Download A daunting task: manipulating leukocyte function with RNAi

Dan Peer
A daunting task: manipulating
leukocyte function with RNAi
Author’s address
Dan Peer1,2
1
Laboratory of NanoMedicine, Department of Cell
Research and Immunology, George S. Wise Faculty of Life
Science, Tel Aviv, Israel.
2
Center for Nanoscience and Nanotechnology, Tel Aviv
University, Tel Aviv, Israel.
Summary: RNA interference (RNAi) has advanced into clinical trials. In
spite of the progress made in systemic RNAi delivery to the liver and
solid tumors, delivery of RNAi to leukocytes remains challenging and
less advanced. Manipulating leukocyte function with RNAi holds great
promise for streamlining the drug discovery process by facilitating
in vivo drug target validation and for facilitating the development of
RNAi-based therapy platforms for leukocyte-implicated diseases, such
as blood cancer, inflammation, and leukocyte-tropic viral infections. In
this review, progress in delivery strategies of RNAi payloads to leukocytes, which are notoriously difficult cells to transduce with RNAi, is
discussed with special emphasis on the challenges and potential opportunities for manipulating leukocyte function with RNAi.
Correspondence to:
Dan Peer
Tel Aviv University, Cell Research & Immunology
Laboratory of NanoMedicine
George S. Wise Faculty of Life Science
Britannia Building, room 226
Tel Aviv 69978, Israel
Tel.: +972 3640 7925
Fax: +972 3640 5926
e-mail: [email protected]
Acknowledgements
Dan Peer thanks Ms. Varda Wexler for her help with the
graphics and illustrations and the Peer laboratory members
for helpful discussions. This work was supported in part
by grants from the Lewis Family Trust, Israel Science
Foundation (Award #181/10), the Kenneth Rainin
Foundation, the Israeli Centers of Research Excellence (ICORE), Gene Regulation in Complex Human Disease,
Center No 41/11, the FTA: Nanomedicine for
Personalized Theranostics, and by The Leona M. and Harry
B. Helmsley Nanotechnology Research Fund awarded to D.
P. The author has no conflicts of interest to declare.
This article is part of a series of reviews
covering RNA Regulation of the Immune
System appearing in Volume 253 of
Immunological Reviews.
Immunological Reviews 2013
Vol. 253: 185–197
Printed in Singapore. All rights reserved
© 2013 John Wiley & Sons A/S. Published by Blackwell Publishing
Ltd
Immunological Reviews
0105-2896
Keywords: RNAi, leukocytes, integrins, nanoparticles, liposomes
Introduction
RNA interference (RNAi) is a natural cellular mechanism for
small RNA-guided posttranscriptional suppression of gene
expression that is conserved in a wide range of organisms.
The endogenous small RNAs responsible for gene regulation
are processed to approximately 19–23 nucleotides imperfectly
paired, double-stranded RNAs with two unpaired nucleotides
at their 5′-phosphorylated ends and unphosphorylated 3′-ends
(1–3). RNAi can be activated also exogenously by expressing
short hairpin RNAs (shRNA) using viral vectors that are processed in the cell into small RNAs that mimic the endogenous
gene-silencing RNAs or by introducing synthetic small interfering RNAs (siRNAs) directly into the cell cytoplasm (4–6).
In the cytoplasm, siRNAs are incorporated into the endogenous machinery responsible for gene silencing, the RNAinduced silencing complex (RISC), which removes one strand.
The remaining antisense RNA strand then guides the RISC to
bind, cleave, and block translation of mRNAs bearing complementary sequences (5, 6). Since the target mRNA is destroyed
and the antisense strand is protected from degradation within
the RISC, the same RNA template can be used repeatedly to
eliminate many transcripts. Indeed, gene knockdown occurs
with picomolar concentrations of RNA and can last for several
© 2013 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd
Immunological Reviews 253/2013
185
Peer Manipulating leukocyte function with RNAi
days in dividing cells, where it is diluted with each cell division, and for several weeks in non-dividing cells, even in vivo
(7–9).
Soon after RNAi was found in mammals (1), synthetic
siRNAs were shown to treat disease in mice (10). Small
RNAs were quickly proclaimed as the ‘next new class of
drugs’. Eagerness sprinted high because of the potential of
these molecules to knockdown any gene of interest to treat
almost any disease by targeting otherwise ‘undruggable’
targets, such as molecules without ligand-binding domains
or enzymatic function.
Although initially gene knockdown was thought to be
perfectly specific for the target gene, it soon became clear
that off-target effects were predominant via suppression of
genes harboring non-identical but homologous sequences
(such as in the case of endogenous microRNAs) and by recognition of the innate immune RNA sensors that can initiate
interferon and cytokine secretion and activate complement
and coagulation cascades. