Download Suppression of the Malignant Phenotype in Somatic Cell Hybrids

[CANCER RESEARCH 50. 3095-3100, May 15. 1990)
Suppression of the Malignant Phenotype in Somatic Cell Hybrids between Burkitt's
Lymphoma Cells and Epstein-Barr Virus-immortalized Lymphoblastoid Cells
despite Deregulated c-myc Expression
JürgenWolf,1 Michael Pawlita, JörnBullerdiek, and Harald zur Hausen
Institut fur \ 'irusforschung-ATl', Deutsches Krebsforschungszentruni Heidelberg, Im Neuenheimer Feld 506, D-6900 Heidelberg, Federal Republic of Germany /J. H'.,
M. P., H. :. H.], and Zentrum fur Humangenetik, L'niversitat Bremen, D-2800 Bremen, Federal Republic of Germany /J. B.]
ABSTRACT
To approach the question whether the absence of specific cellular gene
functions may be involved in Burkitt's lymphoma pathogenesis, somatic
cell hybrids »ereestablished between a malignant Epstein-Barr virus
(EBV) positive Burkitt's lymphoma cell line (HI 60) and a nonmalignant
EBV-immortalized lymphoblastoid cell line (IARC 277) derived from the
same individual. The hybrids revealed a near tetraploid karyotype includ
ing one copy of the 8q+ chromosome resulting from the Burkitt's lymphoma-specific translocation t(8;22) in addition to three apparently nor
mal copies of chromosome 8. Although the hybrid cells exhibited the
deregulated c-myc expression pattern of the parental Burkitt's lymphoma
cell line with highly abundant transcripts originating from the 8q* chro
mosome, their growth characteristics in tissue culture as well as in nude
mice were identical to that of the parental nonmalignant lymphoblastoid
cell line. These data indicate that, at least in the system described here,
the malignant phenotype of Burkitt's lymphoma cells can be suppressed
by introduction of an additional set of apparently normal chromosomes
from the same individual and that EBV infection and c-myc deregulation
may not be sufficient for maintenance of the malignant phenotype.
malignant phenotype of BL (13, 14).
However, despite extensive studies of EBV infection and cmyc expression in BL (12, 15-19), the precise mechanisms by
which these two postulated oncogenic functions act in the
process of malignant transformation are not well understood.
It remained an open question whether further, as yet unidenti
fied, mechanisms contribute to the development of BL.
Using the technique of somatic cell hybridization we ap
proached the question whether the absence of specific cellular
gene functions may be involved in BL pathogenesis. Cells of a
highly tumorigenic EBV-positive BL cell line carrying a variant
t(8;22) translocation were fused with nontumorigenic EBVimmortalized B-lymphoblastoid cells originating from the same
individual. All hybrid clones investigated were nontumorigenic
in nude mice despite presence of EBV and continued deregu
lation of the c-myc gene.
MATERIALS
AND METHODS
Cells. The Burkitt's lymphoma cell line BL 60 and the lymphoblas
INTRODUCTION
Suppression of the tumorigenic phenotype in somatic cell
hybrids between malignant and nonmalignant cells has strongly
supported the view that absence of specific cellular gene func
tions might represent a critical condition for malignant trans
formation (1-3).
Until now this mechanism has been implicated mainly in the
development of tumors of epithelial and mesenchymal origin,
whereas malignancies of the hematopoietic and lymphatic sys
tem may be considered as models for the dominance of activated
oncogenes. A prototype for these latter malignancies is endemic
BL,2 a malignant B-cell lymphoma, occurring in equatorial
Africa and New Guinea (4). Seroepidemiological studies (5) as
well as the detection of the viral DNA in the tumor (6) have
provided strong evidence for an etiological role of EBV in the
development of endemic BL.
In addition specific chromosomal translocations are consist
ently found in BL which involve the c-myc gene on chromosome
8 and immunoglobulin gene loci on the chromosomes 14, 22,
or 2 (7-9). The c-myc alÃ-eleinvolved in these translocations is
either truncated or shows somatic mutations in, or around, the
first exon (10-12). These structural alterations as well as the
proximity of the c-myc gene to immunoglobulin enhancer ele
ments caused by the translocation have led to the hypothesis
that a deregulated c-myc gene expression contributes to the
Received 10/17/89; revised 2/7/90.
The costs of publication of this article were defrayed in part by the payment
of page charges. This article must therefore be hereby marked advertisement in
accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
' To whom requests for reprints should be addressed.
: The abbreviations used are: BL. Burkitt's lymphoma: EBV. Epstein-Barr
virus: PBS. phosphate-buffered saline: HGPRT~. hypoxanthine-guanine-phosphoribosyltransferase deficient: cDNA. complementary DNA; PCR. polymerase
chain reaction; SDS. sodium dodecyl sulfate: RFLP. restriction fragment length
polymorphism: LCL. lymphoblastoid cell lines.
toid cell line IARC 277 were kindly provided by G. M. Lenoir (20). BL
60 originates from a 4-year-old North African female and was obtained
from a tissue sample taken at diagnosis. BL 60 was shown to be EBV
positive and to carry a chromosomal translocation t(8;22). IARC 277
was established by spontaneous outgrowth of peripheral blood lympho
cytes of the same patient (20). All cells were grown in RPMI 1640
medium supplemented with 10% fetal calf serum and antibiotics. The
concentration of viable cells was determined in 0.25% trypan blue in a
Neubauer chamber.
Electrotransfection. The electrotransfection procedure was performed
as described by Potter et al. (21). Briefly. 1 x IO7 cells and 10 ¿ig
linearized DNA of the plasmid pSV2neo (22) in a total volume of 200
n\ ice cold PBS were placed in an electroporation chamber with an
electrode distance of 4 mm. A high voltage pulse of 2200 V (capacitance
960 nF) was applied with an electropulsing device (constructed by W.
Ansorge, European Molecular Biology Laboratory, Heidelberg, West
Germany). After 5 min on ice, 20 ml growth medium were added and
cells were incubated for 24 h. Then, 2x10'
cells/ml medium were
transferred to 96-well microtiter plates (150 ^I/well; Costar) for selec
tion of G418-resistant clones (1200 ng/ml; Gibco).
Selection of HGPRT Deficient Mutants. Cells (1 x IO7)were seeded
at a concentration of 5 x IO5cells/mJ medium containing 10~* M 6thioguanine (Sigma) in 96-well microtiter plates (150 ¿¿l/well).
Within
5 days more than 99% of the cells died. Three weeks after seeding 6thioguanine-resistant colonies were obtained with a frequency of 4.2 x
10"'. About 10% of these colonies proved to be stably HGPRT~ when
seeded in hypoxanthine-aminopterine-thymidine
selective medium.
Cell Fusion and Hybrid Selection. Cells (1 x 10') of each fusion
partner were attached to 60-mm plastic Petri dishes treated with 100
Mg/ml concanavalin A (Serva) as described elsewhere (23). The plates
were then washed twice with PBS and covered with 2 ml of prewarmed
(37°C)50% (wt/vol) polyethylene glycol 1500 (Boehringer) for 90 s,
followed by washing with PBS and subsequent cultivation in RPMI
medium as described above. Forty-eight hours later, the cells, now
detached from the plastic dishes and in suspension, were transferred to
24-well tissue culture plates (I ml/well; Costar) and the medium was
changed to selective medium containing 1200 Mg/ml G418, 1 x 10~4M
3095
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 1990 American Association for Cancer Research.
SUPPRESSION
OF MALIGNANT
PHENOTYPE
hypoxanthine, 4 x 10 7M aminopterine. and 1.6 x 10 *M thymidine.
Three weeks later hybrid cell colonies appeared and were expanded in
selective medium for another 6 weeks. All further experiments with
hybrid cell lines were performed with cells that had been in tissue
culture for 3-6 months after fusion.
Cytogenetic Analysis. Metaphases were prepared according to routine
methods. Briefly, hypotonie treatment (0.05 M KC1) was followed by
methanol-glacial acetic acid fixation. For spreading, a few drops of the
suspension were delivered onto clean wet slides. For each hybrid clone
and both parental cell lines, the chromosome count of at least 10 Gbanded metaphases was determined and 3 metaphases at an about 300
bands/haploid set stage were fully karyotyped.
DNA Analysis by Southern Blot Hybridization. Extraction of cellular
DNA, restriction endonuclease digestion, and blotting were performed
using standard protocols (24). Usually 10 ^g of digested cellular DNA
were subjected to agarose gel electrophoresis, transferred onto nylon
filters (Gene Screen Plus), and hybridized under standard conditions
(Tm -20°C)with 32P-labeled DNA probes (25).
RNA Analysis by Northern Blot Hybridization. Total cellular RNA
was extracted by the guanidinium isothiocyanate method (26). Usually
5 ^igof RNA were separated in 1% agarose gels, transferred onto nylon
filters (Gene Screen), and hybridized with "P-labeled DNA probes as
described above.
Enzymatic Amplification of Reverse Transcribed RNA Sequences.
Total cellular RNA was treated for 30 min at 37°Cwith DNAse I
(Promega) for removal of contaminating DNA. AMV reverse transcriptase (Boehringer) catalyzed reverse transcription of RNA sequences
was performed as described elsewhere (27). Subsequently, the cDNA
sequences were enzymatically amplified (Thermus aquaticus polymerase, Biolabs). Forty cycles of the PCR (28) were performed. Standard
conditions were 90°Cmelting for 2 min, 50°Cannealing for 2 min, and
70°Cextension for 2 min. Three synthetic oligonucleotides of c-myc
exon 1 were used: ol (20mer, N925-N906, coding strand,
5'CTGGTTTTCCACTACCCGAA3')
as primer for reverse transcrip
tion and enzymatic amplification, o2 (20mer, N704-723, noncoding strand, 5'CCGCAACCCTTGCCGCATCC3')
as second PCR
primer,ando3(20mer, N801 -820, noncodingstrand, 5 'GACGCGGGGAGGCTATTCTG3') as diagnostic oligonucleotide for hybridization.
The sequence numbering (15) is according to GenBank DNA sequence
library, release 56.
Electroblotting. PCR-amplified cDNA fragments were separated in
8% polyacrylamide gels and stained with ethidium bromide (1 Mg/ml).
The gels were then denatured for 15 min in 0.1 M NaOH, 0.6 M NaCl,
washed 3 times with H2O, and neutralized in 25 mM sodium phosphate
buffer, pH 7. Electroblotting onto Gene Screen nylon filters was per
formed at 100 V for l h in 0.5 x TBE.
