Download Tissue-specific expression of AUX1 in maize roots

J. Plant Physiol. 157. 315 – 319 (2000)
 Urban & Fischer Verlag
http://www.urbanfischer.de/journals/jpp
Tissue-specific expression of AUX1 in maize roots
Frank Hochholdinger1, Dörte Wulff, Katrin Reuter, Woong June Park, Günter Feix*
Institut für Biologie III, Albert-Ludwigs-Universität-Freiburg, Schänzlestr. 1, D-79104 Freiburg, Germany
1
Present address: Department of Agronomy, B424 Agronomy Hall, Iowa State University, Ames, IA 50011, USA
The nucleotide sequence reported here has been submitted to GenBank under accession number AJ 011794.
Received March 10, 2000 · Accepted March 29, 2000
Summary
The cDNA of a maize homologue of Arabidopsis AUX1 was isolated. The deduced amino acid
sequence of Zm AUX1 showed 73 % identity to the corresponding At AUX1 and displayed 7 to 10
putative trans-membrane domains. Northern experiments revealed ZmAUX1 expression in the tips of
all maize root types, including the primary-, lateral-, lateral seminal- and crown-roots. In situ hybridisation experiments with tissue sections of the primary root showed that ZmAUX1 expression was
highly tissue-specific, confined to the endodermal and pericycle cell layers of the primary root along
the border of the central cylinder, as well as to the epidermal cell layer. This expression pattern
makes ZmAUX1 useful as a new marker for studies of root development in maize.
Key words: Auxin import carrier – AUX1 – cDNA – Root development – Tissue specificity – Zea
mays
Introduction
The root system of maize (Zea mays L.) consists of embryonic primary and lateral seminal roots and post-embryonic lateral-, crown- and brace-roots (Feldman 1994). In spite of the
complexity of the whole root system, the individual root types
have a similar internal tissue organisation, containing quiescent centre, apical meristem, vascular tissues, pericycle,
endodermis, cortex, epidermis, and root cap. All of this is
rather similar to Arabidopsis. However, some of the maize
root tissues, like the cortex, display many more cell files than
* E-mail corresponding author: [email protected]
Arabidopsis, and the quiescent centre of maize consists of
more than 1,000 cells (Feldman 1994). In contrast, Arabidopsis has only four cells (van den Berg et al. 1998). For an analysis of the development of the various root types, tissuespecific markers will be very helpful.
In Arabidopsis, sets of tissue-specific markers for root system have been developed by using enhancer trap lines
(Malamy and Benfey 1997) and promoter traps (Topping and
Lindsey 1997). Furthermore, after genes involved in auxin
transport have been isolated and tested for tissue-specific
expression, the identification of more tissue-specific markers
can be expected. Recently, auxin influx (Bennett et al. 1996)
and efflux (Luschnig et al. 1998, Muller et al. 1998, Utsuno et
0176-1617/00/157/03-315 $ 15.00/0
316
Frank Hochholdinger et al.
al. 1998, Chen et al. 1998) carriers have been cloned in Arabidopsis. Among them, AtAUX1 reveals a high degree of similarity to amino acid permeases acting as a proton-driven
symporter, indicating its role as a putative auxin influx carrier
(Bennett 1996). The aux1 mutant shows auxin and ethylene
resistance and aberrant root gravitropism without changes in
aboveground phenotype (Maher and Martindale 1980, Pickett
et al. 1990). In vivo gene expression studies using AtAUX1
promoter-GUS system demonstrated its expression within all
tissues of the root, from the meristematic initials to the elongation zone, including the lateral root cap. However, AtAUX1
was not expressed in the upper three tiers of the gravitysensing columella (Marchant et al. 1999).
To date, very few tissue-specific markers are available for
use in maize roots; e.g. glycine rich proteins for the root cap
(Goddemeier et al. 1998, Matsuyama et al. 1999) and SCARECROW (SCR ) for the endodermis (Lim and Benfey, personal
communication). As part of our research for root tissue-specific markers, we decided to isolate a maize homologue of
AtAUX1 expressed in the root system, since the root system
is under strong control of auxin. So far, maize genes in connection with auxin transport have not yet been isolated, although maize has been extensively used for auxin transport
studies (e.g. Hertel and Leopold 1963). In this report, we describe the isolation and characterisation of a cDNA encoding
a full length AUX1 homologue and its tissue-specific expression in the primary root of maize providing a further
marker probe for studies on root development.
