Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Loss of PI3K␥ Enhances cAMP-Dependent MMP Remodeling of the Myocardial N-Cadherin Adhesion Complexes and Extracellular Matrix in Response to Early Biomechanical Stress Danny Guo, Zamaneh Kassiri, Ratnadeep Basu, Fung L. Chow, Vijay Kandalam, Federico Damilano, Wenbin Liang, Seigo Izumo, Emilio Hirsch, Josef M. Penninger, Peter H. Backx, Gavin Y. Oudit Rationale: Mechanotransduction and the response to biomechanical stress is a fundamental response in heart Downloaded from http://circres.ahajournals.org/ by guest on June 17, 2017 disease. Loss of phosphoinositide 3-kinase (PI3K)␥, the isoform linked to G protein– coupled receptor signaling, results in increased myocardial contractility, but the response to pressure overload is controversial. Objective: To characterize molecular and cellular responses of the PI3K␥ knockout (KO) mice to biomechanical stress. Methods and Results: In response to pressure overload, PI3K␥KO mice deteriorated at an accelerated rate compared with wild-type mice despite increased basal myocardial contractility. These functional responses were associated with compromised phosphorylation of Akt and GSK-3␣. In contrast, isolated single cardiomyocytes from banded PI3K␥KO mice maintained their hypercontractility, suggesting compromised interaction with the extracellular matrix as the primary defect in the banded PI3K␥KO mice. -Adrenergic stimulation increased cAMP levels with increased phosphorylation of CREB, leading to increased expression of cAMP-responsive matrix metalloproteinases (MMPs), MMP2, MT1-MMP, and MMP13 in cardiomyocytes and cardiofibroblasts. Loss of PI3K␥ resulted in increased cAMP levels with increased expression of MMP2, MT1-MMP, and MMP13 and increased MMP2 activation and collagenase activity in response to biomechanical stress. Selective loss of N-cadherin from the adhesion complexes in the PI3K␥KO mice resulted in reduced cell adhesion. The -blocker propranolol prevented the upregulation of MMPs, whereas MMP inhibition prevented the adverse remodeling with both therapies, preventing the functional deterioration in banded PI3K␥KO mice. In banded wild-type mice, long-term propranolol prevented the adverse remodeling and systolic dysfunction with preservation of the N-cadherin levels. Conclusions: The enhanced propensity to develop heart failure in the PI3K␥KO mice is attributable to a cAMP-dependent upregulation of MMP expression and activity and disorganization of the N-cadherin/-catenin cell adhesion complex. -Blocker therapy prevents these changes thereby providing a novel mechanism of action for these drugs. (Circ Res. 2010;107:00-00.) Key Words: myocardial contractility 䡲 cardiomyopathy 䡲 signaling pathways 䡲 heart failure 䡲 hypertrophy T cell adhesion complexes which are modulated by both class IA and IB PI3Ks.1,7 Although PI3Ks and lipid phosphatases can modulate cytoskeletal interactions, stretch can in turn activate Akt/PKB and GSK-3 activity in both cardiomyocytes and Langendorff-perfused hearts.8 In cardiac muscle, cell adhesion and the cardiomyocyte stretch sensor machinery play key roles in the complex mechanism leading to human DCM and associated heart failures.9 Indeed, dilated cardio- he phosphoinositide 3-kinase (PI3K) system has a fundamental role in cell signaling and is involved in cell survival and growth and modulates myocardial contractility.1,2 In the heart, both PI3K␣3–5 and PI3K␥3,6 controls distinct aspects of cardiac structure and function. Mechanotransduction plays a fundamental role in cardiac (and vascular) function and it appears to involve interactions between extracellular matrix and intracellular cytoskeletal proteins via Original received November 30, 2009; resubmission received July 26, 2010; revised resubmission received September 2, 2010; accepted September 8, 2010. In August 2010, the average time from submission to first decision for all original research papers submitted to Circulation Research was 13.2 days. From the Division of Cardiology, Department of Medicine (D.G., F.L.C., G.Y.O.); Mazankowski Alberta Heart Institute (D.G., Z.K., R.B., F.L.C., V.K., G.Y.O.); and Department of Physiology (Z.K., R.B., V.K.), University of Alberta, Edmonton, Canada; University of Torino (F.D., E.H.), Italy; Department of Physiology (W.L., P.H.B.), University of Toronto, Canada; Beth Israel Deaconess Medical Center (S.I., J.M.P.), Harvard Medical School, Boston Mass; and Institute of Molecular Biotechnology of the Austrian Academy of Sciences, Vienna. Correspondence to Gavin Y. Oudit, MD, PhD, FRCP(C), Division of Cardiology, Department of Medicine, Mazankowski Alberta Heart Institute, University of Alberta, Edmonton, Alberta, T6G 2S2, Canada. E-mail [email protected] © 2010 American Heart Association, Inc. Circulation Research is available at http://circres.ahajournals.org DOI: 10.1161/CIRCRESAHA.110.229054 1 2 Circulation Research November 12, 2010 Non-standard Abbreviations and Acronyms Downloaded from http://circres.ahajournals.org/ by guest on June 17, 2017 AB ANF BNP DIDA ECM ERK GSK KO LV MHC MMP phospho PI3K PI3K␣DN PI3K␥KD PI3K␥KO PLN TIMP WT aortic banding atrial natriuretic factor B-type natriuretic peptide 2⬘,5⬘-dideoxyadenosine extracellular matrix extracellular signal-regulated kinase glycogen synthase kinase knockout left ventricular myosin heavy chain matrix metalloproteinase phosphorylated phosphoinositide 3-kinase phosphoinositide 3-kinase ␣ dominant negative phosphoinositide 3-kinase ␥ kinase dead phosphoinositide 3-kinase ␥ knockout phospholamban tissue inhibitor of matrix metalloproteinases wild type myopathy in humans is associated with marked remodeling of extracellular matrix and cell adhesion complexes. Loss of p110␥, the catalytic subunit of the PI3K␥ complex, leads to enhanced cAMP generation resulting from a loss of phosphodiesterase activity, resulting in enhanced Ca2⫹ cycling and attributable primarily to increased phosphorylation (and inhibition) of phospholamban (PLN) and increased sarcoplasmic reticulum Ca2⫹ stores.3,6,10 Using the aortic banding (AB) model, we showed that despite these biochemical changes, PI3K␥KO mice show enhanced susceptibility to early biomechanical stress. Our results provide a crucial link between PI3K␥ and the cellular responses to biomechanical stress, with a loss of p110␥ resulting in elevated matrix metalloproteinase (MMP) expression and activity, and correlates with a selective loss of N-cadherin from cell adhesion complexes. Importantly, these adverse cellular changes are not observed in the PI3K␣DN and in PI3K␥ kinase dead (kDa) mutant mice in response to pressure overload. Inhibition of cAMP levels with propranolol and MMP inhibition provided significant rescue of the dilated cardiomyopathy in banded PI3K␥KO mice. Chronic -blocker therapy also resulted in prevention of adverse myocardial remodeling in wild-type (WT) mice. These results illustrate the importance of cell adhesion and extracellular matrix in the response to biomechanical stress even in the setting of enhanced Ca2⫹ cycling and increased myocardial contractility. Methods An expanded Methods section is available in the Online Data Supplement at http://circres.ahajournals.org. Experimental Animals PI3K␥KO, PI3K␣DN, and PI3K␥KD mice in C57Bl/6 background have been described previously.3,6,11 All experiments were performed in accordance with institutional guidelines and Canadian Council on Animal Care. Only male mice of 8 to 9 weeks of age and littermate C57Bl/6 WT controls were used. For the propranolol experiments, mice were treated with propranolol in their drinking water (0.2 g/L) to deliver 15 mg/kg per day; propranolol was withdrawn 1 day before the echocardiographic and hemodynamic measurements. The broad-spectrum MMP inhibitor PD166793 (Pfizer Inc) was administered orally by daily gavage as described previously.12 Because of the rapid onset of ventricular dilation in PI3K␥KO mice, PD166793 treatment (30 mg/kg per day) began 3 days before AB and continued until mice were euthanized. Aortic Banding The AB protocol was used as a means of pressure overload and biomechanical stress as described previously.12,13 Briefly, the descending aortic arch was accessed via a left thoracotomy and the descending thoracic aorta was surgically constricted to generate a transstenotic pressure gradient of 50 to 60 mm Hg. Histology, Hydroxyproline, and TUNEL Assays For heart morphometry, hearts were arrested with KCl, fixed with 10% buffered formalin, and embedded in paraffin. Myocardial interstitial fibrosis was determined as collagen volume fraction using confocal microscopy on picrosirius red stained 10 m thick sections pretreated with PMA. Collagen content was also determined using the hydroxyproline assay as previously reported.14 In situ DNA fragmentation was labeled using the TUNEL assay (ApopTag Plus kit; Oncor, Gaithersburg, Md). Echocardiography and Hemodynamic Measurements Echocardiographic assessments and invasive hemodynamic measurements were carried out as described previously.3,12,13 Isolated Cardiomyocyte Contractility Left ventricular (LV) cardiomyocyte contractility was carried out as described previously.3 Isolation and Culture of Adult Cardiomyocytes and Fibroblasts The protocol used for isolation and culture of adult mouse cardiomyocytes and fibroblasts was modified from O’Connell et al (see Online Methods).15 Measurement of cAMP Levels The cAMP levels in isolated adult ventricular cardiomyocytes and LV myocardial tissue were measured using the cAMP competitive enzyme immunoassay system (GE Healthcare Amersham Biosciences). Cell Adhesion Assay The ECM-based cell adhesion assay was carried out using a colorimetric-based assay (CytoSelect 48-Well Cell Adhesion Assay; Cell Biolabs Inc). TaqMan Real-Time PCR, Western Blot Analyses, and Membrane Fractionation, Gelatin Zymography, and Collagenase Activity Assay RNA expression levels were quantified with TaqMan RT-PCR using ABI Prism 7700 sequence detection system as described previously (see Online Table I for primers and probes).16,17 Western blot analyses, gelatin zymography, and collagenase activity were performed as described previously (see Online Methods).16,17 For the in vitro analysis of N-cadherin cleavage, 100 ng of human recombinant N-cadherin Fc Chimera protein (R&D) was incubated with 0, 1, 10, 100 nmol/L MMP2 (R&D) or MT1-MMP (R&D). Role of PI3K␥ in Biomechanical Stress Guo et al A B WT 3 weeks AB D PI3Kγ-KO 3 weeks AB WT 3 weeks AB PI3Kγ-KO 3 weeks AB WT PI3Kγ-KO 10 * PSR CVF (%) 8 6 4 2 0 apoptotic myocytes (%) PI3Kγ-KO 3 weeks AB G 3 weeks AB F TUNEL Staining WT 3 weeks AB WT PI3Kγ-KO 4 3 2 1 0 1 week AB H BNP/18S (AU) 2400 2000 1600 * 1200 800 3000 2000 1000 400 0 Sham 1 Week AB 3 Weeks AB 0 Figure 1. Development of early-onset dilated cardiomyopathy in response to biomechanical stress in PI3K␥KO mice. A and B, Four-chamber trichrome-stained heart sections showing concentric hypertrophy in WT mice (A) with ventricular dilation and eccentric remodeling in PI3K␥KO mice (B) in response to after AB. C through F, Increased interstitial fibrosis shown using picrosirius red staining (C, left) and quantification of the collagen volume fraction (CVF) (D) with lack of an increase in apoptosis based on TUNEL staining (E, left) and quantified as percentage of apoptotic nuclei (F, right) (P⫽0.341; n⫽5 per group). G through I, Expression profile of hypertrophy disease markers showing early and markedly increased expression of ANF (G), BNP (H), and MHC (I) in banded PI3K␥KO mice compared with WT mice. n⫽5 for sham groups and n⫽7 for AB groups. AU indicates arbitrary unit. *P⬍0.05 compared with the WT group. * 8 6 4 2 0 3 weeks AB 4 3 2 1 0 3 weeks AB I * 4000 WT PI3Kγ-KO * 100 βMHC/18S (AU) 2800 ANF/18S (AU) Downloaded from http://circres.ahajournals.org/ by guest on June 17, 2017 E Hydroxyproline (ug/mg) PI3Kγ-KO 1 week AB apoptotic myocytes (%) WT 1 week AB C 3 Sham 1 Week AB * 80 60 40 * 20 3 Weeks AB 0 Confocal Fluorescence Microscopy Formalin-fixed sections were permeabilized with ice-cold methanol for 10 minutes, blocked with goat serum and incubated with primary antibodies (anti–N-cadherin [rabbit] and anti–-catenin [mouse], 1:500, Abcam) overnight at 4°C in a humidified chamber. After several washes, Texas red– conjugated (for cadherin) or FITCconjugated (for catenin) secondary antibodies were incubated for 30-minute at room temperature. The sections were evaluated with a Zeiss LSM510 confocal microscope and associated software. Statistical Analysis One-way ANOVA was used to test for overall significance, followed by the Student–Newman–Keuls test for multiple comparison testing between the various groups. All statistical analyses were performed with the SPSS software (version 10.1). Data are presented as means⫾SEM; n refers to the sample size. Results Accelerated Development of Ventricular Dilation and Pathological Hypertrophy in PI3K␥KO Mice in Response to Biomechanical Stress In response to pressure overload, WT mice developed concentric remodeling with increased wall thickness and reduction in chamber size at 1 and 3 weeks following AB (Figure 1A). In contrast, LV size dilated rapidly in PI3K␥KO mice characteristic of eccentric remodeling at 1 and 3 weeks Sham 1 Week AB 3 Weeks AB following AB as shown by trichrome-stained four-chamber views (Figure 1B). The early development of dilated cardiomyopathy in the banded PI3K␥KO mice was associated with increased interstitial myocardial fibrosis at 3 weeks after AB as illustrated by picrosirius red staining (Figure 1C) and quantified as collagen volume fraction (Figure 1D). Increased myocardial fibrosis in banded PI3K␥KO mice was confirmed by the biochemical assessment of hydroxyproline content (Figure 1D) and occurred without a measurable increase in apoptosis (Figure 1E and 1F). In banded PI3K␥KO mice, mRNA expression profile showed greater myocardial expression of the disease markers, atrial natriuretic factor (ANF) (Figure 1G), BNP (Figure 1H), and MHC (Figure 1I) with morphometric features of hypertrophy (Online Table I). Activation of several signaling pathways is a key mediator of the response to biomechanical stress.18,19 The increased phosphorylation of extracellular signal-regulated kinase (ERK)1/2 (Figure 2A) and Akt (Figure 2B) were reduced in banded PI3K␥KO mice compared with banded WT mice after 1 week of pressure overload. However, following 3 weeks of pressure overload, the degree of ERK1/2 phosphorylation was equivalent in WT and PI3K␥KO mice (Figure 2A). The GSK-3 system is an important downstream mediator of PI3K/Akt signaling1,2,20 and consistent with a loss of Akt 4 Circulation Research November 12, 2010 1 wk AB Sham A p-ERK 1/2 ERK 1/2 B WT AB AB Sh 1 wk 3 wk PI3Kγ-KO AB AB Sh 1 wk 3 wk p-Akt (S473) Akt Downloaded from http://circres.ahajournals.org/ by guest on June 17, 2017 C WT PI3Kγ-KO AB AB Sh 1 wk 3 wk AB AB Sh 1 wk 3 wk p-GSK-3α GSK-3α D WT PI3Kγ-KO AB AB Sh 1 wk 3 wk AB AB Sh 1 wk 3 wk p-GSK-3β GSK-3β E WT PI3Kγ-KO AB AB Sh 1 wk 3 wk AB AB Sh 1 wk 3 wk p-FAK FAK 1.2 1.2 1.0 1.0 0.8 * * 0.6 0.4 0.4 0.2 0.2 0.0 0.0 1.2 * * 1.0 0.8 0.8 0.6 0.6 0.4 0.4 0.2 0.2 0.0 0.0 2.0 2.0 * 1.5 1.5 1.0 1.0 0.5 0.5 0.0 0.0 0.6 0.6 0.5 * 0.4 0.3 0.3 0.2 0.2 0.1 0.1 0.0 0.0 1.0 * * # 0.5 0.4 1.2 * 0.8 0.6 1.0 3 wk AB PI3Kγ-KO 1.2 p-Akt (S473) / Akt (AU) AB AB Sh 1 wk 3 wk p-GSK-3α / GSK-3α (AU) AB AB Sh 1 wk 3 wk p-GSK-3β / GSK-3β (AU) PI3Kγ-KO p-FAK / FAK (AU) WT p-ERK 1/2 / ERK 1/2 (AU) WT * 1.2 1.0 0.8 0.8 0.6 0.6 0.4 0.4 0.2 0.2 0.0 0.0 * * Figure 2. Altered signaling in response to biomechanical stress in PI3K␥KO mice. A and B, Western blot analysis (left) and quantification (right) showing increased phosphorylation of the mitogen-activated protein kinase ERK1/2 (A) with loss of serine 473 Akt phosphorylation (B) in the banded PI3K␥KO mice. C through E, Western blot analysis (left) and quantification (right) showing preservation of glycogen synthase kinase 3␣ (GSK-3␣) (C) and GSK-3 (D) phosphorylation in banded WT mice but with a loss of phosphorylation in the banded PI3K␥KO mice, whereas earlier phosphorylation of focal adhesion kinase (FAK) occurs in the banded PI3K␥KO mice (E). n⫽5 per group. AU indicates arbitrary unit. *P⬍0.05 compared with the corresponding sham group; #P⬍0.05 compared with WT sham. signaling, phosphorylated (phospho)–GSK-3␣ (Figure 2C) and phospho–GSK-3 (Figure 2D) were not affected initially at 1 week and then showed a drastic reduction at 3 weeks after AB in PI3K␥KO mice. Interestingly, baseline level of phospho–GSK-3 was significantly greater in PI3K␥KO compared with WT mice (Figure 2D). The phosphorylation of focal adhesion kinase (FAK) is widely accepted as a fundamental response in myocardial mechanical stretch and hypertrophy.21 In the banded PI3K␥KO mice, increased phosphoFAK occurred at an earlier stage compared with WT mice consistent with an aberrant response to biomechanical stress (Figure 2E). These results show that PI3K␥KO mice devel- Guo et al oped a rapid onset of adverse myocardial remodeling and pathological hypertrophy in response to biomechanical stress with resultant alteration in the activation of mechanosensitive and Akt-dependent signaling cascades. Uncoupling Between In Vivo Myocardial Contractility and Single-Cardiomyocyte Contractility in Pressure-Overloaded PI3K␥KO Mice Downloaded from http://circres.ahajournals.org/ by guest on June 17, 2017 To examine whether these differences in myocardial remodeling in WT and PI3K␥KO mice result in functional alteration, we used transthoracic echocardiography to assess heart function. LV size rapidly dilated with a marked and progressive decrement in systolic function at 1 and 3 weeks in PI3K␥KO mice (Figure 3A through 3E; Online Table II). In marked contrast, banded WT mice developed increased wall thickness with reduced ventricular size and preserved systolic function (Figure 3A through 3D; Online Table II). We used invasive hemodynamic measurements to further characterize these functional alterations which showed greater elevation in LV end diastolic pressure (Online Table II) and reduced myocardial contractility as assessed by ⫹dP/dtmax (Figure 3D; Online Table II) and ⫺dP/dtmin (Figure 3E; Online Table II) in banded PI3K␥KO mice. The early and marked decompensation in banded PI3K␥KO mice despite enhanced Ca2⫹ cycling and increased basal myocardial contractility (Figure 3; Online Table II)3,6,10 suggests that myocardial cell adhesion is compromised. As such, we hypothesize that isolated cardiomyocyte contractility would remain elevated in banded PI3K␥KO mice. Increased phosphorylation of PLN is a critical target of the elevated cAMP levels in PI3K␥KO mice.3,10,22 Western blot analyses confirmed increased serine-16 phosphorylation of PLN in PI3K␥KO compared with WT mice, which was preserved in response to pressure overload (Figure 3F). Analysis of cAMP levels in the LV from PI3K␥KO mice confirmed elevated basal levels of cAMP which were maintained in response to 1 week of after AB (Figure 3G). Indeed, isolated cardiomyocytes from banded PI3K␥KO mice showed increased cell shortening (Figure 3H) and rate of contractility (Figure 3I) compared with cardiomyocytes obtained from banded WT mice. Whereas ECM-based cell adhesion was intact in the PI3K␥KO cardiomyocytes under baseline conditions (sham), there was a drastic loss of adhesive properties to collagen IV and laminin in response to pressure overload (Figure 3J). In contrast, cardiomyocyte adhesion from WT mice remained intact following pressure overload (Figure 3J). These results show that isolated cardiomyocytes maintain an increased contractility despite the early deterioration in whole heart systolic function providing strong evidence that the primary defect in banded PI3K␥KO mice is a disorganized extracellular matrix and/or cell adhesion. Selective Upregulation of MMP2 and MT1-MMP and MMP Inhibition Mediated Rescue of Pressure-Overloaded PI3K␥KO Mice Adverse remodeling of the extracellular matrix by MMPs is a key determinant of the response to biomechanical stress.23 Role of PI3K␥ in Biomechanical Stress 5 MMP2 (gelatinase A) and MMP13 (collagenase-3) genes contain promoter regions encoding a cAMP-response element (CRE), which binds CRE binding protein (CREB)24 and mediates cAMP-dependent increase in the synthesis of MMP225 and MMP13,26 whereas MT1-MMP expression is also positively regulated by cAMP.27 We hypothesize that elevated cAMP levels in the setting of increased biomechanical stress synergistically increase MMP expression and/or activity in banded PI3K␥KO mice. Indeed, both MMP2 (Figure 4A) and MT1-MMP (Figure 4B) myocardial mRNA expression increased within 1 week of after AB and persisted at 3 weeks in PI3K␥KO compared with WT mice, whereas MMP13 expression was drastically increased in PI3K␥KO mice at 3 weeks after AB (Figure 4C). In contrast, non– cAMP-responsive MMPs such as MMP9 (gelatinase B) (Figure 4D) and MMP8 (collagenase-2) (data not shown) showed no differential change in expression in response to after AB. To provide a more definitive connection between cAMP and MMP expression/activity, we also examined the expression of these MMPs in banded PI3K␣DN mice which also develop an early dilated cardiomyopathy4 and in banded PI3K␥KD mice, which lack PI3K␥ signaling without elevation in cAMP levels.6 Consistent with our hypothesis, myocardial expression levels of MMP2 (Figure 4A), MT1-MMP (Figure 4B), and MMP13 (Figure 4C) were not increased in PI3K␣DN and PI3K␥KD mice at 1 and 3 weeks after AB. Next, we examined the changes in MMP expression in cultured adult ventricular cardiomyocyte and cardiofibroblast fractions in response to the activation of cAMP signaling using the -adrenergic agonist, isoproterenol. The levels of cAMP in cardiomyocytes increase significantly in response to isoproterenol stimulation preventable by -adrenergic blockade using propranolol (25 mol/L) and specific adenylate cyclase inhibition using 2⬘,5⬘-dideoxyadenosine (DIDA) (30 mol/L; Figure 4E). Western blot analysis showed an early and marked increase in serine-133 CREB phosphorylation in cultured cardiomyocytes and cardiofibroblasts (Figure 4F) and