Hybridization with 5'-"P-labeled oligonucleotides (24) was per
formed in 0.9 M NaCl, 6 mM EDTA, 90 mM Tris HC1, pH 7.5, 1%
SDS, and 100 Mg/ml tRNA at Tm -7°C for 10 h. Filters were washed
for 10 min each in 3x standard saline citrate-10 mM sodium phosphate
buffer, pH 7-5% SDS and Ix standard saline citrate-1% SDS.
Tumorigenicity Assays. The tumorigenic potential of the cell lines in
nude mice was determined as described by Gurdsevitch et al. (29). Fourweek-old female nu/nu mice (Swiss background, purchased from
Charles River Laboratories) were subjected to whole body irradiation
to a dose of 4.8 Gy (60Co,0.48 Gy/min.). Twenty-four h postirradiation
the animals were inoculated with 1 x lO'viable cells from exponentially
growing cultures in a total volume of 0.1 ml; the injections were given
under the skin of both flanks of each mouse. The animals were examined
weekly to measure the minimal and maximal diameter of each tumor.
Animals were sacrificed when the tumors impaired their well-being.
IN SOMATIC CKI.L HYBRIDS
morigenic EBV-immortalized lymphoblastoid cell line IARC
277 were derived from the same individual (20) but harbor
different EBV genomes (30).
To establish somatic cell hybrids between these cell lines two
selectable markers had to be introduced. To avoid a possible
selection for tumorigenic variants, no marker was introduced
into the nonmalignant lymphoblastoid fusion partner IARC
277. Rather, BL 60 cells were rendered neomycin resistant by
transfection of the plasmid pSV2neo (22). Subsequently, spon
taneous HGPRT" mutants were selected in 6-thioguanine-containing medium. A "universal fuser" subline of BL 60, termed
BL60-P7 (neomycin-resistent HGPRT~), was fused with the
IARC 277 cell line. Seven hybrid clones were analyzed in detail.
Karyotype and c-myc RFLP Analysis. The hybrid clones were
cytogenetically characterized by near tetraploid karyotypes
(modal counts, 82-93) in comparison to the near diploid paren
tal cell lines BL60-P7 and IARC 277 (modal counts, 45-47).
In each hybrid clone one copy of the Burkitt's lymphomaderived
(8;22)(8pter—>8q24::22ql l-»22qter) translocation
chromosome (chromosome 8q+) was identified in all meta
phases as well as the 22q~ translocation chromosome and three
apparently normal copies of chromosome 8. In addition the
presence of 4 marker chromosomes, three originating from the
parental BL cell line and one originating from the parental
LCL, showed the BL/LCL hybrid nature of the clones (Fig. 1).
The presence of the BL60-P7-derived chromosome 8q+ in
the hybrid cells was confirmed by demonstration of the Pvull
RFLP in c-myc exon 1 (19). In the variant t(8;22) translocation
in BL 60 the breakpoint on chromosome 8q+ lies 3' of the cmyc gene, leaving the latter nonrearranged. One Pvull restric
tion site, however, is abolished in c-myc exon 1 on chromosome
8q+ so that in addition to the 0.86-kilobase germ line fragment
a new fragment can be detected in Southern blot analysis of
Pi'wII-digested BL 60 DNA probed with c-myc exon 1. Six of
the 7 hybrids showed the predicted 1.8-kilobase fragment with
7H s8-mt
5
X
ttt
I
J
I II III IV
Fig. 1. Cytogenetic analysis of a representative hybrid clone. The G-banded
metaphase of hybrid clone 3 demonstrates a near tetraploid chromosome comple
ment. The 8q*-translocation chromosome (large arrow) and the 22q~ chromo
RESULTS
Establishment of Somatic Cell Hybrids between the Burkitt's
Lymphoma Cell Line BL 60 and the Lymphoblastoid Cell Line
IARC 277. The EBV-positive Burkitt's lymphoma cell line BL
60 carries a variant t(8;22) translocation and is highly tumori
genic in nude mice (29). The BL 60 cell line and the nontu-
some (small arrow) resulting from the reciprocal translocation are marked. The
presence of additional marker chromosomes /: del(4)(:pl3 or 14—Iqtcr),//: 3pter3q26 or 27::?, IV: t(19;?)(pter or qten?) of the parental BL60-P7 cell line, and
///: t(18;?)(18pter-18qll::?)?ofthe
parental IARC 277 cell line further confirms
the BL/LCL hybrid nature of the cells. The Cytogenetic nomenclature is according
to ISCN (45).
3096
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 1990 American Association for Cancer Research.
SUPPRESSION
OF MALIGNANT PHENOTYPE
10.0
approximately one-third of the intensity of the germ line band
(Fig. 2). Hybrid clone 4 contained an aberrant band, probably
due to additional loss of a Pvull site.
The presence of EBV DNA sequences was demonstrated in
the parental and hybrid cells by Southern blot analysis of
ÄawHI-digested cellular DNA probed with the BamHl-W frag
ment of EBV (data not shown).
Growth Characteristics in Vitro. In suspension culture all
hybrid clones demonstrated the typical phenotype of EBVimmortalized LCL by forming large, macroscopically visible
clumps (31). indistinguishable from those observed in the pa
rental nonmalignant lymphoblastoid cells. In contrast the pa
rental Burkitt's lymphoma cells grew as individual cells without
clumping (data not shown).
