Download Transcriptional Activity of Male Gamete

Plant Cell Physiol. 46(5): 797–802 (2005)
doi:10.1093/pcp/pci075, available online at www.pcp.oupjournals.org
JSPP © 2005
Short Communication
Transcriptional Activity of Male Gamete-specific Histone gcH3 Promoter in
Sperm Cells of Lilium longiflorum
Takashi Okada 1, Prem L. Bhalla and Mohan B. Singh 2
Plant Molecular Biology and Biotechnology Laboratory, ARC Centre of Excellence for Integrative Legume Research, Institute of Land and Food
Resources, The University of Melbourne, Parkville, Victoria 3010, Australia
;
associated with the linker DNA connecting nucleosomal cores,
termed linker histones. Histone genes can be subdivided into
three major groups according to their gene expression profile,
replication-dependent, replication-independent and tissue-specific histones (Witt et al. 1996). Many plant histone genes have
been studied, and several transcriptional regulatory elements
coupled with cell proliferation have been identified (Meshi et
al. 1998, Meshi et al. 2000). The OCT motif in the histone promoter has been identified as a cis-acting element involved in
proliferation-coupled and S phase-specific expression. Almost
all plant histone gene promoters in the genome databases contain at least one OCT motif in their proximal regions (Meshi et
al. 2000).
During mammalian spermatogenesis, testis-specific histone variants that show preferential expression in spermatogonia, spermatid or sperm during spermatogenic development
have been reported (Grimes et al. 1990, Lim and Chae 1992,
Witt et al. 1996, Zalensky et al. 2002). The mammalian testisspecific linker histone H1t gene is transcriptionally active in
pachytene primary spermatocytes and repressed in all other
germinal and non-germinal cell types. The TE1, GC box 1 and
TG box have been identified as transcriptional activators that
interact with a nuclear protein leading to up-regulation of H1t
gene expression in spermatocytes. In contrast, GC box 2, RE
and TE2 have been reported as repressor elements that also
interact with nuclear proteins involved in silencing of the H1t
gene in non-germinal cells (Clare et al. 1997, Grimes et al.
2003). Therefore, H1t gene expression is controlled by upregulation in germline cells and suppression in non-germline
cells mediated by several transcriptional regulators.
In flowering plants, we previously have reported male
gamete-specific histone variants, gcH2A and gcH3, expressed
in lily generative cells (Xu et al. 1999a), and other variants
gH2A, gH2B and gH3 in lily have also been reported (Ueda
and Tanaka 1995, Ueda et al. 2000). The expression profile of
these genes is similar to that of mammalian testis-specific histone genes; up-regulation in male gametic cells and silencing in
sporophytic tissues. These observations led us to hypothesize
that plants might have a similar mechanism to regulate male
gametic cell-specific gene expression of histone variant genes.
Histones are essential for packaging of eukaryotic
genomic DNA in nucleosomes, and histone gene expression
is normally coupled with DNA synthesis. Some of the flowering plant histone genes show strictly male gamete-specific expression. However, mechanisms underlying their
male gamete-specific expression have not been elucidated so
far. Here we report the isolation of the male gamete-specific histone gcH3 promoter from Lilium longiflorum and
its activity in the male gametic cell of the flowering plant.
The OCT motif, which is well conserved in plant histone
promoters regulating S phase-specific expression, is not
conserved in the gcH3 promoter. Instead sequence motifs
identical to GC box 1 and GC box 2, the transcriptional
activator and suppressor for mammalian testis-specific histone H1t, are present in the gcH3 promoter, suggesting that
plants and animals share the mechanism which governs the
specificity of gene expression in male gametic cells. Male
gamete-specific activation of the gcH3 promoter has been
confirmed by microprojectile bombardment in lily pollen.
The sperm cell carrying gold particles showed reporter
gene expression, while green fluorescent protein (GFP) was
absent in the other sperm cell which had no particles, confirming that the gcH3 promoter is activated in the male
gametic cell, and sperm cells have transcriptional and
translational machinery that is independent of the vegetative cell of pollen.
Keywords: Generative cell — GFP — Histone H3 — Male
gamete — Promoter — Sperm cell.
Abbreviations: DAPI, 4′,6-diamidino-2-phenylindole; GFP,
green fluorescent protein; SC, sperm cell.
The nucleotide sequence reported in this paper has been submitted to the GenBank under accession number AB195654.