shown quantitatively (Figure 4G) in response to -adrenergic receptor stimulation. Consistent with activation of CREB, mRNA levels of cAMP-responsive MMPs following 24 hours of stimulation with 100 nmol/L isoproterenol showed that MMP2 (Figure 4H), MT1-MMP (Figure 4I), and MMP13 (Figure 4J) all showed a significant rise in mRNA expression in cultured adult cardiomyocytes. Although the basal expressions of MMP2 and MT1-MMP were greater in cultured adult cardiofibroblasts, MMPs also showed a similar increase in response to -adrenergic stimulation in these cells (Figure 4H through 4J). Importantly, the corresponding increase in mRNA expression of MMP2, MT1-MMP, and MMP13 in both cardiomyocytes and cardiofibroblasts were suppressed by both propranolol and DIDA (Figure 4H through 4J). We next assessed for direct biochemical evidence for increased MMP activity in the PI3K␥KO mice in response to pressure overload. Myocardial collagenase activity showed a significant increase at 1 and 3 weeks after AB in the PI3K␥KO mice compared with banded WT mice, which was suppressible by the MMP inhibitor PD166793 (Figure 5A), whereas gelatin zymography showed selective activation of 6 Circulation Research November 12, 2010 Downloaded from http://circres.ahajournals.org/ by guest on June 17, 2017 Figure 3. Uncoupling between in vivo myocardial contractility and isolated single cardiomyocyte contractility in PI3K␥KO mice in response to early biomechanical stress. A through E, M-mode echocardiograms (A) and in vivo quantitative assessment of heart function showing baseline hypercontractility followed by rapid and marked ventricular dilation (B) and reduction in systolic function based on fractional shortening (C) and invasive hemodynamic measurement of ⫹dP/dtmax (D) and ⫺dP/dtmin (E) at 1 week after AB. LVEDD indicates LV end-diastolic diameter. n⫽8 for sham groups; n⫽12 for AB groups. F through G, Western blot analysis (left) and quantification (right) using myocardial membrane fractions showing increased phospho-PLN at baseline and in banded PI3K␥KO mice (F) with elevated myocardial cAMP levels in PI3K␥KO hearts at baseline and at 1 week after AB (G). n⫽5 for all groups. H and I, Single cardiomyocyte contractility measurements showing basal hypercontractility based on percentage (H) and rate of change (⫹dL/dt) (I) of cell shortening in PI3K␥KO mice, which persists in response to 1 week of pressure overload. n⫽8 for sham groups; n⫽12 for AB groups. J, ECM-based cell adhesion of isolated adult LV cardiomyocytes following 1 week of after AB showing an increase in fibronectin adhesion in WT cardiomyocytes and a marked decrease in adhesion to collagen IV and laminin in PI3K␥KO cardiomyocytes. AU indicates arbitrary unit; Col I, collagen I; Col IV, collagen IV; FN, fibronectin; LN, laminin. n⫽4 for WT and PI3K␥KO. *P⬍0.05 compared with corresponding WT group. Role of PI3K␥ in Biomechanical Stress Guo et al WT 140 PI3Kα-DN 120 PI3Kγ-KO PI3Kγ-KD 100 80 B * * 60 4 MT1-MMP/18S (AU) MMP2/18S (AU) A 40 7 * 3 * 2 1 20 0 C Sham 1 Week AB D 16 MMP9/18S (AU) 12 10 8 6 1 Week AB 3 Weeks AB Sham 1 Week AB 3 Weeks AB 3 2 1 2 Sham 1 Week AB E Cardiomyocyte F 40 * 30 Control ISO ISO + Prop ISO + ACi 0 3 Weeks AB Control G ISO 30 mins ISO 1 hour p-CREB CREB Cardiofibroblast 20 Control 10 ISO 30 mins ISO 1 hour p-CREB 0 I 10 5 0 * Cardiomyocyte Cardiofibroblast * # 1.5 1.0 0.5 Cardiomyocyte Cardiofibroblast 40 30 20 10 0 10 MMP 13/18S (AU) 15 50 MT1-MMP/18S (AU) MMP 2/18S (AU) 20 # J 25 * 2.0 0.0 CREB H Control ISO 30 mins ISO 1 hour # # 2.5 p-CREB/CREB (AU) 0 cAMP (pmol/mg) Downloaded from http://circres.ahajournals.org/ by guest on June 17, 2017 4 Sham 4 * 14 MMP13/18S (AU) 0 3 Weeks AB * Cardiomyocyte Cardiofibroblast 8 6 * Control ISO ISO + Prop ISO + ACi 4 2 0 * Cardiomyocyte Cardiofibroblast Figure 4. Upregulation of myocardial matrix metalloproteinase expression in banded PI3K␥KO mice with -adrenergic receptor stimulation of MMPs expression in isolated adult cardiomyocytes and cardiofibroblasts. A through D, Expression profiling of MMPs revealed selective upregulation of myocardial MMP2 (A), MT1-MMP (B), and MMP13 (C) expression without a change in MMP9 (D) expression in the banded PI3K␥KO mice compared with banded WT, PI3K␣DN, and PI3K␥-kDa mice. *P⬍0.05 compared with all other groups. E, Normalization of elevated cAMP levels in cultured adult cardiomyocytes in response to -adrenergic receptor stimulation using isoproterenol (100 nmol/L) by -adrenergic receptor blockade using propranolol (25 mol/L) and specific adenylate cyclase inhibition using DIDA (30 mol/L); n⫽5 for each group. F and G, Western blot analyses showing early phosphorylation of cAMPresponse element (CRE) binding protein (CREB) in response to -adrenergic receptor stimulation using isoproterenol (100 nmol/L) in cultured adult cardiomyocytes and cardiofibroblasts (F) and shown quantitatively (G). n⫽5 for each group. #P⬍0.05 compared with the control group. H through J, Expression analysis showing that long-term -adrenergic receptor stimulation using isoproterenol (100 nmol/L) leads to an upregulation of mRNA expression of MMP2 (H), MT1-MMP (I), and MMP13 (J) in cultured adult cardiomyocytes and cardiofibroblasts, which was prevented by the -adrenergic receptor blocker propranolol (25 mol/L) and specific adenylate cyclase inhibition using DIDA (30 mol/L). AU indicates arbitrary unit. n⫽5 for each group. *P⬍0.05 compared with all other groups. MMP2 in banded PI3K␥KO compared with WT mice (Figure 5B). MMP9 protein levels did not change in banded WT hearts, whereas at 3 weeks, post-AB PI3K␥KO hearts showed an increase (Online Figure III) despite minimal increase in mRNA levels (Figure 4D), suggesting a posttranscriptional mechanism for the increased MMP9 levels. Given the lack of an increased MMP expression in banded PI3K␥KD mice, myocardial collagenase activity was not elevated in these November 12, 2010 WT A 2.0 Collagenase activity (AU) B WT PI3Kγ-KO PI3Kγ-KD PI3Kγ-KO sh 1wk 3wks sh 1wk 3wks 72kDa MMP2 64kDa MMP2 * * 1.5 1.0 WT 0.5 PI3Kγ-KO sh 1wk 3wks sh 1wk 3wks 0.0 Sham 1wk AB 72kDa MMP2 64kDa MMP2 3 wks AB 1wk AB + MMPi α-tubulin MT1-MMP Ponceau Red E *# 6 * 4 2 0 WT 5 * 4 3 * 2 1 0 WT PI3Kγ-KO 4 * * 3 * 2 1 0 WT PI3Kγ-KO D PI3Kγ-KO 16 14 12 10 8 6 4 2 0 PI3Kγ-KO + AB + MMPi TIMP3/18S (AU) PI3Kγ-KO + AB + MMPi *# 5 Sham 1 week AB 3 weeks AB 2.0 # TIMP2/18S (AU) sh 1wk 3wks sh 1wk 3wks 8 1.5 # 1.0 # # 0.5 Sham 0 1 Week AB 3 Weeks AB * 3 2 1 0 Sham 1 Week AB 3 Weeks AB WT PI3Kγ-KO 4 4 TIMP4/18S (AU) PI3Kγ-KO MT1-MMP/Ponceau Red (AU) WT TIMP1/18S (AU) C Sham 1 Week AB 3 Weeks AB 3 * 2 1 0 Sham 1 Week AB 3 Weeks AB F 4 2 0 MMPi (-) (-) (+) WT PI3Kγ-KO 10 8 6 4 4 3 2 3 10 1 0 WT PI3Kγ-KO MMPi (-) (-) (+) WT PI3Kγ-KO 30 20 0 *# 40 2 1 (+) 50 4 0 (-) * 5 2 MMPi (-) 60 6 5 FS (%) BNP/18S (AU) 6 * 6 * 12 LVESD (mm) 14 * LVEDD (mm) 8 ANF/18S (AU) Downloaded from http://circres.ahajournals.org/ by guest on June 17, 2017 Sham 1 week AB 3 weeks AB MMP2 (72kDa)/α-tubulin (AU) Circulation Research MMP2 (64kDa)/α-tubulin (AU) 8 * 0 MMPi (-) (-) (+) WT PI3Kγ-KO MMPi (-) (-) (+) WT PI3Kγ-KO Figure 5. Increased collagenase activity, MMP2 activation, and MT1-MMP levels with prevention of the dilated cardiomyopathy by broad-spectrum MMP inhibition in banded PI3K␥KO mice. A, Increased myocardial collagenase activity in banded PI3K␥KO mice suppressible by the MMP inhibitor PD166793 (30 mg/kg per day). B and C, Gelatin zymography showed increased pro-MMP2 and active MMP2 levels in the banded PI3K␥KO mice and Western blot analysis showing increased expression of active MMP2 (64 kDa) and pro-MMP2 (72 kDa) (B) and membrane-fractionated MT1-MMP (C) in banded PI3K␥KO at 1 and 3 weeks after AB. n⫽4 for sham group and AB groups. *P⬍0.05 compared with the sham group. D, Expression profile of tissue inhibitors of metalloproteinases (TIMP) showing equivalent upregulation in TIMP1 without alteration in TIMP2, whereas TIMP3 and TIMP4 levels were increased in banded PI3K␥KO mice. n⫽6 for sham group and n⫽8 for AB groups. #P⬍0.05 compared with the sham group; *P⬍0.05 compared with the WT group. E and F, Treatment with the broad-spectrum MMP inhibitor PD166793 (30 mg/kg per day) prevented the dilated cardiomyopathy and disruption of the extracellular collagen network shown as picrosirius red staining (E) while reversing the upregulation of disease markers, ANF and BNP, ventricular dilation at end-diastole and end-systole, and reduction in systolic performance (F) in banded PI3K␥KO mice. FS indicates fractional shortening; LVEDD, LV end diastolic diameter; LVESD, LV end systolic diameter. n⫽8 for each group. *P⬍0.05 compared with all other groups; #P⬍0.05 compared with WT group. AU indicates arbitrary unit. Guo et al Downloaded from http://circres.ahajournals.org/ by guest on June 17, 2017 mice (Figure 5A). Consistent with gelatin zymography, Western blot analysis and quantification (Figure 5B) revealed increased myocardial expression of active MMP2 (64 kDa) and pro-MMP2 (72 kDa) in banded PI3K␥KO mice at 1 and 3 weeks after AB. Similarly, membrane fractionation and analysis of MT1-MMP levels showed an earlier and greater increase in MT1-MMP levels in banded PI3K␥KO mice (Figure 5C). The activity of MMPs are inhibited by tissue inhibitor of matrix metalloproteinases (TIMPs), TIMP1, TIMP2, TIMP3, and TIMP4 with TIMP3 playing a key role in the myocardial response to biomechanical stress.12,28 Interestingly, TIMP1 levels increased similarly, whereas the expression of TIMP2 did not change in banded WT and PI3K␥KO mice (Figure 5D). By contrast, increase in TIMP3 and TIMP4 expression occurs at 3-weeks after AB in PI3K␥KO mice possibly attributable to a negative-feedback response to the increased MMP expression and activities (Figure 5D). Our data provide a crucial link between the adverse myocardial remodeling in banded PI3K␥KO mice and the increase in activation and activity of MMPs. Human recombinant MMP2 rather than MT1-MMP cleaves human recombinant N-cadherin Fc chimera and was inhibited by the MMP inhibitor, PD166793 (Online Figure II). We hypothesized that MMP inhibition will lead to a marked protection in banded PI3K␥KO mice. Daily treatment of banded PI3K␥KO mice with the broad-spectrum MMP inhibitor PD166793 (30 mg/kg per day)12 prevented the dilated cardiomyopathy, fibrosis, and disruption of the extracellular collagen network (Figure 5E). This also reversed the upregulation of disease markers, ANF and BNP, and ventricular dilation at end-diastole and end-systole, resulting in improved systolic performance in banded PI3K␥KO mice (Figure 5F). These results illustrate a key role of cAMP-mediated upregulation of MMP2 and MT1-MMP expressions in mediating the adverse myocardial remodeling in pressure-overloaded PI3K␥KO mice. Specific Loss of N-Cadherin From Adhesion Complexes While -Adrenergic Blocker Prevents Upregulation of MMP and Loss of N-Cadherin in Banded PI3K␥KO Mice In addition to the degradation of the ECM, N-cadherin/catenin cell adhesion complexes are also important targets of an activated MMP system.29,30 Western blot analysis of the myocardial membrane fraction in banded WT and PI3K␣DN mice showed a modest increase in N-cadherin levels (Figure 6A and 6B), whereas in banded PI3K␥KO mice, there was a 75% loss of N-cadherin levels (Figure 6A and 6B). In contrast, in the banded PI3K␥KO (and PI3K␣DN) mice, levels of -catenin in the heart were significantly increased compared with banded WT mice (Figure 6C). The relative preservation of N-cadherin levels in the PI3K␥KD hearts is consistent with a critical role of cAMP in mediating the loss of N-cadherin from adhesion complexes independent of the PI3K␥ lipid kinase activity per se. The quality of Western blot analysis was confirmed by absence of the membranespecific protein (toll-like receptor 4) in the cytosolic fraction and absence of the cytosolic-specific protein (caspase-3) in the membrane fraction (Online Figure I). Immunofluores- Role of PI3K␥ in Biomechanical Stress 9 cence microscopy confirmed colocalization of N-cadherin and -catenin in the end-to-end and side-to-side connections between cardiomyocytes in banded WT hearts (Figure 6D). Consistent with our Western blot analysis, there was a near complete loss of N-cadherin from end-to-end and side-to-side connections from pressure-overloaded PI3K␥KO myocardium (Figure 6E). Consistent with the ability of PD166793 to prevent MMP2-mediated cleavage of N-cadherin (Online Figure II) and rescue the dilated cardiomyopathy in banded PI3K␥KO mice (Figure 5), Western blot analysis confirmed reduced loss of membrane-associated N-cadherin (Figure 6F and 6G), resulting in more pronounced staining of N-cadherin in the myocardial cell adhesion junctions (Figure 6H) in banded PI3K␥KO mice treated with PD166793. Given the key role of integrin complexes in mediating cell adhesion in the heart,31,32 we also examined changes in integrin levels in response to pressure overload. Western blot analysis of membrane fractionated 1D and ␣7B integrins showed increased levels in WT hearts at 1 and 3 weeks after AB with a delayed increase in the PI3K␥KO hearts with a significant increase only at 3 weeks after AB (Online Figure IV). We then tested the hypothesis that elevated cAMP plays a key in vivo role in the adverse remodeling in banded PI3K␥KO mice by using the nonspecific -adrenergic blocker propranolol at a dose that has been previously shown to normalize elevated cAMP levels.6 Propranolol treatment normalizes the mRNA expression of MMP2, MT1-MMP, and MMP13 (Figure 7A) with similar changes seen in the expression of disease markers, ANF, MHC, and BNP (Figure 7B). Consistent with a reduction in MMP expression, elevated collagenase activity in the banded PI3K␥KO mice was normalized in response to propranolol (Figure 7C) with relative preservation of N-cadherin levels in the myocardial membrane fraction (Figure 7D). These biochemical and cellular changes implies that cardiac function was rescued in banded PI3K␥KO mice treated with propranolol. Indeed, echocardiographic assessment showed a near normalization of the increased LV dilation and improved fractional shortening with invasive hemodynamic parameters showing marked increase in ⫹dP/dtmax and ⫺dP/dtmin in the banded PI3K␥KO mice treated with propranolol (Figure 7E). These results highlight a key reversible defect in the N-cadherin system in the PI3K␥KO mice in response to biomechanical stress caused by cAMP-dependent upregulation of MMP activity. -Blocker Therapy Prevents the Adverse Remodeling in Response to Chronic Pressure Overload The beneficial effects of -blocker therapy in the banded PI3K␥KO mice suggest that blockade may have a similar protective role in a long-term (9 weeks) AB model of WT mice. Aortic banding for 9 weeks resulted in marked increase in expression of hypertrophy markers, ␣-skeletal actin, MHC and BNP (Figure 8A) in association with LV dilation and reduced systolic function (Figure 8B; Online Figure V). Propranolol treatment prevented the adverse remodeling and systolic dysfunction in response to chronic biomechanical stress (Figure 8A and 8B; Online Figure V). Quantitative 10 Circulation Research November 12, 2010 A B C 2.0 2.0 * AB Sh AB N-cadherin β-catenin Coomassie Blue 1.5 1.5 * 0.5 * F PI 3K γKD PI 3K γKO T αDN W PI 3K N-cadherin G PI3Kγ-KO AB β-catenin Co-localization H N-cadherin Co-localization PI3Kγ-KO AB + MMPi PI3Kγ-KO WT AB N-cadherin Coomassie Blue AB AB + MMPi N-Cadherin (AU) 1.2 β-catenin 1.0 N-cadherin Co-localization 0.8 0.6 0.4 * 0.2 0.0 T AB PI 3 Kγ -K O AB MMPi (-) (-) (+) W Downloaded from http://circres.ahajournals.org/ by guest on June 17, 2017 β-catenin 0.5 0.0 E WT AB * 1.0 1.0 0.0 D Sham AB αDN PI 3K γKD PI 3K γKO Sh T AB * W Sh PI3Kγ-KO PI 3K AB PI3Kγ-KD β-Catenin (AU) Sh PI3Kα-DN N-Cadherin (AU) WT Figure 6. Selective loss of N-cadherin from myocardial membrane fraction and the cell adhesion complexes in the myocardium from banded PI3K␥KO mice. A through C, Western blot analysis of the myocardial membrane fraction (A) and quantification (B) showing a selective loss of N-cadherin levels without alteration in -catenin levels (C) in banded PI3K␥KO mice, whereas the level of N-cadherin increases in banded WT and PI3K␣DN mice. *P⬍0.05 compared with the corresponding sham group. D and E, Immunofluorescence microscopy of the myocardial -catenin and N-cadherin proteins showing end-to-end connections (top) and side-to-side connections (bottom) in banded WT (D) and PI3K␥KO (E) mice with a distinct loss of N-cadherin in the banded PI3K␥KO mice. F through H, Western blot analysis of the myocardial membrane fraction (F) and quantification (G) and immunofluorescence microscopy of myocardial -catenin and N-cadherin proteins (H) showing MMP inhibition prevents loss of N-cadherin in banded PI3K␥KO mice. AU indicates arbitrary unit. n⫽5 for all groups. *P⬍0.05 compared with all other groups. assessment of cardiac systolic function using echocardiography showed a marked improvement in fractional shortening and reduction in LV end-diastolic dimension (Online Figure V). Similarly, invasive hemodynamic measurement revealed restoration of an elevated LV end-diastolic pressure and normalization of ⫹dP/dtmax and – dP/dtmin in response to chronic -blocker therapy (Figure 8C). These functional changes correlated with a reduction of MMP2 and MT1- Guo et al Role of PI3K␥ in Biomechanical Stress 11 Downloaded from http://circres.ahajournals.org/ by guest on June 17, 2017 Figure 7. The nonspecific -receptor blocker propranolol (15 mg/kg per day) prevents the molecular, biochemical, and functional deterioration in response to biomechanical stress in PI3K␥KO mice. A and B, Expression profiling showing that treatment with propranolol prevents the increased expression of MMPs including MMP2, MT1-MMP, and MMP13 (A) and disease markers such as ANF, MHC, and BNP (B) in banded PI3K␥KO mice. *P⬍0.05 compared with all other groups. C and D, Suppression of the increased myocardial collagenase activity (C) with Western blot analysis and quantification (D) showing restoration of the membrane N-cadherin levels in banded PI3K␥KO mice. *P⬍0.05 compared with all other groups. E, Reduction in LV dilation and preservation of systolic function in response to treatment with propranolol in banded PI3K␥KO mice based on echocardiographic parameters, LV end diastolic diameter (LVEDD) and fractional shortening (FS), and hemodynamic assessment, ⫹dP/dtmax and ⫺dP/dtmin. AU indicates arbitrary unit. n⫽8 for all groups. *P⬍0.05 compared with all other groups. 12 Circulation Research November 12, 2010 Downloaded from http://circres.ahajournals.org/ by guest on June 17, 2017 Figure 8. Chronic -blocker prevents pressure overload–induced adverse remodeling and preserves systolic function in WT mice. A, Expression profile of hypertrophy disease markers showing markedly increased expression of ␣-skeletal actin, MHC, and BNP in banded WT mice at 9 weeks, which was dramatically reduced by treatment with propranolol. n⫽5 per group. B, Echocardiographic assessment of systolic function with M-mode echocardiograms showing a marked reduction in LV dilation and increase in fractional shortening in response to therapy with propranolol. C, Invasive hemodynamic assessment showing marked reduction in LVEDP and prevention of the deterioration in myocardial contractility based on ⫹dP/dtmax and ⫺dP/dtmin in response to chronic -blocker therapy. n⫽6 for WT sham and n⫽8 for WT AB groups. D, Expression of MMPs showing a marked increase in MMP2 and MT1-MMP expression without a differential effect on MMP-13 levels and a normalization in response to chronic -blocker therapy (n⫽5 per group). E, Western blot analysis revealed a greater increase in myocardial N-cadherin levels with equivalent increase in -catenin levels, leading to a relative preservation of the N-cadherin/-catenin ratio in response to chronic -blocker therapy. AU indicates arbitrary unit. n⫽5 per group. *P⬍0.05 compared with all other groups; #P⬍0.05 compared with WT⫹AB 9 weeks; ‡P⬍0.05 compared with WT sham group. Guo et al MMP expression in the absence of a differential effect on MMP13 expression (Figure 8D). Western blot analysis showed a higher level of membrane-associated N-cadherin with an equivalent increase in -catenin levels resulting in preservation of the myocardial N-cadherin/-catenin ratio (Figure 8E) in response to chronic -blocker therapy. Our results highlight a novel mechanism of chronic -blocker therapy in preventing the adverse myocardial remodeling in pressure overload–induced heart failure. Discussion Downloaded from http://circres.ahajournals.org/ by guest on June 17, 2017 The response to biomechanical stress is a fundamental response in heart disease and plays a key adaptive role in response to a pressure overload state characteristic of hypertension and valvular stenosis. Mechanotransduction plays a fundamental role in cardiac structure and function and involves a concerted interaction between extracellular matrix, intracellular cytoskeletal proteins, and cell adhesion complexes.7,33 Advanced heart failure in response to myocardial injury including biomechanical stress leads to impaired Ca2⫹ cycling and strategies aimed at enhancing Ca2⫹ cycling are currently being developed as therapies for heart failure.34,35 Loss of PI3K␥ increases basal cAMP levels, enhances SERCA2 function and Ca2⫹ cycling, and increases basal myocardial contractility.3,6,10 In the heart, loss of PI3K␥ prevents phosphorylation of Akt in response to G protein– coupled receptor agonists,6,11,36 and PI3K␥KO mice are resistant to the pathological effects of -adrenergic stimulation.11 Despite these biochemical changes, PI3K␥KO mice show enhanced susceptibility to biomechanical stress,6,37 and we provide direct evidence that the primary defect is a compromised cell-adhesion/extracellular matrix system linked to elevated cAMP levels. In contrast, in PI3K␥KD mice, which have normal myocardial cAMP levels,6 there is no upregulation of MMPs with preservation of N-cadherin levels consistent with the ability of these mice to maintain normal systolic function in response to early biomechanical stress.6 The PI3K/PTEN system may also have a more direct role in the cardiac response to biomechanical stress.2,7,8,13 Whereas PI3K and lipid phosphatases can modulate cytoskeletal interactions, stretch can in turn activate Akt/PKB and GSK-3 activity.8 Indeed, loss of PTEN prevents pressure overload–induced heart failure,13 whereas loss of Akt1/PKB␣ leads to a rapid onset of ventricular dilation and systolic dysfunction in response to pressure overload.38 Consistent with a critical role of PI3K␥ in pathological G protein– coupled receptor signaling,6,11,36 phosphorylation of ERK1/2 is impaired in response to early biomechanical stress in the PI3K␥KO mice.6 However, this differential response is loss at 3 weeks after AB, which is likely driven by severe disruption of the ECM and/or cell adhesion leading to G protein– coupled receptor–independent activation of ERK1/2 in the PI3K␥KO mice. Despite equivalent basal phospho-Akt levels in WT and PI3K␥KO hearts, basal phospho–GSK-3 was increased in the PI3K␥KO mice, likely mediated by PKA39 given the chronic elevation of myocardial cAMP levels in these mice. The diverse downstream effects of Role of PI3K␥ in Biomechanical Stress 13 elevated basal phospho–GSK-340 may have contributed to the adverse remodeling in the PI3K␥KO mice. Elevated cAMP levels in response to increased biomechanical stress leads to increased MMP expression and increased active (cleaved) MMP2 and collagenase activity, leading to adverse myocardial remodeling. Activation of pro-MMP2 occurs by proteolytic cleavage of the N-terminal propeptide and requires two MT1-MMP molecules in association with TIMP2.41,42 In addition to degrading various components of the ECM, increased MMP activity can also adversely modify cell– cell adhesion complexes. Cardiomyocyte cell adhesion complexes provide an important mechanism by which cardiomyocytes (and cardiofibroblasts) are anchored to the extracellular matrix while allowing force transmission to the intracellular cytoskeletal network.31,33,43 In particular, we have shown that increased MMP expression and activity can regulate N-cadherin function through proteolytic degradation.29,30,44 Cardiac-specific loss of N-cadherin in the heart leads to a dilated cardiomyopathy attributable to loss of the integrity of cell adhesion junctions.45 Because of their homophilic binding and adhesive specificities, N-cadherin/catenin complex is required for cadherin-mediated cell adhesion and linkage to the actin cytoskeleton. The delayed increase in membrane 1D and ␣7B integrins in the banded PI3K␥KO hearts may have also contributed to the early onset of dilated cardiomyopathy.31,32 In addition, MT1-MMP is a potent collagenase that also targets other ECM components such as fibronectin,46 laminin,46 and integrins47,48 while activating MMP13 (collagenase-3), thereby amplifying the collagen-degradation process.16,49 Our results are consistent with the conclusion that elevated cAMP (and its downstream effects) is the primary driver of the adverse remodeling in banded PI3K␥KO mice rather than loss of PI3K␥ signaling per se. Our findings may help to explain the cardiomyopathy in experimental models with enhanced -adrenergic signaling (and cAMP levels)50,51 and lack of a protection against pressure overload and tumor necrosis factor–induced heart failure despite enhanced Ca2⫹ cycling in the PLN knockout mice.52,53 Indeed, whereas Ca2⫹ transients in cardiomyocytes were normalized in tumor necrosis factor–induced cardiomyopathy in a PLN-null background, global systolic function remained depressed and unchanged.53 We propose that enhancing cell– cell adhesion and cell–ECM interaction will promote the salutary effects of enhanced intracellular Ca2⫹ cycling on whole heart function and booster the therapeutic potential of normalizing intracellular Ca2⫹ cycling in patients with heart failure. Increased sympathetic nervous system activity and -adrenergic receptor signaling are key aspects of the pathophysiology of heart failure54 and in catecholamine-mediated cardiomyopathies.55,56 -Adrenergic receptor blockers improve clinical outcomes in patients with chronic heart failure.54 In contrast, agents that increase myocardial cAMP such as PDE3 inhibitors are associated with adverse outcomes and increased mortality in patients with heart failure.57 Our data support a novel role of -adrenergic blocker in reducing MMP expression and/or activity and preservation of cell adhesion, thereby curtailing adverse myocardial remodeling. 14 Circulation Research November 12, 2010 Sources of Funding This work was supported by the Heart and Stroke Foundation of Canada (to G.Y.O.), Canadian Institute for Health Research (grant 86602 to G.Y.O. and grant 84279 to Z.K.), and the Alberta Innovates–Health Solutions (to G.Y.O. and Z.K.). Disclosures None. References Downloaded from http://circres.ahajournals.org/ by guest on June 17, 2017 1. Oudit GY, Sun H, Kerfant BG, Crackower MA, Penninger JM, Backx PH. The role of phosphoinositide-3 kinase and PTEN in cardiovascular physiology and disease. J Mol Cell Cardiol. 2004;37:449 – 471. 2. Oudit GY, Penninger JM. Cardiac regulation by phosphoinositide 3-kinases and PTEN. Cardiovasc Res. 2009;82:250 –260. 3. Crackower MA, Oudit GY, Kozieradzki I, Sarao R, Sun H, Sasaki T, Hirsch E, Suzuki A, Shioi T, Irie-Sasaki J, Sah R, Cheng HY, Rybin VO, Lembo G, Fratta L, Oliveira-dos-Santos AJ, Benovic JL, Kahn CR, Izumo S, Steinberg SF, Wymann MP, Backx PH, Penninger JM. Regulation of myocardial contractility and cell size by distinct PI3K-PTEN signaling pathways. Cell. 2002;110:737–749. 4. McMullen JR, Shioi T, Zhang L, Tarnavski O, Sherwood MC, Kang PM, Izumo S. Phosphoinositide 3-kinase(p110alpha) plays a critical role for the induction of physiological, but not pathological, cardiac hypertrophy. Proc Natl Acad Sci U S A. 2003;100:12355–12360. 5. Inuzuka Y, Okuda J, Kawashima T, Kato T, Niizuma S, Tamaki Y, Iwanaga Y, Yoshida Y, Kosugi R, Watanabe-Maeda K, Machida Y, Tsuji S, Aburatani H, Izumi T, Kita T, Shioi T. Suppression of phosphoinositide 3-kinase prevents cardiac aging in mice. Circulation. 2009;120: 1695–1703. 6. Patrucco E, Notte A, Barberis L, Selvetella G, Maffei A, Brancaccio M, Marengo S, Russo G, Azzolino O, Rybalkin SD, Silengo L, Altruda F, Wetzker R, Wymann MP, Lembo G, Hirsch E. PI3Kgamma modulates the cardiac response to chronic pressure overload by distinct kinasedependent and -independent effects. Cell. 2004;118:375–387. 7. Sugden PH. Ras, Akt, and mechanotransduction in the cardiac myocyte. Circ Res. 2003;93:1179 –1192. 8. Baba HA, Stypmann J, Grabellus F, Kirchhof P, Sokoll A, Schafers M, Takeda A, Wilhelm MJ, Scheld HH, Takeda N, Breithardt G, Levkau B. Dynamic regulation of MEK/Erks and Akt/GSK-3beta in human end-stage heart failure after left ventricular mechanical support: myocardial mechanotransduction-sensitivity as a possible molecular mechanism. Cardiovasc Res. 2003;59:390 –399. 9. Knoll R, Hoshijima M, Hoffman HM, Person V, Lorenzen-Schmidt I, Bang ML, Hayashi T, Shiga N, Yasukawa H, Schaper W, McKenna W, Yokoyama M, Schork NJ, Omens JH, McCulloch AD, Kimura A, Gregorio CC, Poller W, Schaper J, Schultheiss HP, Chien KR. The cardiac mechanical stretch sensor machinery involves a Z disc complex that is defective in a subset of human dilated cardiomyopathy. Cell. 2002;111:943–955. 10. Kerfant BG, Gidrewicz D, Sun H, Oudit GY, Penninger JM, Backx PH. Cardiac sarcoplasmic reticulum calcium release and load are enhanced by subcellular cAMP elevations in PI3Kgamma-deficient mice. Circ Res. 2005;96:1079 –1086. 11. Oudit GY, Crackower MA, Eriksson U, Sarao R, Kozieradzki I, Sasaki T, Irie-Sasaki J, Gidrewicz D, Rybin VO, Wada T, Steinberg SF, Backx PH, Penninger JM. Phosphoinositide 3-kinase gamma-deficient mice are protected from isoproterenol-induced heart failure. Circulation. 2003;108: 2147–2152. 12. Kassiri Z, Oudit GY, Sanchez O, Dawood F, Mohammed FF, Nuttall RK, Edwards DR, Liu PP, Backx PH, Khokha R. Combination of tumor necrosis factor-alpha ablation and matrix metalloproteinase inhibition prevents heart failure after pressure overload in tissue inhibitor of metalloproteinase-3 knock-out mice. Circ Res. 2005;97:380 –390. 13. Oudit GY, Kassiri Z, Zhou J, Liu QC, Liu PP, Backx PH, Dawood F, Crackower MA, Scholey JW, Penninger JM. Loss of PTEN attenuates the development of pathological hypertrophy and heart failure in response to biomechanical stress. Cardiovasc Res. 2008;78:505–514. 14. Bradshaw AD, Baicu CF, Rentz TJ, Van Laer AO, Boggs J, Lacy JM, Zile MR. Pressure overload-induced alterations in fibrillar collagen content and myocardial diastolic function: role of secreted protein acidic and rich in cysteine (SPARC) in post-synthetic procollagen processing. Circulation. 2009;119:269 –280. 15. O’Connell TD, Rodrigo MC, Simpson PC. Isolation and culture of adult mouse cardiac myocytes. Methods Mol Biol. 2007;357:271–296. 16. Kandalam V, Basu R, Abraham T, Wang X, Soloway PD, Jaworski DM, Oudit GY, Kassiri Z. TIMP2 deficiency accelerates adverse postmyocardial infarction remodeling because of enhanced MT1-MMP activity despite lack of MMP2 activation. Circ Res. 2010;106:796 – 808. 17. Zhong JC, Basu R, Guo D, Chow FL, Byrns S, Shuster M, Loibner H, Wang X, Penninger JM, Kassiri Z, Oudit GY. Angiotensin converting enzyme 2 suppresses pathological hypertrophy, myocardial fibrosis and cardiac dysfunction. Circulation. 2010;122:717–728. 18. Sussman MA, McCulloch A, Borg TK. Dance band on the Titanic: biomechanical signaling in cardiac hypertrophy. Circ Res. 2002;91: 888 – 898. 19. Heineke J, Molkentin JD. Regulation of cardiac hypertrophy by intracellular signalling pathways. Nat Rev Mol Cell Biol. 2006;7:589 – 600. 20. Matsuda T, Zhai P, Maejima Y, Hong C, Gao S, Tian B, Goto K, Takagi H, Tamamori-Adachi M, Kitajima S, Sadoshima J. Distinct roles of GSK-3alpha and GSK-3beta phosphorylation in the heart under pressure overload. Proc Natl Acad Sci U S A. 2008;105:20900 –20905. 21. Romer LH, Birukov KG, Garcia JG. Focal adhesions: paradigm for a signaling nexus. Circ Res. 2006;98:606 – 616. 22. Oudit GY, Kassiri Z. Role of PI3 kinase gamma in excitation-contraction coupling and heart disease. Cardiovasc Hematol Disord Drug Targets. 2007;7:295–304. 23. Spinale FG. Myocardial matrix remodeling and the matrix metalloproteinases: influence on cardiac form and function. Physiol Rev. 2007;87: 1285–1342. 24. Sands WA, Palmer TM. Regulating gene transcription in response to cyclic AMP elevation. Cell Signal. 2008;20:460 – 466. 25. Melnikova VO, Mourad-Zeidan AA, Lev DC, Bar-Eli M. Plateletactivating factor mediates MMP-2 expression and activation via phosphorylation of cAMP-response element-binding protein and contributes to melanoma metastasis. J Biol Chem. 2006;281:2911–2922. 26. Quinn CO, Rajakumar RA, Agapova OA. Parathyroid hormone induces rat interstitial collagenase mRNA through Ets-1 facilitated by cyclic AMP response element-binding protein and Ca(2⫹)/calmodulin-dependent protein kinase II in osteoblastic cells. J Mol Endocrinol. 2000;25:73– 84. 27. Shankavaram UT, Lai WC, Netzel-Arnett S, Mangan PR, Ardans JA, Caterina N, Stetler-Stevenson WG, Birkedal-Hansen H, Wahl LM. Monocyte membrane type 1-matrix metalloproteinase. Prostaglandindependent regulation and role in metalloproteinase-2 activation. J Biol Chem. 2001;276:19027–19032. 28. Kassiri Z, Khokha R. Myocardial extra-cellular matrix and its regulation by metalloproteinases and their inhibitors. Thromb Haemost. 2005;93: 212–219. 29. Ho AT, Voura EB, Soloway PD, Watson KL, Khokha R. MMP inhibitors augment fibroblast adhesion through stabilization of focal adhesion contacts and up-regulation of cadherin function. J Biol Chem. 2001;276: 40215– 40224. 30. Covington MD, Burghardt RC, Parrish AR. Ischemia-induced cleavage of cadherins in NRK cells requires MT1-MMP (MMP-14). Am J Physiol Renal Physiol. 2006;290:F43–F51. 31. Ross RS, Borg TK. Integrins and the myocardium. Circ Res. 2001;88: 1112–1119. 32. Babbitt CJ, Shai SY, Harpf AE, Pham CG, Ross RS. Modulation of integrins and integrin signaling molecules in the pressure-loaded murine ventricle. Histochem Cell Biol. 2002;118:431– 439. 33. Jamora C, Fuchs E. Intercellular adhesion, signalling and the cytoskeleton. Nat Cell Biol. 2002;4:E101–E108. 34. Chien KR, Ross J Jr, Hoshijima M. Calcium and heart failure: the cycle game. Nat Med. 2003;9:508 –509. 35. Jaski BE, Jessup ML, Mancini DM, Cappola TP, Pauly DF, Greenberg B, Borow K, Dittrich H, Zsebo KM, Hajjar RJ. Calcium upregulation by percutaneous administration of gene therapy in cardiac disease (CUPID Trial), a first-in-human phase 1/2 clinical trial. J Card Fail. 2009;15: 171–181. 36. Naga Prasad SV, Esposito G, Mao L, Koch WJ, Rockman HA. Gbetagamma-dependent phosphoinositide 3-kinase activation in hearts with in vivo pressure overload hypertrophy. J Biol Chem. 2000;275: 4693– 4698. 37. Oudit GY, Kassiri Z, Crackower MA, Penninger JM, Backx PH. Loss of PI3 kinase gamma leads to an accelerated progression to dilated cardiomyopathy in response to pressure overload. Circulation. 2004; 108(Suppl):IV-238. Guo et al Downloaded from http://circres.ahajournals.org/ by guest on June 17, 2017 38. DeBosch B, Treskov I, Lupu TS, Weinheimer C, Kovacs A, Courtois M, Muslin AJ. Akt1 is required for physiological cardiac growth. Circulation. 2006;113:2097–2104. 39. Tanji C, Yamamoto H, Yorioka N, Kohno N, Kikuchi K, Kikuchi A. A-kinase anchoring protein AKAP220 binds to glycogen synthase kinase-3beta (GSK-3beta) and mediates protein kinase A-dependent inhibition of GSK-3beta. J Biol Chem. 2002;277:36955–36961. 40. Hardt SE, Sadoshima J. Glycogen synthase kinase-3beta: a novel regulator of cardiac hypertrophy and development. Circ Res. 2002;90: 1055–1063. 41. English JL, Kassiri Z, Koskivirta I, Atkinson SJ, Di Grappa M, Soloway PD, Nagase H, Vuorio E, Murphy G, Khokha R. Individual Timp deficiencies differentially impact pro-MMP-2 activation. J Biol Chem. 2006; 281:10337–10346. 42. Page-McCaw A, Ewald AJ, Werb Z. Matrix metalloproteinases and the regulation of tissue remodelling. Nat Rev Mol Cell Biol. 2007;8:221–233. 43. Stokes DL. Desmosomes from a structural perspective. Curr Opin Cell Biol. 2007;19:565–571. 44. Pon YL, Auersperg N, Wong AS. Gonadotropins regulate N-cadherinmediated human ovarian surface epithelial cell survival at both posttranslational and transcriptional levels through a cyclic AMP/protein kinase A pathway. J Biol Chem. 2005;280:15438 –15448. 45. Kostetskii I, Li J, Xiong Y, Zhou R, Ferrari VA, Patel VV, Molkentin JD, Radice GL. Induced deletion of the N-cadherin gene in the heart leads to dissolution of the intercalated disc structure. Circ Res. 2005;96:346 –354. 46. Ohtake Y, Tojo H, Seiki M. Multifunctional roles of MT1-MMP in myofiber formation and morphostatic maintenance of skeletal muscle. J Cell Sci. 2006;119:3822–3832. 47. Deryugina EI, Ratnikov BI, Postnova TI, Rozanov DV, Strongin AY. Processing of integrin alpha (v) subunit by membrane type 1 matrix metalloproteinase stimulates migration of breast carcinoma cells on vitronectin and enhances tyrosine phosphorylation of focal adhesion kinase. J Biol Chem. 2002;277:9749 –9756. Role of PI3K␥ in Biomechanical Stress 15 48. Ratnikov BI, Rozanov DV, Postnova TI, Baciu PG, Zhang H, DiScipio RG, Chestukhina GG, Smith JW, Deryugina EI, Strongin AY. An alternative processing of integrin alpha(v) subunit in tumor cells by membrane type-1 matrix metalloproteinase. J Biol Chem. 2002;277:7377–7385. 49. Itoh Y, Seiki M. MT1-MMP: a potent modifier of pericellular microenvironment. J Cell Physiol. 2006;206:1– 8. 50. Engelhardt S, Hein L, Wiesmann F, Lohse MJ. Progressive hypertrophy and heart failure in beta1-adrenergic receptor transgenic mice. Proc Natl Acad Sci U S A. 1999;96:7059 –7064. 51. Liggett SB, Tepe NM, Lorenz JN, Canning AM, Jantz TD, Mitarai S, Yatani A, Dorn GW II. Early and delayed consequences of beta(2)adrenergic receptor overexpression in mouse hearts: critical role for expression level. Circulation. 2000;101:1707–1714. 52. Kiriazis H, Sato Y, Kadambi VJ, Schmidt AG, Gerst MJ, Hoit BD, Kranias EG. Hypertrophy and functional alterations in hyperdynamic phospholamban-knockout mouse hearts under chronic aortic stenosis. Cardiovasc Res. 2002;53:372–381. 53. Janczewski AM, Zahid M, Lemster BH, Frye CS, Gibson G, Higuchi Y, Kranias EG, Feldman AM, McTiernan CF. Phospholamban gene ablation improves calcium transients but not cardiac function in a heart failure model. Cardiovasc Res. 2004;62:468 – 480. 54. Triposkiadis F, Karayannis G, Giamouzis G, Skoularigis J, Louridas G, Butler J. The sympathetic nervous system in heart failure physiology, pathophysiology, and clinical implications. J Am Coll Cardiol. 2009;54: 1747–1762. 55. Kloner RA, Hale S, Alker K, Rezkalla S. The effects of acute and chronic cocaine use on the heart. Circulation. 1992;85:407– 419. 56. Gianni M, Dentali F, Grandi AM, Sumner G, Hiralal R, Lonn E. Apical ballooning syndrome or Takotsubo cardiomyopathy: a systematic review. Eur Heart J. 2006;27:1523–1529. 57. Nony P, Boissel JP, Lievre M, Leizorovicz A, Haugh MC, Fareh S, de Breyne B. Evaluation of the effect of phosphodiesterase inhibitors on mortality in chronic heart failure patients. A meta-analysis. Eur J Clin Pharmacol. 1994;46:191–196. Novelty and Significance What Is Known? ● ● Phosphoinositide 3-kinase (PI3K)␥ couples G protein– coupled receptors to downstream signaling pathways. Loss of PI3K␥ enhances cAMP levels and enhances basal myocardial contractility. What New Information Does This Article Contribute? ● ● ● Loss of PI3K␥ enhances susceptibility to biomechanical stress and early-onset heart failure. Activation of matrix metalloproteinase (MMP) and loss of N-cadherin– mediated cell adhesion are critical mediators of this adverse remodeling. -Blocker suppresses cAMP-mediated MMP upregulation and preserves N-cadherin levels with minimization of cardiac systolic dysfunction. Altered PI3K signaling plays a fundamental role in heart disease. Although loss of PI3K␥ enhances myocardial contractility, there is a paradoxical rapid development of heart failure in response to biomechanical stress. The uncoupling between basal hypercontractility and the response to pathological stimulus was driven by adverse remodeling of the extracellular matrix and N-cadherin mediated cell-adhesion. In particular, there was upregulation of the myocardial MMP2 and MT1-MMP axis. Inhibition of MMP prevented the accelerated development of dilated cardiomyopathy in pressure-overloaded PI3K␥KO mice. The molecular trigger of this adverse remodeling is excess cAMP, and -blocker therapy normalizes cAMP levels, suppresses MMP expression, and rescues the early onset of dilated cardiomyopathy in the mutant mice. These findings provide valuable insight into the phenotype of other gene-targeted animal models with elevated Ca2⫹ cycling but an inability to rescue heart failure. Our findings highlight the potential negative impact chronic elevations in cAMP can have on the heart in the setting of heart failure while highlighting a novel mechanism of chronic -blocker therapy in preventing the adverse myocardial remodeling in pressure overload–induced heart failure. Downloaded from http://circres.ahajournals.org/ by guest on June 17, 2017 Loss of PI3Kγ Enhances cAMP-Dependent MMP Remodeling of the Myocardial N-Cadherin Adhesion Complexes and Extracellular Matrix in Response to Early Biomechanical Stress Danny Guo, Zamaneh Kassiri, Ratnadeep Basu, Fung L. Chow, Vijay Kandalam, Federico Damilano, Wenbin Liang, Seigo Izumo, Emilio Hirsch, Josef M. Penninger, Peter H. Backx and Gavin Y. Oudit Circ Res. published online September 16, 2010; Circulation Research is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231 Copyright © 2010 American Heart Association, Inc. All rights reserved. Print ISSN: 0009-7330. Online ISSN: 1524-4571 The online version of this article, along with updated information and services, is located on the World Wide Web at: http://circres.ahajournals.org/content/early/2010/09/16/CIRCRESAHA.110.229054.citation Data Supplement (unedited) at: http://circres.ahajournals.org/content/suppl/2010/09/16/CIRCRESAHA.110.229054.DC1 Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published in Circulation Research can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for which permission is being requested is located, click Request Permissions in the middle column of the Web page under Services. Further information about this process is available in the Permissions and Rights Question and Answer document. Reprints: Information about reprints can be found online at: http://www.lww.com/reprints Subscriptions: Information about subscribing to Circulation Research is online at: http://circres.ahajournals.org//subscriptions/ Guo D et al. Role of PI3Kγ in Biomechanical Stress ONLINE METHODS and DATA SUPPLEMENT Loss of PI3Kγ enhances cAMP-dependent MMP remodeling of the myocardial N-cadherin adhesion complexes and extracellular matrix in response to early biomechanical stress by Danny Guo BSc, Zamaneh Kassiri PhD, Ratnadeep Basu MD, Fung L. Chow MSc, Vijay Kandalam BSc, Federico Damilano MD, Wenbin Liang MSc, MD, Seigo Izumo MD, Emilio Hirsch MD, Josef M. Penninger MD, Peter H. Backx DVM, PhD and Gavin Y. Oudit MD, PhD ONLINE METHODS Experimental Animals. PI3Kgamma knockout (PI3KγKO), PI3Kalpha dominant negative (PI3KαDN), PI3Kgamma kinase dead (PI3KγKD) mice have been previously described.1-3 All experiments were performed in accordance to institutional guidelines and Canadian Council on Animal Care. Mice were backcrossed into a pure C57Bl/6 background for at least 10 generations and only littermate male mice of 8-9 weeks of age were used. For the propranolol experiments, mice were treated with propranolol in their drinking water (0.2 g/L) in order to deliver 15 mg/kg/day; propranolol was withdrawn one day prior to the echocardiographic and hemodynamic measurements. The broad spectrum MMP inhibitor, PD166793 (Pfizer Inc.), was administered orally by daily gavage as previously described.4 Due to the rapid onset of ventricular dilation in PI3KγKO mice following pressure-overload, PD166793 treatment (30 mg/kg/day) began 3 days prior to aorticbanding and continued until mice were sacrificed. Aortic Banding. 8-9 week old male C57Bl/6 WT, PI3KαDN, PI3KγKO and PI3KγKD mice weighing (20–25 g) were used in these experiments. Mice were anesthetized with 1.5 ketamine (100 mg/kg) and xylaxine (10 mg/kg). A topical depilatory agent was applied to the neck and chest area to 1 Guo D et al. Role of PI3Kγ in Biomechanical Stress remove fur at and around the area of incision. The skin was cleaned with Germex and Betadine. One dose of penicillin (10 mg/kg, 0.1 mL i.p.) was administered prior to start of surgery. Mice were placed supine and body temperature was maintained at 37oC with a heating pad. A horizontal skin incision of 1 cm in length was made at the level of second intercostal space, once the animal was in surgical plane of anesthesia (lack of reflex or response to toe-pinching). A 6-0 silk suture was passed under the aortic arch. A bent 26-gauge needle was then placed next to the aortic arch and the suture was snugly tied around the needle and aorta between the left carotid artery and the brachiocephalic trunk. The needle was quickly removed allowing the suture to constrict the aorta. The incision was closed in layers and the mice were allowed to recover on a warming pad until they were fully awake. Immediately after the surgery, mice received one dose of buprenorphine and 5for the first 24 hours. The sham animals underwent the same procedure without the aortic banding. The heart tissues were snap frozen in liquid nitrogen and were kept in -80oC until being used for experiments. Echocardiographic Imaging. Transthoracic M-mode and Doppler echocardiographic examination at 1 wk and 3 wks post-aortic banding were performed using an Acuson® Sequoia C256 system equipped with a 15-MHz linear transducer (15L8) (Version 4.0, Acuson Corporation, Mountain View, California) as previously described.1, 4, 5 Data were stored on the hard drive and 230 MB optical disk for image processing. Mice were placed on a heating pad and a nose cone with 0.75-1% isoflurane in 100% oxygen was applied. The temperature was maintained at 36.5 to 37.5°C. Ultrasound gel was placed on the chest of the anesthetized mouse. The ultrasound probe was placed in contact with the ultrasound gel and scanning was performed over 30 min. The temperature, heart rate (HR) and blood pressure (BP) were constantly monitored during the scanning. M-mode images were obtained for measurements of left ventricular (LV) wall thickness (LVWT), LV end-diastolic 2 Guo D et al. Role of PI3Kγ in Biomechanical Stress diameter (LVEDD), and LV end-systolic diameter (LVESD). M-mode images were used to measure LV chamber sizes and wall thicknesses. Fractional shortening and velocity of circumferential shortening were calculated. For the propanolol experiments in the WT mice, the echocardiographic measurements were made using the Vevo 770 high-resolution imaging system equipped with a 30MHz transducer (RMV-707B; VisualSonics, Toronto, Canada) as we have previously described.6 Isolated Cardiomyocyte Contractility. Ventricular cardiomyocytes were placed in a Plexiglas chamber and continuously perfused with oxygenated Tyrodes buffer (137 mM NaCl, 5.4 mM KCl, 10 mM glucose, 10 mM HEPES, 0.5 mM NaH2PO4, 1 mM MgCl2, 1.2 mM CaCl2, and pH 7.4) at 2.5 mL/min at 36oC. Cardiomyocytes were stimulated at 1 Hz with a Grass S44 stimulator (pulse duration 3 ms; 15-20 V) and a video edge detector (Crescent Electronics) was used to track myocyte contractions. Steady state contractions were recorded at 1 kHz following a 4 min equilibrium period using a Phillips 800 camera system (240 Hz) and Felix acquisition software (Photon Technologies Inc.). Cardiomyocyte length, percent fractional shortening, shortening rate (+dL/dt) and relaxation rate (-dL/dt) were determined at baseline. Isolation and culture of adult cardiomyocytes and fibroblasts. Adult murine left ventricular cardiomyocytes and cardiofibroblasts were isolated and cultured as previously described.7 Briefly, 11week old mice were injected with 0.05 mL of 1000USP/mL heparin for 15 min and then anesthetized using 2% isoflurane (1 L/min oxygen flow rate) provided through a nose cone. After opening the chest cavity, the heart was quickly excised and perfused using a Langendorff system within 45 s. Following 3 min perfusion, the heart was then digested with 2.4 mg/mL collagenase type 2 (Worthington) for 7-8 min. After sufficient digestion, the ventricles were removed, dissociated using forceps and transfer 3 Guo D et al. Role of PI3Kγ in Biomechanical Stress pipettes, and resuspended in stopping buffer (10% FBS perfusion buffer). The isolated cardiomyocytes were then exposed to increasing calcium concentrations (100 µM, 400 µM, and 900 µM) for 15 min each before being plated onto laminin coated culture dishes in plating buffer (Eagle’s MEM with 10% FBS, Sigma) and placed at 37oC in a sterile 2% CO2 incubator. The discarded stopping buffer was set aside for cardiofibroblasts collection. One hour after plating, the plating buffer was gently aspirated and replaced with culture buffer (serum free Eagle’s MEM with 0.1% BSA) and then placed into the incubator for 18 h before treatment. The discarded stopping buffer is centrifuged at 20 g for 3 min and the resulting supernatant was collected in a 15 mL conical tube. This was then centrifuged at 1500 rpm for 5 min and the pellet was collected and washed in 10% FBS DMEM (GIBCO). The solution is once again centrifuged at 1500 rpm for 5 min and the pellet was collected and plated onto a 10 cm culture dish in 10% FBS DMEM. The cardiofibroblasts were then passaged 2 times and put into 24 h serum free DMEM prior to treatment. TaqMan Real-time PCR. RNA expression levels of various genes were determined by TaqMan Real-time PCR as previously described.4, 8 Total RNA was extracted from flash-frozen tissue or cardiofibroblasts using TRIzol extraction protocol, and cDNA was synthesized from 1 μg RNA by using random hexamers. For each gene, a standard curve was generated using known concentrations of cDNA (0.625, 1.25, 2.5, 5, 10 and 20 µg) as a function of cycle threshold (CT). Expression analysis of the reported genes was performed by TaqMan Real-time PCR using ABI 7900 Sequence Detection System. The SDS2.2 software (integral to ABI7900 real-time machine) fits the CT values for the experimental samples and generates values for cDNA levels. All samples were run in triplicates in 384 well plates. 18S rRNA was used as an endogenous control. The primers and probes for mRNA expression analysis by Taqman Real-time PCR are listed in Supplementary Table 1 (see below). 4 Guo D et al. Role of PI3Kγ in Biomechanical Stress Western Blot Analysis and Membrane Fractionation. The phosphorylated and/or total proteins from cultured cells and heart tissues of mice were measured by Western blot analysis as previously described.8, 9 Protein was extracted in 50 mM Tris, 120 mM NaCl, 1 mM EDTA and 1% Triton X-100 (final pH 7.4). After quantification using the BCA Protein Array Kit (Pierce, Rockford, IL, USA), protein samples were separated by 8%-12% SDS-PAGE gel electrophoresis and then transferred to nitrocellulose membrane (Millipore). The membrane was blocked with 5% milk in Tris-Buffered Saline Tween-20 (TBST) for 2 h and then incubated overnight at 4oC with primary antibody against phosphorylated and total ERK1 (44kDA), ERK2 (42kDa), AKT (60kDA), GSK-3α (51kDa), GSK-3β (46kDa) (Cell Signaling), FAK (125kDa) (Santa Cruz and BD Biosciences), PLN (25kDa) (Santa Cruz), and CREB (43kDa) (Cell Signaling). Primary antibodies against N-Cadherin (130kDa), βCatenin (92kDa) (BD Biosciences), MMP2 (72 and 64 kDa) (Millipore), MT1-MMP (60 kDa) (Millipore), MMP9 (92 kDa) (Millipore) and β1D-integrin (116 kDa) (Millipore) antibodies were also used. The anti-α7B-integrin (26-34 kDa) was kindly provided by Dr. Stephen J. Kaufman, University of Illinois, Urbana, Illinois and used as previously described.10 After primary antibody was removed, the membrane was washed 3 times with TBST for 15 min each. The membrane was then incubated with an appropriate horseradish peroxidase (HRP) coupled secondary antibody at a 1:5000 dilution in TBST for 2 h at room temperature, then washed 3 times with TBST for 15 min each. Proteins were detected by enhanced chemiluminescence (GE) using X-ray film (Fuji) and analyzed by the ImageJ software (U.S. National Institutes of Health, Bethesda, MD). For the in vitro analysis of N-cadherin cleavage, 100ng of N-Cadherin Fc Chimera protein (R&D) was incubated with 0, 1, 10, 100 nM of MMP2 (R&D) or MT1-MMP (R&D) (see Online Supp. Fig. II). An additional group of 100 ng of NCadherin Fc Chimera and 100 nM of MMP2 or MT1-MMP was incubated with 10 μM of the MMP 5 Guo D et al. Role of PI3Kγ in Biomechanical Stress inhibitor PD166793. All components were dissolved in 50 mM Tris/HCl pH 7.8, 50 mL CaCl2 and 0.5 M NaCl. The mixture was incubated in 37oC for 4 h and then the proteolysis was stopped with 5X SDS sample buffer. The samples were then immediately separated in a 12% SDS-PAGE gel and blotted with an N-Cadherin specific antibody (Santa Cruz). Membrane fraction was extracted from LV myocardium by homogenized frozen tissue in RIPA buffer (50 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA) with DTT (1 mM), PMSF (1 mM), protease inhibitor (Calbiochem, San Diego, USA) and phosphatase inhibitor cocktails (SigmaAldrich, Oakville, Canada), centrifugation at 2,900g for 20 min. The supernatant containing the cytosolic and membrane proteins was centrifuged at 29,000g for 45 min. This high speed centrifugation separated the cytosolic protein (supernatant) from the membrane protein (pellet). The pellet was resuspended in 50 μL RIPA buffer (containing DTT, PMSF, protease and phosphatase inhibitors, with 0.25% sodium deoxycholate and 1% NP40 and then centrifuged at 15,000 g for 20 min. This supernatant was stored at -80oC as the membrane fraction. Western blot analysis for Ncadherin, β-catenin and MT1-MMP were performed on the membrane fraction using a 10% SDSPAGE gel. The nitrocellulose membrane was then stripped with a mild stripping buffer (62.5 mM Tris-HCl, pH 6.8, 69.4 mM SDS, and 0.7% β-mercaptoethanol; 30 min at 55oC), blocked with 10% skim milk and blotted for Toll-like receptor 4 (TLR4) (1:500 dilution, Santa Cruz, Santa Cruz, USA), and subsequently for caspase 3 (1:3000 dilution, Cell Signaling). The purity of the membrane fraction was confirmed by the presence of the membrane specific protein, TLR4, and the absence of the cytoplasmic protein, caspase 3. Cell Adhesion Assay. The cell adhesion assay was performed in accordance with the protocol provided by CELL BIOLABS, INC. CytoSelect 48-Well Cell Adhesion Assay (ECM Array, 6 Guo D et al. Role of PI3Kγ in Biomechanical Stress Colorimetric Format) as previously described.11 Adult murine cardiomyocytes from sham and 1 wk post-AB hearts were freshly isolated and a hemocytometer was used to determine cell concentration per mL. The concentration was adjusted to 100,000 cells/mL and the cells were plated into each well at 20,000 cells/well. The cells were then placed into a 2% CO2 sterile 37oC incubator for 60 min for cells to adhere. The adherent cells were washed with PBS before 200 µL of the Cell Stain solution was added for 10 min. The cells were then washed 5 times with PBS to remove the staining solution and left to air dry for 10 min. 200 µL of extraction solution was then added to each well and the plate was incubated for 10 min on a rocker. Once the color of the solution stabilized, the 48-well plate was placed in a plate reader and optical density (OD) was recorded at 560 nm. The reported OD values are the raw OD values of samples minus the OD value of a blank. Measurement of cAMP levels. The cAMP assay was performed following the protocol provided with the GE Healthcare Amersham cAMP Biotrak Enzyme immunoassay System. Isolated ventricular cells and LV myocardial tissue were homogenized with the provided lysis reagent and centrifuged to remove debris. The homogenate was placed into the appropriate wells in the 96-well pre-made plate and incubated with antiserum for 2 h at 4oC. After the incubation, cAMP-peroxidase conjugate was pipetted into all the wells except blanks and the plate was then incubated at 4oC for 1 h before the wells were aspirated, washed and dried. Enzyme substrate was then added to each well for 30 min at room temperature before collecting the OD values at 630 nm. The OD values were converted to concentrations using a standard curve prepared from provided standards. The effects of β-adrenergic blockade using propranolol (25 µM) (Sigma) and specific adenylate cyclase inhibition using 2′,5′dideoxyadenosine (DIDA; 30 µM) (Sigma)12 on isoproterenol-induced increase in cAMP were also examined. 7 Guo D et al. Role of PI3Kγ in Biomechanical Stress Confocal Fluorescence Microscopy. Formalin-fixed sections were permeablized with ice-cold methanol for 10 min, blocked with goat serum and incubated with primary antibodies (N-cadherin (rabbit) and β-catenin (mouse), 1:500, Abcam®) overnight at 4oC in a humidified chamber. After several washes, Texas Red-conjugated (for N-cadherin) or FITC-conjugated (for β-catenin) secondary antibodies were added and the sections were incubated for 30 min at room temperature. The sections were evaluated with a Zeiss LSM510 confocal microscope and associated software. References 1. Crackower MA, Oudit GY, Kozieradzki I, Sarao R, Sun H, Sasaki T, Hirsch E, Suzuki A, Shioi T, Irie-Sasaki J, Sah R, Cheng HY, Rybin VO, Lembo G, Fratta L, Oliveira-dosSantos AJ, Benovic JL, Kahn CR, Izumo S, Steinberg SF, Wymann MP, Backx PH, Penninger JM. Regulation of myocardial contractility and cell size by distinct PI3KPTEN signaling pathways. Cell. 2002;110:737-749. 2. Oudit GY, Crackower MA, Eriksson U, Sarao R, Kozieradzki I, Sasaki T, Irie-Sasaki J, Gidrewicz D, Rybin VO, Wada T, Steinberg SF, Backx PH, Penninger JM. Phosphoinositide 3-kinase gamma-deficient mice are protected from isoproterenolinduced heart failure. Circulation. 2003;108:2147-2152. 3. Patrucco E, Notte A, Barberis L, Selvetella G, Maffei A, Brancaccio M, Marengo S, Russo G, Azzolino O, Rybalkin SD, Silengo L, Altruda F, Wetzker R, Wymann MP, Lembo G, Hirsch E. PI3Kgamma modulates the cardiac response to chronic pressure overload by distinct kinase-dependent and -independent effects. Cell. 2004;118:375-387. 4. Kassiri Z, Oudit GY, Sanchez O, Dawood F, Mohammed FF, Nuttall RK, Edwards DR, Liu PP, Backx PH, Khokha R. Combination of tumor necrosis factor-alpha ablation and matrix metalloproteinase inhibition prevents heart failure after pressure overload in tissue inhibitor of metalloproteinase-3 knock-out mice. Circ Res. 2005;97:380-390. 5. Oudit GY, Kassiri Z, Zhou J, Liu QC, Liu PP, Backx PH, Dawood F, Crackower MA, Scholey JW, Penninger JM. Loss of PTEN attenuates the development of pathological 8 Guo D et al. Role of PI3Kγ in Biomechanical Stress hypertrophy and heart failure in response to biomechanical stress. Cardiovasc Res. 2008;78:505-514. 6. Kandalam V, Basu R, Abraham T, Wang X, Soloway PD, Jaworski DM, Oudit GY, Kassiri Z. TIMP2 deficiency accelerates adverse post-myocardial infarction remodeling because of enhanced MT1-MMP activity despite lack of MMP2 activation. Circ Res. 2010;106:796-808. 7. O'Connell TD, Rodrigo MC, Simpson PC. Isolation and culture of adult mouse cardiac myocytes. Methods Mol Biol. 2007;357:271-296. 8. Kassiri Z, Zhong J, Guo D, Basu R, Wang X, Liu PP, Scholey JW, Penninger JM, Oudit GY. Loss of angiotensin-converting enzyme 2 accelerates maladaptive left ventricular remodeling in response to myocardial infarction. Circ Heart Fail. 2009;2:446-455. 9. Zhong JC, Yu XY, Lin QX, Li XH, Huang XZ, Xiao DZ, Lin SG. Enhanced angiotensin converting enzyme 2 regulates the insulin/Akt signalling pathway by blockade of macrophage migration inhibitory factor expression. Br J Pharmacol. 2008;153:66-74. 10. Babbitt CJ, Shai SY, Harpf AE, Pham CG, Ross RS. Modulation of integrins and integrin signaling molecules in the pressure-loaded murine ventricle. Histochem Cell Biol. 2002;118:431-439. 11. Cervera AM, Apostolova N, Crespo FL, Mata M, McCreath KJ. Cells silenced for SDHB expression display characteristic features of the tumor phenotype. Cancer Res. 2008;68:4058-4067. 12. Desaubry L, Shoshani I, Johnson RA. 2',5'-Dideoxyadenosine 3'-polyphosphates are potent inhibitors of adenylyl cyclases. J Biol Chem. 1996;271:2380-2382. 9 Guo D et al. Role of PI3Kγ in Biomechanical Stress SUPPLEMENTAL TABLES Supplemental Table I. Taqman primers and probes TIMP 1 TIMP 2 TIMP3 TIMP 4 MMP-9 MMP-2 MMP13 Forward Primer: Reverse Primer: Probe: Forward Primer: Reverse Primer: Probe: Forward Primer (294): Reverse Primer (427): Probe (376): Reverse primer2 (423): Forward Primer: Reverse Primer: Probe: Forward Primer: Reverse Primer: Probe: Forward Primer: Reverse Primer: Probe: Forward Primer: Reverse Primer: Probe: MMP14 MT1MMP Forward Primer: Reverse Primer: Probe: ANF Forward Primer: Reverse Primer: Probe: Forward Primer: Reverse Primer: Probe: Forward Primer: Reverse Primer: Probe: BNP ß-MHC 5'-CATGGAAAGCCTCTGTGGATATG-3' 5'-AAGCTGCAGGCACTGATGTG-3' 5'-FAM-CTCATCACGGGCCGCCTAAGGAAC-TAMRA-3' 5'-CCAGAAGAAGAGCCTGAACCA-3' 5'-GTCCATCCAGAGGCACTCATC-3' 5'-FAM-ACTCGCTGTCCCATGATCCCTTGC-TAMRA-3' 5'- CCG CAG CGG ACC ACA AC-3' 5'- CCG GAT CAC GAT GTC GGA G-3' 5'- FAM-CTA CCA TGA CTC CCT GGC TT-TAMRA-3' 5'- GGA TCA CGA TGT CGG AGT TGC-3' 5'-TGCAGAGGGAGAGCCTGAA-3' 5'-GGTACATGGCACTGCATAGCA-3' 5'-FAM-CCACCAGAACTGTGGCTGCCAAATC-TAMRA3' 5’-CGAACTTCGACACTGACAAGAAGT -3’ 5’- GCACGCTGGAATGATCTAAGC-3’ 5’-TCTGTCCAGACCAAGGGTACAGCCTGTTC -3’ 5’-AACTACGATGATGACCGGAAGTG -3’ 5’-TGGCATGGCCGAACTCA -3’ 5’-TCTGTCCTGACCAAGGATATAGCCTATTCCTCG -3’ 5’-GGGCTCTGAATGGTTATGACATTC -3’ 5’-AGCGCTCAGTCTCTTCACCTCTT -3’ 5’-AAGGTTATCCCAGAAAAATATCTGACCTGGGATTC -3’ 5’- AGGAGACAGAGGTGATCATCATTG -3’ 5’- GTCCCATGGCGTCTGAAGA -3’ 5’-FAM- CCTGCCGGTACTACTGCTGCTCCTG-TAMRA 3’ 5'-GGA GGA GAA GAT GCC GGT AGA-3' 5'-GCT TCC TCA GTC TGC TCA CTC A-3' 5'-TGA GGT CAT GCC CCC GCA GG-3' 5'-CTG CTG GAG CTG ATA AGA GA-3' 5'-TGC CCA AAG CAG CTT GAG AT-3' 5'-FAM-CTC AAG GCA GCA CCC TCC GGG-TAMRA-3' 5'-GTGCCAAGGGCCTGAATGAG-3' 5'-GCAAAGGCTCCAGGTCTGA-3' 5'-ATCTTGTGCTACCCAGCTCTAA-3' 10 Guo D et al. Role of PI3Kγ in Biomechanical Stress Supplemental Table II. Echocardiographic, hemodynamic and morphometric parameters following aortic banding N HR (bpm) PWT (mm) LVEDD (mm) LVESD (mm) FS (%) VCFc (circ/s) +dP/dtmax (mmHg/s) -dP/dtmin (mmHg/s) LVEDP (mmHg) LVW/BW (mg/g) HW/BW (mg/g) WT+ SHAM PI3KγKO+ SHAM 8 554±14 0.68±0.06 3.81±0.11 1.71±0.09 55.1±1.8 10.8±0.32 10131±301 8 549±12 0.67±0.05 3.79±0.12 1.52±0.1* 59.9±1.9* 12.94±0.4* 12893±276* WT+AB 1wk post-AB 10 561±14 0.74±0.09 3.78±0.14 1.69±0.16 55.3±2.5 10.9±0.38 9935±378 PI3KγKO+AB 1 wk post-AB 10 548±15 0.73±0.11 4.41±0.2* 2.63±0.18* 40.3±2.8* 7.48±0.31* 7138±330* WT+AB 3 wks post-AB 10 539±16 0.86±0.12# 3.65±0.17 1.69±0.21 53.8±3.1 10.9±0.45 9984±423 PI3KγKO+AB 3 wks post-AB 10 568±17 0.84±0.14# 5.53±0.23* 4.58±0.19* 17.2±4.2* 4.52±0361* 5012±359* 9945±252 12671±311 9471±283 6902±363* 6145±369 4875±408* 5.23±1.96 3.75±0.13 4.9±0.15 6.56±2.7 3.71±0.17 4.88±0.15 7.71±2.8 4.17±0.21 5.21±0.23 12.8±2.2* 4.22±0.24 5.28±0.27 9.23±4.1 5.63±0.22# 6.27±0.41# 19.3±3.9* 5.69±0.29# 6.31±0.38# AB, aortic banded; SHAM, sham-operated; HR, heart rate; PWT, posterior left ventricular wall thickness; LVEDD, left ventricular end diastolic diameter; LVESD, left ventricular end systolic diameter; FS, fractional shortening; VCFc, velocity of circumferential shortening corrected for heart rate; +dP/dtmax, maximum first derivative of the change in left ventricular pressure; and -dP/dtmin, minimum first derivative of the change in left ventricular pressure; LVEDP, left ventricular end-diastolic pressure. *p<0.05 compared with the corresponding WT+AB group; #p<0.05 compared with corresponding SHAM group. 11 Guo D et al. Role of PI3Kγ in Biomechanical Stress SUPPLEMENTAL FIGURES Online Figure I Online Supplemental Figure I. The purity of protein fractionation was confirmed using western blot for caspace-3 (a membrane bound protein) and toll-like receptor 4 (a cytosolic protein). Caspace-3 protein was only found in the cytosolic fraction and not the membrane fraction whereas toll-like receptor 4 protein was present in the membrane fraction but not in the cytosolic fraction. 12 Guo D et al. Role of PI3Kγ in Biomechanical Stress Online Figure II Online Supplemental Figure II. II MMP2, MMP2 but not MT1-MMP, MT1 MMP cleaves human recombinant N-cadherin Fc Chimera. N-cadherin Fc Chimera (NCAD, 100 ng) was incubated with 3 different concentrations of human recombinant MMP2 or MT1-MMP and the MMP inhibitor (MMPi, PD166793 (10 μM)) for 4 hours at 37oC. Western blotting detected bands at 65, 60, and 40kDa representing fragments of the N-cadherin Fc Chimera. 13 Guo D et al. Role of PI3Kγ in Biomechanical Stress Online Figure III Online Supplemental Figure III. Western blot analysis of MMP9 protein levels showing an increase in the PI3KγKO hearts at 3 weeks after AB but not at 1 week after AB whereas WT hearts showed no changes in MMP9 protein levels. n=4 for all groups. *p<0.05 compared with sham and 1 week AB groups. 14 Guo D et al. Role of PI3Kγ in Biomechanical Stress Online Figure IV Online Supplemental Figure IV. Western blot analysis of membrane β1D and α7B integrin protein showing increased levels in WT hearts at 1 and 3 weeks after AB. Both integrins increased in the PI3Kγ-KO at 3 weeks after AB. n=4 for all groups. *p<0.05 compared with corresponding sham group; #p<0.05 compared with the PI3Kγ-KO group. 15 Guo D et al. Role of PI3Kγ in Biomechanical Stress Online Figure V Online Supplemental Figure V. V Echocardiography shows that 9 weeks of AB in WT mice induces LV systolic dysfunction characterized by a reduction in percentage of fractional shortening (A) and an increase in left ventricular end diastolic diameter (LVEDD) (B). These changes are reversed with a daily intake of the beta-blocker, propranolol (15 mg/kg/day) (A-B). *p<0.05 compared with all other groups. 16