Comparison of the growth kinetics of the parental cells and
the hybrids again showed no difference between the parental
lymphoblastoid cells and the hybrids. When seeded at a concen
tration of 1 x IO5 cells/ml in fresh medium, the parental
Burkitt's lymphoma cells proliferated to a final concentration
of about 3 x IO6 cells/ml within 1 week. Under the same
IN SOMATIC CELL HYBRIDS
E
_w
0>
tou
o
days
Fig. 3. Growth kinetics of the parental cell lines and the hybrid clones. Cells
(1 X 10') of each of the parental lines BL60-P7 (A) and IARC 277 (/.), the fastest
growing hybrid clone 2 (2), and the slowest growing hybrid clone 7 (7) were
seeded in I ml fresh tissue culture medium. The concentration of viable cells was
determined on days 2.4. and 6. Values given are averages of duplicates determined
in 2 independent experiments.
conditions the parental lymphoblastoid cells as well as the
hybrid clones reached a final concentration of only about 7 x
IO5cells/ml before growth arrest occurred (Fig. 3).
The parental cell lines BL 60 and IARC 277 showed no
difference for serum requirement. Also both cell lines were not
clonable in soft agar. Therefore these parameters were not
analyzed in the hybrid clones.
Tumorigenicity in Nude Mice. The parental cell lines (BL60P7, IARC 277) and the hybrid clones were tested for their
tumorigenic potential in nude mice by inoculation of 1 x IO7
cells into each flank of preirradiated nude mice (29). No differ
ence was seen between the in vivo growth pattern of the hybrid
clones and the parental lymphoblastoid cells. Initial growth of
well-circumscribed spherical masses occurred after a latency
period of 2 weeks for all cell lines. While the grafts of the
parental Burkitt's lymphoma cell line formed large progres
sively growing tumors reaching a size of 4-5 cm diameter
without any sign of regression within 5 weeks after injection,
the grafts of the parental lymphoblastoid cell line as well as of
BL
12345
67
kb
«3.O
* ***
*""
Fig. 4. Tumorigenicity assay of parental cell lines and hybrid clone 3 in
preirradiated nude mice. The injection sites of the parental Burkitt's lymphoma
cell line BL60-P7 (B). the parental LCL IARC 277 (¿).and the hybrid clone 3
(3) are shown 4 weeks after subcutaneous inoculation of I X 10'cells. BL60-P7
cells formed large, progressively growing tumors; the grafts of IARC 277 as well
as of hybrid clone 3, that reached a maximal diameter of about 1 cm, regressed
and became necrotic.
-»0.86
Fig. 2. Southern blot analysis of the Pvu\\ RFLP in c-myc exon 1 in parental
cell lines and hybrid clones. PvuII-digested cellular DNAs of the parental BL cell
line BL60-P7 (Lane A), the parental lymphoblastoid cell line IARC 277 (¿one
¿),and the hybrid clones 1-7 {Lanes 1-7) were probed with an 860-base pair
Pvull fragment containing c-myc exon 1. The position of the 0.86-kilobase (kb)
band representing the germ line c-myc Pvull fragment and the 1.8-kilobase
fragment due to loss of the Pvul\ site in c-myc exon 1 on chromosome 8q* are
noted. The size of the additional 3.0-kilobase band in hybrid clone 4 (Lane 4) is
compatible with the loss of an additional Prull site.
the hybrid clones reached a size of 0.5-1.0 cm diameter. Then
the growth of these grafts stopped and they started to regress,
partly with necroses (Fig. 4; Table 1). Two animals that carried
hybrid grafts (clones 2 and 5) with extended necroses died in a
cachectic state 7 weeks after injection. For all other hybrid
grafts as well as for the grafts of the parental lymphoblastoid
3097
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 1990 American Association for Cancer Research.
SUPPRESSION
OF MALIGNANT
PHENOTYPE
Table 1 Initial take number and growth behavior oj parental cells and hybrid
clones in preirradiated nude mice
IN SOMATIC CELL HYBRIDS
exon I
c-myc
exon II
size 5 weeks postinjection
no."2
take
cm)0-1.0
(diameter in
weekspostinjection19/208/107/88/84/67/87/87/87/12Graft
4.1-5.019877
1.1-2.0 2.1-3.0 3.1-4.0
Pvull
03
Cell
lineBL
60-P71ARC
277Hybrid1234567Initial
*mo
«5
exon III
gCO
0141
CO181
bp222
bpI
i1
bp1
1476
BBLL11
177
Pvull -+-+-+-+-4--
223344556677
+ -+-
^
+ -
°Number of injection sites with initially growing graft/total number of injec
tion sites.
428s
I
Ml
<2'.2kb
Fig. 5. Northern blot analysis of c-myc expression in parental cell lines and
hybrid clones. Equal amounts of total cellular RNA (5 Mg/lane) of the parental
cell lines BL60-P7 (Lane B) and IARC 277 (Lane L) and the hybrid clones 1-7
(Lanes 1-7) were separated on an agarose gel (ethidium bromide staining, top),
transferred to Nylon filters, and probed with c-myc exon 3 (bottom), kb. kilobase.
cell line complete regression within 9 weeks after injection
could be observed.
c-myc Transcription, c-myc transcripts in the BL cell line BL
60 originate from the translocation chromosome 8q+ and are
more abundant compared to EBV-immortalized lymphoblas
toid cells, probably due to loss of a transcriptional elongation
block near the 3' end of exon 1 (19). We wanted to analyze
whether this deregulated c-myc expression pattern of the paren
tal Burkitt's lymphoma is changed in the nonmalignant hybrid
clones. Therefore, we first determined the steady state level of
c-myc RNA in the parental cell lines and the hybrid clones by
Northern blot analysis of total cellular RNA probed with c-myc
exon 3. The amount of c-myc RNA in all hybrids was found to
be in the range ofthat present in BL60-P7, which is significantlyhigher than in IARC 277 (Fig. 5).