Materials and Methods
Library screening and nucleotide sequence analysis
The hybridisation probe for the maize cDNA library screening was
obtained by performing PCR with 2 µg of reversely transcribed rice
seedling RNA (prepared from the variety «indica» using the RNeasykit (Qiagen), 1 µmol/L primers (CAGTTCATCACGTTCGGGTTCG and
TCGGCAGAAAGAACGGTGGCTT), devised according to the rice sequence D4186 of the expressed sequence tag (EST) database),
0.2 mmol/L deoxyribonucleoside triphosphates and 1 unit of Taq DNA
Polymerase (Pharmacia) with 35 cycles and an annealing temperature of 58 ˚C. The resulting PCR fragment, partially encoding a putative rice AUX1 homologue, was cloned into the Eco RV site of pBC
SK-. After digestion of this plasmid with Bam HI and Xho I, the rice EST
fragment was purified by gel electrophoresis and labelled with digoxigenin (Boehringer) by the random priming method. The labelled fragment was denatured at 100 ˚C, and used as a hybridisation probe to
screen approximately 300,000 plaque-forming units of a λ ZAP II
cDNA library of coleoptilar nodes of 8 to 10-day-old maize seedlings
(Goddemeier et al. 1998). Screening at 63 ˚C and in vivo excision with
a helper phage were performed according to Grasser et al. (1996).
Nucleotide sequences of the cDNA inserts were determined with an
automated sequencer (ALF, Pharmacia), and analysed with the GCG
V8.0 sequence analysis system.
Northern blot analysis
Total RNA from the tips of the primary-, lateral-, lateral seminal-, and
crown-roots was isolated from 12-day-old maize seedlings grown in a
phytochamber with a 12-hour light (28 ˚C)/12-hour dark (18 ˚C) cycle
at 70 % relative humidity. The RNA samples were separated on a denaturating 1% agrose gel (20 g/lane) and blotted on a Hybond-N + nylon-membrane (Amersham).
Northern hybridisation analysis was performed according to the
protocol of Kropat et al. (1997) with hybridisation temperature at 50 ˚C
in the presence of 55 % formamide. A 250-bp fragment of ZmAUX1
from the 3′-end of the cDNA, labelled with [α-32P]dCTP (3,000 Ci/
mmol; Amersham) by the random priming protocol, was used as the
probe.
In situ hybridisation
Longitudinal sections (12 µm-thick) of 6-day-old maize primary roots
were used for hybridisation experiments. The 250-bp 3′-end probe of
ZmAUX1 was labelled with DIG-12-rUTP according to standard protocols (Boehringer, Mannheim). Fixation, embedding, and sectioning
of root materials was performed according to Jackson (1992). Hybridisation was performed at 50 ˚C, and immunological detection was
performed according to Coen et al. (1990).
Results
Isolation and characterisation of an AUX1 homologous
cDNA from maize
For the isolation of a maize AUX1 cDNA, a maize cDNA library was screened with a 300-bp fragment corresponding to
a rice EST (D41862) with 74 % sequence identity to the 3′-end
of the coding region of the Arabidopsis AUX1 cDNA. Screening of the maize cDNA library (Goddemeier et al. 1998) led to
the isolation of a clone containing a 2108-bp fragment, representing a full length maize AUX1 cDNA homologue of the
Arabidopsis AUX1 gene (GenBank AJ011794). The ZmAUX1
cDNA had a GC content of 63 % and encoded a protein of
529 amino acids with an estimated mass of 58,190 Da, showing 73 % identity and 81% similarity (Fig. 1) to the Arabidopsis
AUX1 protein. The high sequence similarity of AUX1 between
maize and Arabidopsis was observed in a central part of 428
amino acid residues with 89 % identity. The N-terminal 41 and
the C-terminal 16 amino acids of the Arabidopsis AUX1 sequence displayed only a low sequence similarity (12 and
25 % identity, respectively) to the corresponding maize sequence.