The basic structural unit of chromatin is the nucleosome,
about 140 bp of DNA wrapped around a protein octamer containing two copies of each histone H2A, H2B, H3 and H4, designated core histones. In addition, histone H1 proteins are
1
2
Present address: CSIRO Plant Industry, PO Box 350, Glen Osmond, SA 5064, Australia.
Corresponding author: E-mail, [email protected]; Fax, +61-3-8344-5051.
797
798
Transcriptional activity of gcH3 in sperm cells
Fig. 1 (A) Nucleotide sequence alignment of the proximal promoter
region of gcH3 and rat testis-specific histone H1t. Transcriptional regulatory elements of the H1t promoter identified previously are shown
above the sequence. (B) Conservation of mammalian testis-specific
transcriptional elements, GC box 1 and GC box 2, in plant male gamete-specific gene promoters. (C) Two possible silencer elements conserved in the gcH3 promoter and the putative suppressor-binding
domain of the LGC1 promoter.
However, no plant male gamete-specific histone promoter has
been investigated so far. Our previous study regarding the
LGC1 gene promoter is the only report of a flowering plant
male gamete-specific gene promoter, and our analysis suggested that germline cell-specific expression is achieved by
suppression of the LGC1 gene in sporophytic cells as found in
the animal H1t gene (Singh et al. 2003). Here, we report the
isolation of the 5′-flanking region of the lily male gametespecific histone gcH3 and its activity in male gametic cells of
flowering plants.
To compare cis-regulatory elements in the male gametespecific histone gcH3 promoter with the somatic histone H3
promoter, we cloned the 5′-flanking region of the gcH3 gene by
TAIL-polymerase chain reaction (PCR) as described (Terauchi
and Kahl 2000). The combination of four nested gcH3-specific
primers (H3-RV1, CAATATCCTAATAGCATCCTCC; H3RV2, TCAGTTACCTCCTCAAGTGG; H3-RV3, GCAGATGTGTCTTCAAGTCC; and H3-RV4, ACCAGCCCTTGGAATGGCAG) and 10mer arbitrary primers was used to amplify
the promoter region of gcH3 from genomic DNA. The PCR
products were cloned into pGEM-T Easy vector (Promega) and
the DNA sequence was determined. The longest fragment
obtained in this experiment was 1.3 kb including 1 kb of 5′flanking region from the initiation codon. This genomic DNA
fragment shows 98% identity to gcH3 cDNA and contains an
84 bp intron.
Comparing the gcH3 promoter sequence with known ciselements of the histone promoter manually and by a PLACE
database search (http://www.dna.affrc.go.jp/PLACE/), we found
several motif sequences in the promoter region. There are three
domains showing similarity to the NONA motif at –446, –422
and –145 from the putative transcription initiation site. The
NONA motif is present in more than half of the plant histone
promoters and is considered as a modulator element, by increasing the activity of Oct-containing composite elements
dependent on the proliferative state and/or the position of cells
in plants (Meshi et al. 2000). The NON motif, a similar modulator element to NONA, and the CAT motif, which is involved
in promoter strength in the maize histone H3C4 promoter
(Meshi et al. 2000), were also found at –358 and –559, respectively. The OCT motif has been identified as a histone promoter cis-acting element involved in proliferation-coupled and
S phase-specific expression. This motif is well conserved in
plant histone promoters, and almost all histone gene promoters, >40 genes examined by Meshi et al. (2000), in the database contain at least one OCT motif in their proximal regions.
However, there is no significant region similar to the OCT
motif in the gcH3 promoter. The OCT motif is necessary for S
phase-specific histone gene expression, while cell cycle of lily
mature pollen generative cell is arrested at G2/M stage where
the gcH3 is expressed; thus the OCT motif may not be necessary for the expression of gcH3 in the generative cell.
In rat testis-specific histone H1t, several transcription activator and repressor elements in the proximal region of the H1t
promoter have been reported (reviewed by Grimes et al. 2003).
Among these regulatory elements, GC box 1 and GC box 2 are
present in the lily gcH3 promoter (Fig. 1A). GC box 1 contains
a consensus binding site for members of the Sp family of
transcription factor and it has been demonstrated that Sp1 and
Sp3 are expressed in testis cells and show binding activity
to GC box 1 (Wilkerson et al. 2002a, Wilkerson et al. 2002b).
Furthermore, overexpression of Sp1 and Sp3 enhances H1t
promoter activity in a sequence-specific manner and methylation of GC box 1 inhibits the binding of Sp1 and Sp3, thus GC
box 1 is a transcriptional activator for the H1t gene in mammalian testis (Wilkerson et al. 2002a, Wilkerson et al. 2002b).
This GC box 1 is not only found in the gcH3 promoter but also
in the LGC1 promoter that is also male gamete-specific (Xu et
al. 1999b, Singh et al. 2003) and shows almost a perfect match
with the consensus sequence (Fig. 1B).
GC box 2, which is located just downstream of the TATA
box, has been shown to bind a nuclear protein, and fusion of
the GC box 2 motif onto the somatic histone H1d promoter
resulted in suppression of promoter activity in cultured cells by
transient gene expression assay (Clare et al. 1997). In addition,
it has been shown that GC box 2-binding proteins are only
expressed in somatic cells but not in testis; thus it has been proposed that the silencer element GC box 2 represses the expression of H1t in somatic cells. A similar cytosine-rich sequence
is found downstream of a putative TATA box of the gcH3 promoter (Fig. 1B). Although the number of cytosine nucleotides
is less than that of GC box 2 in H1t and gcH3, the LGC1 promoter also contains a cytosine-rich sequence just downstream
Transcriptional activity of gcH3 in sperm cells
of the TATA box. Finding these mammalian type testis-specific
histone H1t regulatory elements in male gamete-specific gene
promoters suggests that plants and animals may share the
mechanism which governs specific gene expression in male
germline cells by similar transcriptional regulators.
In our previous study, deletion of a 43 bp DNA sequence
from the LGC1 promoter led to loss of the generative cell
specificity, resulting in activation of this promoter in sporophytic tissues (Singh et al. 2003). This 43 bp putative silencer
fragment of this promoter region has been shown to bind a
nuclear protein of lily petal, leading us to conclude that the
male gamete specificity of the LGC1 gene seems to be regulated by factors that suppress its activation in other plant cells.
We compared the putative silencer sequence of the LGC1 promoter with the gcH3 promoter sequence to evaluate whether
two different male gamete-specific genes share regulatory
sequences. Two regions showed significantly high sequence
similarity between the LGC1 and gcH3 promoter (Fig. 1C).
These two domains are possible cis-regulatory elements that
might be common in male gametic genes and function to suppress gene expression in sporophytic tissues. Together with
these results, male gametic genes of flowering plants are likely
to be controlled by several transcriptional regulators to maintain the silenced state in sporophytic cells and up-regulation in
male gametic cells.
To investigate the promoter activity of the gcH3 gene
in male gametic cells of lily, we fused 1 kb of the 5′flanking region including the 5′-untranslated region (5′-UTR)
with a reporter gene GFP. The promoter of gcH3 was amplified with primers attached by restriction enzyme site (H3 pro
5′-HindIII, TTTGAAGCTTGAGGTGATTTTGTATGAG; H3
pro 3′-BamHI, ACGGGATCCCGGAGCGACGGATTTCTTCTC) and the digested fragment was inserted 5′ upstream of
sGFP to generate gcH3–green fluorescent protein (GFP) (Chiu
et al. 1996). As in the case of the other generative cell-specific
gene LGC1 promoter (Singh et al. 2003), a transient gene
expression assay was carried out by microprojectile bombardment. A cauliflower mosaic virus (CaMV) 35S-GFP plasmid
(Chiu et al. 1996) was used in a control experiment. Onion epithelium and lily mature pollen grains were placed on top of a
nylon membrane on the Murashige and Skoog (MS) medium.
DNA-coated gold particles were introduced into plant tissues
using a Bio-Rad He-particle gun as described (Singh et al.
2003). After the delivery of DNA, sample tissues were placed
under dark conditions at 25°C for 5 h to overnight. Samples
were assessed by incident light fluorescent microscopy BX60
(Olympus, NSW, Australia) using a UV filter and blue filter
combination. The number of cells in which GFP expression
was observed was counted and images were recorded using a
DP11digital camera (Olympus, NSW, Australia).
GFP expression in onion epithelium carrying 35S–GFP
and gcH3–GFP is shown in Fig. 2A and B, respectively. Strong
expression of GFP induced by the 35S promoter was observed,
whereas a much weaker fluorescent signal was observed in a
799
few gcH3–GFP-transformed cells. The number of cells that
showed GFP expression induced by gcH3–GFP was 10-fold
less than that by 35S–GFP. Futhermore, our previous data
revealed that the endogenous gcH3 gene shows generative cell
specific expression with no expression detected in other vegetative tissues (Xu et al. 1999a). Therefore, the expression of
GFP induced by the gcH3 promoter in onion epithelium is
most likely to be an ectopic expression caused by excess foreign DNA.