By Northern blot analysis we could not distinguish whether
the abundant c-myc transcripts present in the hybrid cells
originated from the 3 copies of germ line chromosome 8 or
from the BL60-P7-derived 8q+ chromosome, because the
t(8;22) translocation does not affect the size of the c-myc
transcripts. We took advantage of the PvuU RFLP in c-myc
exon 1 to identify the origin of the transcripts. A 222-base pair
c-myc exon 1 cDNA fragment extending from 181 base pairs
upstream to 41 base pairs downstream of the germ line PvuU
site, which is lost on the chromosome 8q+, was generated first
by reverse transcription and subsequently by enzymatic ampli
fication (polymerase chain reaction), using two synthetic 20mer
oligonucleotides (Fig. 6a). Following PvuU digestion cDNA
derived from transcripts of the c-myc gene on chromosome 8q+
remained undigested (i.e., 222 base pairs long), whereas cDNA
-222
-181
Fig. 6. Analysis of the origin of c-myc transcripts in parental cell lines and
hybrid clones, a. Schematic representation of the c-myc locus and the positions
and orientations of the synthetic oligonucleotidcs used as primer for reverse
transcription and enzymatic amplification (ol. 20mcr. coding strand), as second
PCR primer (o2. 20mer. noncoding strand), and the diagnostic oligonucleotide
(o3. 2omer, noncoding strand) used for hybridi/ation. The cDNA fragments that
are obtained from c-myc transcripts originating from the germ line chromosome
8 and the 8q* chromosome, respectively, after reverse transcription using ol as
primer and PCR primed by ol and o2 followed by PvuU digestion are shown
schematically, h. Separation of the amplified cDNA fragments of the parental
cell lines BL60-P7 (Lanes B), IARC 277 (Lanes /.). and the hybrid clones 1-7
(Lanes 1-7) with (+ ) and without (-) A'uII digestion in 8'ïpolyacrylamide gels.
A linearized 2959-base pair (bp) plasmid DNA fragment which can be cut by
Pvull into 2514- and 445-base pair fragments was added after amplification and
codigested to monitor completeness of Pvull digestion. In Lane L+, 10 times
more amplification products were loaded onto the gel to visualize the small 41base pair fragment. In c. the gel shown in h was electroblotted and hybridized
with end-labeled oligonucleotide o3.
derived from germ line c-myc transcripts was digested into two
fragments of 181 and 41 base pairs. As shown by ethidium
bromide staining of the PvwII-digested amplified cDNA frag
ments (Fig. 6b) as well as after hybridization with an internal
diagnostic oligonucleotide (Fig. 6c), only transcripts from chro
mosome 8q+ could be found with this highly sensitive method
in the hybrid clones 1-7. After long-term exposure we could
detect traces of germ line-derived c-myc transcripts with an
intensity of less than 1% of the 8q+-derived transcripts. No cmyc cDNA fragments were obtained in control experiments in
which reverse transcriptase was omitted.
c-myc transcription was also analyzed in vivo. From three
regressing, partly necrotic hybrid grafts (clones 2, 5, and 7), we
could isolate intact RNA to determine steady state level and
chromosomal origin of c-myc transcripts as described above, cmyc transcripts in these regressing hybrid grafts were found to
be highly abundant and derived almost exclusively from the
BL60-P7 8q* chromosome as observed in tissue culture (data
not shown).
These results indicate that despite their lymphoblastoid celllike growth pattern in vitro and in vivo the hybrid clones show
the deregulated c-myc expression pattern of the parental Burkitt's lymphoma cell line.
3098
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 1990 American Association for Cancer Research.
SUPPRESSION OF MALIGNANT PHENOTYPE IN SOMATIC CELI. HYBRIDS
DISCUSSION
Using the technique of somatic cell fusion, we have ap
proached the question whether the absence of specific cellular
functions might represent an essential condition in the pathogenesis of endemic BL. Hybrids between a highly tumorigenic
BL cell line and a nontumorigenic LCL derived from the same
individual were shown to be nontumorigenic despite the pres
ence of EBV and the continued deregulation of the c-myc gene.
Suppression of the malignant phenotype has already been
observed for a wide spectrum of murine and human tumor cells
fused with normal fibroblasts or keratinocytes (32-36).
Whether this tumor suppression effect is also a characteristic
of lymphoma/lymphocyte hybrids, however, has still been un
clear. For instance, murine T-lymphoma/lymphocyte
hybrids
retained the tumorigenic phenotype (37, 38). In addition, the
murine plasmacytoma/lymphocyte
hybrids commonly used for
the production of monoclonal antibodies show progressive
growth in vivo (3). It thus remained an open question whether
these results reflected a dominance of phenotype of the malig
nant lymphoma or whether they were due to loss of the chro
mosomes which are thought to be necessary for tumor suppres
sion. In the seven BL/LCL hybrid clones presented here, nontumorigenicity correlates well with a stable, near tetraploid
karyotype.