Zm AUX1 protein is 44 amino acid residues longer than the
previously published AUX1 sequence of Arabidopsis (Bennett et al. 1996), carrying additional residues at both ends of
the protein. Alignment of the two amino acid sequences with
the GCG program gap showed that the maize sequence carries additional 8 and 35 amino acid residues at the N- and
C-terminal, respectively (Fig. 1). The function of these addi-
Tissue-specific expression of an AUX1 homologue in maize root tips
317
Figure 1. Alignment of the deduced amino acid sequences
of ZmAUX1 and AtAUX1 (Bennett et al. 1996). Bars indicate identity, one or two points indicate different degrees of
similarity between corresponding amino acid residues of
ZmAUX1 and AtAUX1.
tional amino acid residues on both ends of the maize AUX1
protein is still unclear.
Computer analysis of Zm AUX1 with TMPRED (http://
ulrec3.unil.ch/software/TMPRED_form.html) and ALOM (http://
psort.nibb.ac.jp) software revealed 7 to 10 putative transmembrane domains (data not shown) in contrast to the 10 to
12 trans-membrane domains predicted for Arabidopsis AUX1
(Bennett et al. 1996).
Tissue-specific expression of ZmAUX1 in the primary
root tip
Northern blot analyses performed with total RNA isolated
from different parts of primary-, lateral seminal-, or crownroots of 12-day-old seedlings, and probed with ZmAUX1 (Fig.
2), highlighted expression in root tips. This included the meristematic and early zones (0–1 cm apart from the root tip),
but not the upper part (1– 2 cm from the root tip). In lateral
roots, ZmAUX1 expression was preferentially observed in the
RNA sample obtained from shorter root tip segments (0 –
4 mm from the root tip). When RNA from whole lateral root (1–
2 cm) was used, only a weak hybridisation signal was detected (data not shown).
The expression of ZmAUX1 in the tip region of the primary
root was analysed in more detail by in situ hybridisation experiments in order to identify the tissue specificity of ZmAUX1
expression (Fig. 3). A ZmAUX1 cDNA subclone of the 3′-end
was used as a template for the synthesis of a 250-bp DIG labelled ZmAUX1 RNA probe. Analysis of longitudinal sections
of the primary root with sense and anti-sense probes revealed
that ZmAUX1 was highly expressed in the epidermal cell
layers surrounding the root tip directly adjacent to the root
cap and in the pericycle and endodermis layers along the
central cylinder/cortex boundary. The in situ hybridisation signals were mainly observed in the root tip region, but not in the
upper region (starting at 4 – 5 mm from the root tip; data not
shown).
Discussion
Auxin has long been recognised as a determining factor in
root formation. Genetic analysis of Arabidopsis identified
genes involved in auxin action and transport, including AUX1,
which has now been isolated from maize. To monitor for expression of ZmAUX1 in maize roots, Northern hybridisation
analyses were performed which showed ZmAUX1 expression
318
Frank Hochholdinger et al.
Figure 2. Northern blot analysis of ZmAUX1 transcripts. Total RNA
was isolated from the primary (PR)-, lateral (LR)-, lateral seminal
(LSR)- and crown (CR)-roots of 12-day-old maize seedlings. RNA
from each root type except the lateral root was obtained from 0–1 cm
from the tip (indicated as 1.) or from 1– 2 cm from the tip (indicated as
2.). Lateral root RNA was prepared from the initial 3 – 4 mm of the tip.
The upper part of the figure presents the ZmAUX1 hybridisation
signal, and the lower part shows the ethidium bromide-stained gel
displaying the 26S and 18S rRNA bands.
Figure 3. In situ analysis of ZmAUX1 expression in longitudinal sections of 6-day-old maize primary root tips. Results are in the presence
of either sense (a) or anti-sense (b) probes. The scale bar indicates
100 µm. (details in the experimental procedures).
in the tip region of all root types of the early root system (Fig.
2), indicating a regulatory system common to all root types.
The observed ZmAUX1 expression in a more restricted
region of the lateral roots may simply be the reflection of relatively shorter tip organisation of lateral roots.
In situ hybridisation studies with the primary root demonstrated that ZmAUX1 is tissue-specifically expressed in the
root tip (Fig. 3). The ZmAUX1 expression was observed in the
boundary of the central cylinder containing pericycle and endodermis and in the epidermal layer. The pericycle is the initiation site of lateral root primodia, where the accumulation of
high amounts of IAA was observed (Kerk and Feldman 1995).
