
Thromb Vasc Biol 2007;27:2677–2683.