In previous studies with BL/LCL hybrids which were estab
lished to analyze the regulation of the translocated c-myc gene
(39, 40), no conclusions concerning a putative tumor suppres
sion mechanism could be drawn, because the parental LCL,
despite its lymphoblastoid phenotype in tissue culture, was
highly tumorigenic in nude mice after introduction of selection
markers (39).
Our result that the EBV-positive BL/LCL hybrids are not
tumorigenic despite deregulated c-myc expression may have
implications for the understanding of endemic BL. A three-step
development of endemic BL has been suggested by Klein (41).
According to this model, primary EBV infection is the first
event and leads to B-lymphocyte immortalization. Subsequent
T-cell suppression and polyclonal B-cell proliferation stimu
lated by parasite infection, e.g., holoendemic malaria, cause an
increase in the number of dividing B-cells which increases the
risk of genetic alterations. The chromosomal translocation is
the third step and finally leads to the deregulation of the c-myc
gene and the development of a malignant cell clone. Alterna
tively, Lenoir and Bornkamm (42) have suggested that the
malaria-induced triggering of the B-cell system and the chro
mosomal translocation precede EBV infection. Despite the
different temporal sequence in these two scenarios, the two
critical events remain the same: EBV infection and c-myc
deregulation.
Experiments in which the two postulated critical factors were
introduced into B-lymphocytes appeared to support these
models. EBV-induced immortalization and subsequent transfection of a constitutively expressed c-myc gene were reported
to render human B-lymphocytes tumorigenic, suggesting that
EBV infection and c-myc deregulation might be sufficient for
malignant transformation in this cell type (43).
The results reported here, in some contrast, indicate that, at
least in somatic BL/LCL hybrids, EBV and c-myc deregulation
may not be sufficient for maintenance of the tumorigenic phe
notype.
At present we cannot exclude that specific features of the
experimental system of somatic cell hybrids contribute to the
suppression of the malignant phenotype. For instance, gene
dosage effects in the near tetraploid hybrids could result in an
increased production of a factor inhibiting the product of the
activated c-myc gene.
The discrepancy between the tumorigenicity of the c-myc
transfectants in the study mentioned above and our nontumo
rigenic BL/LCL hybrids might also be due to the use of different
cell lines and experimental conditions in the tumorigenicity
assays. The c-myc transfectants were reported to induce tumors
within 5 weeks after inoculation into untreated nude mice, in
contrast to the control LCLs which did not obtain c-myc
expression plasmids. No further information was provided on
size and long-term growth pattern of the transfectants. In the
present study, 5 weeks after inoculation into preirradiated nude
mice, most of the LCL and hybrid grafts appeared as small
tumors but regressed completely in the following weeks. Similar
results, albeit with an overall reduced take rate, were also
obtained with a small number of nonirradiated recipient nude
mice (data not shown). The in vivo growth pattern observed for
the parental cell lines in the present study is in accordance with
the results of Gurdsevitch et al. (29) who tested a large number
of BL cell lines and LCLs for their tumorigenic potential in
nude mice.
Our view that EBV infection and c-myc deregulation may
not be sufficient for tumorigenicity of B-lymphocytes is sup
ported by recent results of Hotchin et al. (44). These authors
also introduced a constitutively expressed c-myc gene into an
EBV-immortalized lymphoblastoid cell line and reported that
the transfectants had altered growth properties in vitro but were
not tumorigenic in vivo.
Taken together, our results suggest that the parental LCL
contributes one or more specific functions which prevent tumor
formation of the hybrids and which are absent in the parental
BL cell line.
We are currently investigating the EBV latent gene expres
sion in the hybrid cells described here. These experiments may
reveal whether a modification of the viral gene expression is
involved in tumor suppression. However, other mechanisms
have also to be considered, e.g., regulation of cell proliferation,
tumor angiogenesis, modification of the differentiation state,
and expression of specific cell surface antigens.
ACKNOWLEDGMENTS
We thank Gilbert Lenoir for providing the cell lines, Georg Born
kamm for the c-myc and EBV plasmids. Urina Klevenz for excellent
technical assistance in tumorigenicity assays, and Magnus von KnebelDoeberitz, Regine Heilbronn, Michael Boshart, and Valerie Bosch for
helpful discussion and critical reading of the manuscript.
REFERENCES
1. Sager. R. Genetic suppression of tumor formation: a new frontier in cancer
research. Cancer Res.. 46: 1573-1580. 1986.
2. Klein. G. The approaching era of the tumor suppressor genes. Science (Wash.
DC). 238: 1539-1545. 1987.
3. Harris. H. The analysis of malignancy by cell fusion: the position in 1988.
Cancer Res., 48: 3302-3306. 1988.
4. de Thé.G. Epidemiology of Epstein-Barr virus and associated diseases in
man. In: B. Roi/man (ed.). The Herpesviruses 1, pp. 25-102. New York:
Plenum Press, 1982.
5. Hcnle. G.. Henle. W., Clifford, P., Diehl. V.. Kafuko. G. W., Kirya. B. G.,
Klein. G., Morrow. R. H., Nunube. G. M. R., Pike. P., Tukei, P. M., and
Ziegler. J. L. Antibodies to Epstein-Barr virus in Burkitt's lymphoma and
control groups. J. Nati. Cancer Inst.. 43: 1147-1157, 1969.