A striking feature of ZmAUX1 is its tissue-specific expression beyond the boundary of the central cylinder into the
quiescent centre. In Arabidopsis, the quiescent centre primarily has the function of retarding cell differentiation in the adjacent initial cells (van den Berg et al. 1997). However, the
function of the quiescent centre in most species, including
maize, is unclear. In maize, for example, only 4 out of 8–10
metaxylem cell files initiate near or in the quiescent centre
(Feldman 1998), so that a direct control of the differentiation
status of the other initials seems improbable. Identifying genes
expressed in the quiescent centre could help determine its
function in maize.
Although the root tip-specific expression of ZmAUX1 is in
accordance with the expression of AUX1 in Arabidopsis roots
(Bennett et al. 1996), the in situ hybridisation experiments
with ZmAUX1 revealed some differences in tissue specificity.
This is related to the different structure of the Arabidopsis
root tip. Whereas the Arabidopsis primary root showed
AtAUX1 expression in every tissue which is distal to its meristem extending to the elongation zone (Marchant et al. 1999),
the maize primary root shows a stronger ZmAUX1 expression
in tissues along the border of the central cylinder and in the
epidermal layer.
The expression pattern of ZmAUX1 correlates with the region where saturable auxin uptake was observed, implicating
the existence of an influx carrier (Martin and Pilet 1986). In
this region, the proximal auxin transport, from the root base to
the root tip through the central cylinder (Mitchell and Davies
1975), is redistributed to a second basipetal auxin flow
through the epidermal layer (Tsurumi and Ohwaki 1978).
However, the direct role of this putative auxin import carrier in
auxin distribution in the maize primary root is still unclear.
This is because the pattern of ZmAUX1 in situ signals (Fig. 3)
and the distribution of auxin (see Fig. 3 in Kerk and Feldman
1995) do not completely overlap.
Besides the root system, ZmAUX1 expression was also
observed in mesocotyls and leaves (data not shown), as expected from the diverse actions of auxin in the whole plant.
Interestingly however, ZmAUX1 expression could not be detected in coleoptiles, which are very responsive to exogenously applied auxin and have been extensively used for
auxin transport test (e.g. Hertel and Leopold 1963). This result implies the existence of at least one more member of
ZmAUX1 with different organ-specificity in maize. This idea is
supported by genomic Southern analysis, and by a RFLP
mapping study performed with ZmAUX1 (Perez, personal
communication) showing at least two ZmAUX1 loci on chromosome 1 (between the markers BNL07-21 and UMC67) and
4 (between the markers BNL10-05 and BNL08-23). In Arabidopsis, the AUX1 gene also belongs to a family of closely
related sequences (Bennett et al. 1996).
Acknowledgements. We thank Dr. Pascal Perez of Biogemma for
communicating to us the result of the mapping experiments; Dr. Philip
Benfey and Jun Lim at New York University (USA) for providing their
Tissue-specific expression of an AUX1 homologue in maize root tips
unpublished manuscript and advising on in situ analysis; Drs. Rainer
Hertel and Klaus D. Grasser of this department for their careful reading of the manuscript; and Hannelore Jonas for her excellent technical assistance. This project was supported by the Deutsche Forschungsgemeinschaft and the Biotechnology program of the EU (project PL 960210).
References
Bennett MJ, Marchant A, Green HG, May ST, Ward SP, Milner PA, Walker AR, Schulz B, Feldmann KA (1996) Arabidopsis AUX1 Gene: A
permease-like regulator of root gravitropism. Science 273: 948 –
950
Chen R, Hilson P, Sedbrook J, Rosen E, Casper T, Masson PH (1998)
The Arabidopsis thaliana AGRAVITROPIC1 gene encodes a component of the polar-auxin-transport efflux carrier. Proc Natl Acad
Sci USA 95: 15112–15117
Coen ES, Romero JM, Doyle S, Elliott R, Murphy G, Carpenter R
(1990) floricaula: A Homeotic Gene Required for Flower Development in Antirrhinum majus. Cell 63: 1311–1322
Feldman L (1994) The maize root. In: Freeling M, Walbot V (eds) The
Maize Handbook. Springer Verlag, New York, pp 29 – 37
Feldman L (1998) Not so quiet quiescent centers. Trends Plant Sci 3:
80 – 81
Goddemeier M, Wulff D, Feix G (1998) Root-specific expression of a
Zea mays gene encoding a novel glycine-rich protein, zmGRP3.