In mature pollen of lily, significant GFP expression was
observed in gcH3–GFP pollen. An intense spot of green fluorescence revealed expression of GFP in generative cells
assessed by 4′,6-diamidino-2-phenylindole (DAPI) staining
(Fig. 2C–E). Following the germination of lily pollen tube on
the medium, pollen tubes were assessed under the fluorescent
microscope. Since the gcH3 promoter is expected to be active
only in generative cells, successful penetration of gold particles into generative cells would be a very rare event. Indeed,
expression of GFP in pollen grains and pollen tubes was rarely
seen. Among hundreds of thousands of pollen and pollen tubes,
only 65 pollen grains or pollen tubes revealed GFP expression
induced by the gcH3 promoter, while none of the pollen and
pollen tubes showed GFP expression induced by the 35S–GFP
construct, confirming previous findings of very low activity
of the 35S promoter in pollen (Twell et al. 1991, Okada and
Toriyama 2001). Use of pollen vegetative cell-specific promoters such as LAT52 (Twell et al. 1990) and Bra r 1 (Okada
and Toriyama 2001) resulted in a much higher ratio of GFP
expressed pollen (T. Okada unpublished data). Together with
these results, GFP expression observed in gcH3–GFP pollen is
most likely to be the result of gcH3 promoter activity in male
gametic cells of pollen.
A typical type of green fluorescence in pollen tubes is
shown in Fig. 2F. The fluorescent signal was observed throughout the pollen tube cytoplasm with an intense fluorescent
region. In a bright field image, two sperm cell (SC)-like membrane-surrounded structures were identified in this pollen tube
(Fig. 2G) and the left one showed an intense fluorescent signal, relatively stronger than that in pollen tube cytoplasm, and
there was a lack of fluorescence in the right one, resulting in a
black region in the pollen tube (Fig. 2F). Furthermore, localization of gold particles was only seen in the left structure (Fig.
2G, arrowhead). A vegetative nucleus-like dispersed structure
was found in the bottom left of the pollen tube. Together with
these results, the intense fluorescent region is most likely to be
one SC showing GFP expression induced by the gcH3 promoter. The fluorescent signal observed in pollen tube cytoplasm might be due to two possibilities; the excessive GFP in
SC induced by high copy of gcH3–GFP may have been leaked
from the membrane pore created by particle penetration. The
second possibility is ectopic expression in pollen vegetative
cells induced by high copy of gcH3–GFP. In either case, in our
transient gene expression assay, we believed there would be
some pollen showing significant GFP expression only in male
800
Transcriptional activity of gcH3 in sperm cells
Fig. 2 Transient gene expression assay of gcH3–GFP in onion epidermal cells, lily pollen grains and pollen tubes. Expression of GFP in onion
epithelium carrying 35S–GFP (A) and gcH3–GFP (B). (C–E) GFP expression was confined to the generative cell of mature pollen. An intense
spot of GFP fluorescence was observed (C), and the incident light microscope image (D) and DAPI staining (E) indicate the localization of the
fluorescent spot in the generative cell. (F and G) Intense fluorescence in one SC and its absence in the other SC was observed. GFP was also
localized throughout the pollen tube cytoplasm. (H–K) Specific GFP expression was observed only in one SC (H), which had gold particles inside
of the nucleus assessed by bright field image (I) and DAPI staining (J). The presence of many gold particles on the surface of the original pollen
grains of the pollen tube shown in (H–J) is another piece of evidence for successful transformation (K). (L–Q) Another clear example of specific
GFP expression only in one SC. Weak fluorescence was confined only in one SC (top) and absent in the other SC (bottom) as shown in (L) and
(M). Magnified images clearly revealed that the GFP is accumulated in the SC nucleus and less in the cytoplasm (N), and gold particles were
found only in the SC which showed fluorescence (O) and not in the other SC (P) and vegetative nucleus (Q). Arrowheads indicate the localization of gold particles. VN, vegetative nucleus; GC, generative cell; SC, sperm cell. Bars in (A)–(M) = 50 µm and in (N)–(Q) = 20 µm.
Transcriptional activity of gcH3 in sperm cells
gametic cells, which is consistent with the result of in situ
hybridization (Xu et al. 1999a).
Indeed, our careful observation of hundreds of thousands
of pollen tubes enabled us to find two pollen tubes that showed
GFP expression only in male gametic cells without any GFP
expression in pollen tube cytoplasm. Fig. 2H revealed weak
GFP expression in one SC (middle) and its absence in the other
SC (bottom). SC nuclei were visualized by DAPI staining for
this pollen tube after the GFP photograph was taken, because
DAPI staining causes the diffusion of the GFP signal. Although
the pollen tube has been slightly moved by application of the
DAPI solution onto the slide, the pollen tube still stayed at the
same location on the slide and two SC nuclei were confirmed
in this pollen tube (Fig. 2J). Again, gold particles were found
only in SCs in which GFP expression was observed (Fig. 2I).
The original pollen grain of this pollen tube shown in Fig. 2H–
J was checked and many gold particles were found on the surface of the pollen grain (Fig. 2K), indicating that gold particles
were undoubtedly transferred by bombardment, and fortunately two particles could have penetrated into the generative
cell of mature pollen. Then these particles were eventually separated into two SCs when the second pollen mitosis occurred in
the pollen tube, and two particles were transferred to one SC by
chance. Another example is more obvious and shown in Fig.
2L–Q. Two SC-like structures and a vegetative nucleus were
clearly identified in the bright field image (Fig. 2M) and only
one SC showed GFP expression (Fig. 2L, top). A magnified
image enabled us to recognize the SC structure by GFP fluorescence (Fig. 2N). Since GFP tends to be accumulated in the
nucleus as observed in onion epidermal cells (Fig. 2A), relatively higher fluorescence was observed in the large central
part of SC, and weaker signals in the remaining regions. This
observation is applicable to the feature of SC structure, where a
relatively large portion of the volume is nucleus and a small
portion is cytoplasm. The distribution pattern of GFP was consistent with that observed in onion cells, i.e. intense fluorescence in the nucleus and relatively low fluorescence in the
cytoplasm. A vegetative nucleus would not show this clear
cell-like structure; normally a stretched structure is observed.
Therefore, GFP is expressed only in one SC and also accumulated in its nucleus. Indeed, we found three gold particles in an
SC nucleus (Fig. 2O) but not in other SCs (Fig. 2P) and the
vegetative nucleus (Fig. 2Q). From these results, we conclude
that the gcH3 promoter is active for transcription in male
gametic cells in a cell-specific manner. Although it has been
reported that the transcript of LGC1 is confirmed in two SCs of
lily pollen tube (Xu et al. 1999b) and male gametic histone proteins (gH2A, gH2B and gH3) are localized in two SCs (Ueda et
al. 2000), it was unclear whether the SC is active in transcription or transcripts derived from the generative cell are translated in the SC. The fact that GFP expression was observed
only in one SC that had gold particles points towards transcriptional and translational activities of SC.
801
We have isolated the promoter region of gcH3, a histone
variant specifically expressed in male gametes of L. longiflorum. Comparison of the gcH3 promoter sequence with the lily
male gamete-specific gene LGC1 promoter located shared regulatory motifs. Intriguingly GC box 1 and GC box 2 found in
mammalian testis-specific histone H1t are also observed in the
proximal promoter of gcH3 and LGC1, leading to the suggestion that flowering plants and animals may share a regulatory
mechanism for germline cell-specific gene expression. The Sp
family transcription factors, Sp1 and Sp3, have been shown to
bind to GC box 1 and to up-regulate H1t promoter activity in
mammalian germline cells (Wilkerson et al. 2002a, Wilkerson
et al. 2002b). A search for transcription factors in Lilium male
gametes that interact with GC box 1 and GC box 2 type
sequences and comparison of their structure with that of the Sp
family of mammalian transcription factors would be the next
step towards understanding the mechanism of male gametic
cell-specific gene expression.
Acknowledgments
We gratefully acknowledge financial support provided by the
Australian Research Council (ARC) for this project. T.O. was a recipient of Research Fellowships of the Japan Society for the Promotion of
Science for Young Scientists for a part of the study.
References
Chiu, W., Niwa, Y., Zeng, W., Hirano, T., Kobayashi, H. and Sheen, J. (1996)
Engineered GFP as a vital reporter in plants. Curr. Biol. 6: 325–330.
Clare, S.E., Fantz, D.A., Kistler, W.S. and Kistler, M.K. (1997) The testisspecific histone H1t gene is strongly repressed by a G/C-rich region just
downstream of the TATA box. J. Biol. Chem. 272: 33028–33036.
Grimes, S.R., Wilkerson, D.C., Noss, K.R. and Wolfe, S.A. (2003) Transcriptional control of the testis-specific histone H1t gene. Gene 304: 13–21.
Grimes, S.R., Wolfe, S.A., Anderson, J.V., Stein, G.S. and Stein, J.L. (1990)
Structural and functional analysis of the rat testis-specific histone H1t gene. J.
Cell. Biochem. 44: 1–17.
Lim, K. and Chae, C.B. (1992) Presence of a repressor protein for testis-specific
H2B (TH2B) histone gene in early stages of spermatogenesis. J. Biol. Chem.
267: 15271–15273.
Meshi, T., Taoka, K. and Iwabuchi, M. (1998) S phase-specific expression of
plant histone genes. J. Plant Res. 111: 247–251.
Meshi, T., Taoka, K.I. and Iwabuchi, M. (2000) Regulation of histone gene
expression during the cell cycle. Plant Mol. Biol. 43: 643–657.
Okada, T. and Toriyama, K. (2001) Pollen vegetative cell-specific expression of
Bra r 1: useful tool for observation of the vegetative nucleus and identification of transgenic pollen by nuclear-targeted GFP. Sex. Plant Reprod. 13:
301–307.
Singh, M., Bhalla, P.L., Xu, H. and Singh, M.B. (2003) Isolation and characterization of a flowering plant male gametic cell-specific promoter. FEBS Lett.
542: 47–52.
Terauchi, R. and Kahl, G. (2000) Rapid isolation of promoter sequences by
TAIL-PCR: the 5′-flanking regions of Pal and Pgi genes from yams (Dioscorea). Mol. Gen. Genet. 263: 554–560.
Twell, D., Yamaguchi, J. and McCormick, S. (1990) Pollen-specific gene
expression in transgenic plants: coordinate regulation of two different tomato
gene promoters during microsporogenesis. Development 109: 705–713.
Twell, D., Yamaguchi, J., Wing, R.A., Ushiba, J. and McCormick, S. (1991)
Promoter analysis of genes that are coordinately expressed during pollen
development reveals pollen-specific enhancer sequences and shared regulatory elements. Gene Dev. 5: 496–507.
802
Transcriptional activity of gcH3 in sperm cells
Ueda, K., Kinoshita, Y., Xu, Z., Ide, N., Ono, M., Akahori, Y., Tanaka, I. and
Inoue, M. (2000) Unusual core histones specifically expressed in male
gametic cells of Lilium longiflorum. Chromosoma 108: 491–500.
Ueda, K. and Tanaka, I. (1995) The appearance of male gamete-specific histones gH2B and gH3 during pollen development in Lilium longiflorum. Dev.
Biol. 169: 210–217.
Wilkerson, D.C., Wolfe, S.A. and Grimes, S.R. (2002a) H1t/GC-box and H1t/
TE1 element are essential for promoter activity of the testis-specific histone
H1t gene. Biol. Reprod. 67: 1157–1164.
Wilkerson, D.C., Wolfe, S.A. and Grimes, S.R. (2002b) Sp1 and Sp3 activate
the testis-specific histone H1t promoter through the H1t/GC-box. J. Cell.
Biochem. 86: 716–725.
Witt, O., Albig, W. and Doenecke, D. (1996) Testis-specific expression of a
novel human H3 histone gene. Exp. Cell Res. 229: 301–306.
Xu, H., Swoboda, I., Bhalla, P.L. and Singh, M.B. (1999a) Male gametic cellspecific expression of H2A and H3 histone genes. Plant Mol. Biol. 39: 607–
614.
Xu, H., Swoboda, I., Bhalla, P.L. and Singh, M.B. (1999b) Male gametic cellspecific gene expression in flowering plants. Proc. Natl Acad. Sci. USA 96:
2554–2558.
Zalensky, A.O., Siino, J.S., Gineitis, A.A., Zalenskaya, I.A., Tomilin, N.V., Yau,
P. and Bradbury, E.M. (2002) Human testis/sperm-specific histone H2B
(hTSH2B)—molecular cloning and characterization. J. Biol. Chem. 277:
43474–43480.
(Received December 7, 2004; Accepted February 14, 2005)