6. 7.ur Hausen. H.. Schulte-Holthausen. H.. Klein. G.. Henle. W.. Henle. G..
Clifford. P.. and Santesson. L. EBV DNA in biopsies of linikni tumours
and anaplastic carcinomas of the nasopharynx. Nature (Lond.), 228: 10561058. 1970.
7. Dalla-Favera. R.. Bregni. M., Erikson, J.. Patterson. D.. Gallo, R. C.. and
3099
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 1990 American Association for Cancer Research.
SUPPRESSION
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
OF MALIGNANT
PHENOTVPE
Croce, C. Human c-niyc oncogene is located on the region of chromosome 8
that is translocated in Burkitt lymphoma cells. Proc. Nati. Acad. Sci. USA,
79:7824-7827. 1982.
Dalla-Favera. R.. Martinetti. S.. Gallo. R. C., Erikson. J.. and Croce. C.
Translocation and rearrangements of the c-myc oncogene locus in human
undifferentiated B-cell lymphomas. Science (Wash. DC), 219: 963-967.
1983.
Taub. R.. Kirsch. !.. Morton. C.. Lenoir. G. M.. Swan, D.. Tronick, S.,
Aaronson, S., and Leder, P. Translocation of the c-myc gene into the
immunoglobulin heavy chain locus in human Burkitt lymphoma and murine
plasmocytoma cells. Proc. Nati. Acad. Sci. USA. 79: 7837-7841. 1982.
Rabbitts, T. H.. Hamlyn. P. H.. and Baer. R. Altered nucleotide sequences
of a translocated c-myc gene in Burkitt lymphoma. Nature (Lond.). 306:
760-765, 1983.
Rabbitts. T. H.. Forster. A.. Hamlyn. P.. and Baer. R. Effect of somatic
mutation within translocated c-myc genes in Burkitt's lymphoma. Nature
(Lond.). 30V: 592-597, 1984.
Taub. R., Moulding. C.. Battey, J., Murphy, W.. Vasicek, T.. Lenoir, G. M.,
and Leder. P. Activation and somatic mutation of the translocated c-myc
gene in Burkitt lymphoma cells. Cell. 36: 339-348. 1984.
Leder. P.. Battey. J., Lenoir, G., Moulding. C.. Murphy. W., Potter, H.,
Stewart, T.. and Taub. R. Translocations among antibody genes in human
cancer. Science (Wash. DC). 222: 765-771, 1983.
Croce, C. Chromosome translocations and human cancer. Cancer Res., 46:
6019-6023. 1986.
Bernard. O.. Cory. S.. Gerondakis. S.. Webb. E.. and Adams, J. Sequence of
the murine and human cellular myc oncogenes and two modes of myc
transcription resulting from chromosome translocation in B lymphoid tu
mours. EMBO J., 2: 2375-2383. 1983.
Nishikura. K.. ar-Rushdi. A.. Erikson. J., Watt. R.. Rovera. G., and Croce.
C. Differential expression of the normal and of the translocated human cmyc oncogene in B cells. Proc. Nati. Acad. Sci. USA. 80: 4822-4826, 1983.
ar-Rushdi, A., Nishikura, K., Erikson, J., Watt, R.. Rovera. G., and Croce.
C. Differential expression of the translocated and of the untranslocated cmyc gene in Burkitt lymphoma. Science (Wash. DC). 222: 390-391, 1983.
Eick, D., Piechaczyk. M.. Henglein, B.. Blanchard, J.-M.. Traub. B.. Kofier.
E., Wust, S., Lenoir, G. M., and Bornkamm. G. W. Aberrant c-myc RNAs
of Burkitt's lymphoma cells have longer half lives. EMBO J., 4: 3717-3725.
1985.
19. Cesarman. E., Dalla-Favera. R.. Bentley. D., and Groudine. M. Mutations
in the first exon are associated with altered transcription of c-myc in Burkitt
lymphoma. Science (Wash. DC). 238: 1272-1275. 1987.
20. Lenoir. G. M.. Vuilaume. M.. and Bonnardel. C. The use of lymphomatous
and lymphoblastoid cell lines in the study of Burkitt's lymphoma. In: G.T.
O'Conor and C. L. M. Olweny (eds.). Burkitt's Lymphoma: A Human Cancer
Model. IARC Scientific Publications, Vol. 60. pp. 309-318. Lyon. France:
International Agency for Research on Cancer. 1985.
21. Potter, H.. Weis. L., and Leder. P. Enhancer-dependent expression of human
k immunoglobulin genes introduced into mouse prc-B lymphocytes by electroporation. Proc. Nati. Acad. Sci. USA. 81: 7161-7165. 1984.
22. Southern. P. J.. and Berg. P. Transformation of mammalian cells to antibiotic
resistance with a bacterial gene under control of the SV40 early region
promotor. J. Mol. Appi. Genet.. /: 327-341, 1982.
23. Graessmann, A.. Wolf. H.. and Bornkamm. G. W. Expression of EpsteinBarr virus genes in different cell types after microinjection of viral DNA.
Proc. Nati. Acad. Sci. USA, 77:433-436, 1980.
24. Maniatis, T., Fritsch. E. F., and Sambrook, J. Molecular Cloning: A Labo
ratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory,
1982!
25. Feinberg. A., and Vogelstein, B. A technique for radiolabeling DNA restric
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
IN SOMATIC CELL HYBRIDS
tion endonucleasc fragments to high specific activity. Anal. Biochem., 137:
266-267, 1984.
Chomczynski. P.. and Sacelli. N. Single-step method of RNA isolation by
acid guanidinium
thiocyanate-phenol-chloroform
extraction.
Anal.
Biochem., 162: 156-159, 1987.
Harbarth. P.. and Vosberg. H.-P. Enzymatic amplification of myosin heavychain m-RNA sequences in vitro. DNA, 7: 297-306. 1988.
Saiki, R. R.. Gelfand. D. H.. Stoffel. S.. Scharf. S. J., Higuchi. R., Glenn. H.
T., Mullis, K. B., and Erlich, H. A. Primer-directed enzymatic amplification
of DNA with a thermostable DNA polymerase. Science (Wash. DC), 239:
487-491, 1988.
Gurdsevitch. V. E.. O'Conor, G. T..and Lenoir. G. M. Burkitt's lymphoma
cell lines reveal different degrees of tumorigenicity in nude mice. Int. J.
Cancer. 41: 87-95. 1987.
Bornkamm. G. W.. von Knebel-Doeberitz. M., and Lenoir, G. M. No
evidence for differences in the Epstein-Barr virus genome carried in Burkitt
lymphoma cells and nonmalignant lymphoblastoid cells from the same
patients. Proc. Nati. Acad. Sci. USA, 81: 4930-4934. 1984.
Nilsson, K., and Klein. G. Phenotvpic and cylogenetic characteristics of
human B-lymphoid cell lines and their relevance for the etiology of Burkitt's
lymphoma. Adv. Cancer Res., 37: 319-380. 1982.
Harris. H., Miller. O. J., Klein, G.. Worst, P., and Tachibana, T. Suppression
of malignancy by cell fusion. Nature (Lond.). 223: 363-368, 1969.
Klein, Ci., Bregula. U.. Wiener. F.. and Harris. H. The analysis of malignancy
by cell fusion. J. Cell Sei.. A:659-672. 1971.
Stanbridge, E. J. Suppression of malignancy in human cells. Nature (Lond.),
260: 17-20. 1976.
Klinger. H. P. Suppression of tumorigenicity in somatic cell hybrids. Cytogenet. Cell Genet.. 27: 24-266, 1980.
Sager. R. Genetic suppression of tumor formation. Adv. Cancer Res., 44:
43-68. 1985.
Hays, E. F., Weinroth. S. E., Mac Leod. C.. and Kitada. S. Tumorigenicity
of T-lymphoma/T-lymphoma hybrids and T-lymphoma/normal cell hybrids.
Int. J. Cancer, 38: 597-601, 1986.
Uno. M.. VVirschubsky. Z.. Babonits. M.. Wiener, I-"..Sumegi. J.. and Klein.
G. The role of chromosome 15 in murine leukemogenesis. II. Relationship
between tumorignicity and the dosage of lymphoma vs. normal-parentderived chromosomes 15 in somatic cell hybrids. Int. J. Cancer. 40: 540549, 1987.
Croce, C.. Erikson. J.. ar-Rushdi. A.. Aden. D., and Nishikura. K. Translo
cated c-myc oncogene of Burkitt lymphoma is transcribed in plasma cells
and repressed in lymphoblastoid cells. Proc. Nati. Acad. Sci. USA. 81: 31703174. 1984.
Croce, C., Erikson, J.. Huebner. K.. and Nishikura, K. Coexpression of
translocated and normal c-myc oncogenes in hybrids between Daudi and
lymphoblastoid cells. Science (Wash. DC). 227: 1235-1238, 1985.
Klein, G. Lymphomadevelopment in mice and humans: diversity of initiation
is followed by convergent cytogenetic evolution. Proc. Nati. Acad. Sci. USA,
76:2442-2446. 1979.
Lenoir. G. M., and Bornkamm. G. W. Burkitt's lymphoma,a human cancer
model for the study of the multistep development of cancer: proposal for a
new scenario. In: G. Klein (ed.). Advances in Viral Oncology, Vol. 7, pp.
173-206. New York: Raven Press. 1987.
Lombardi, L., Newcomb, E. W., and Dalla-Favera. R. Pathogenesis of Burkitt
lymphoma: expression of an activated c-myc oncogene causes the tumorigenic
conversion of EBV-infected human B-lymphoblasts. Cell. 49: 161-170. 1987.
Hotchin, N. A.. Allday, M. J., and Crawford, D. H. Deregulated c-myc
expression in Epstein-Barr virus immortalized B-cells induces altered growth
properties and surface phcnotypc but not tumorigenicity. Int. J. Cancer, in
press. 1990.
ISCN: an international system for human cytogcnelic nomenclature: high
resolution banding. Cytogenet. Cell Genet., 31: 1-32, 1981.
3100
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 1990 American Association for Cancer Research.
Suppression of the Malignant Phenotype in Somatic Cell
Hybrids between Burkitt's Lymphoma Cells and Epstein-Barr
Virus-immortalized Lymphoblastoid Cells despite Deregulated
c- myc Expression
Jürgen Wolf, Michael Pawlita, Jörn Bullerdiek, et al.
Cancer Res 1990;50:3095-3100.
Updated version
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
http://cancerres.aacrjournals.org/content/50/10/3095
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at [email protected].
To request permission to re-use all or part of this article, contact the AACR Publications
Department at [email protected].
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 1990 American Association for Cancer Research.