Plant Mol Biol 36: 799 – 802
Grasser KD, Grimm R, Ritt C (1996) Maize Chromosomal HMGc: two
closely related structure specific DNA-binding proteins specify a
second type of plant high mobility group box protein. J Biol Chem
271: 32900 – 32906
Hertel R, Leopold AC (1963) Versuche zur Analyse des Auxintransports in der Koleoptile von Zea mays L. Planta 59: 535 – 562
Jackson DP (1992) In situ hybridisation in plants. In: Gurr SJ, McPherseson M, Bowles DJ (eds) Molecular Plant Pathology: A practical
approach, Volume 1. Oxford University Press, Oxford, pp 163 –
174
Kerk N, Feldman L (1995) A biochemical model for the initiation and
maintenance of the quiescent center; implication for organization
of root meristems. Development 121: 2825 – 2833
319
Kropat J, Oster U, Rüdiger W, Beck CF (1997) Chlorophyll precursors
are signals of chloroplast origin involved in light induction of nuclear heat-shock genes. Proc Natl Acad Sci USA 94: 14168–14172
Luschnig C, Gaxiola R, Grisafi P, Fink GR (1998) EIR1, a root-specific
protein involved in auxin transport, is required for gravitropism in
Arabidopsis thaliana. Genes Dev 12: 2175 – 2187
Maher EP, Martindale SJB (1980) Mutants of Arabidopsis thaliana with
altered responses to auxins and gravity. Biochem Genet 18: 1041–
1053
Malamy JE, Benfey PN (1997) Organization and cell differentiation in
lateral roots of Arabidopsis thaliana. Development 124: 33 – 44
Marchant A, Kargul J, May ST, Muller P, Delbarre A, Perrot-Rechenmann C, Bennett MJ (1999) AUX1 regulates root gravitropism in
Arabidopsis by facilitating auxin uptake within root apical tissues.
EMBO J 8: 2066 – 2073
Martin HV, Pilet P-E (1986) Saturable Uptake of indol-3yl-acetic acid
by maize roots. Plant Physiol 81: 889 – 895
Matsuyama T, Satoh H, Yamada Y, Hashimoto T (1999) A maize glycine-rich protein is synthesized in the lateral root cap and accumulates in the mucilage. Plant Physiol 120: 665 – 674
Mitchell EK, Davies PJ (1975) Evidence for three different systems of
movement of indoleacetic acid in intact roots of Phaseolus coccineus. Plant Physiol 33: 290 – 294
Muller A, Guan C, Galweiler L, Tanzler P, Huijser P, Marchant A, Parry
G, Bennett M, Wisman E, Palme K (1998) AtPIN2 defines a locus
of Arabidopsis for root gravitropism control. EMBO J 17: 6903 –
6911
Pickett FB, Wilson AK, Estelle M (1990) The aux1 mutation of Arabidopsis confers both auxin and ethylene resistance. Plant Physiol
94: 1462–1466
Topping JF, Lindsey K (1997) Promoter trap markers differentiate
structural and positional components of polar development in Arabidopsis. Plant Cell 9: 1713–1725
Tsurumi S, Ohwaki Y (1978) Transport of 14C-labeled indoleacetic acid
in Vicia root segments. Plant Cell Physiol 19: 1195–1206
Utsuno K, Shikanai T, Yamada Y, Hashimoto T (1998) AGR, an Agravitropic locus of Arabidopsis thaliana, encodes a novel membrane-protein family member. Plant Cell Physiol 39: 1111–1118
van den Berg C, Willemsen V, Hendriks G, Weisbeek P, Scheres B
(1997) Short-range control of cell differentiation in the Arabidopsis
root meristem. Nature 390: 287– 289
van den Berg C, Weisbeek P, Scheres B (1998) Cell fate and cell differentiation status in the Arabidopsis root. Planta 205: 483 – 491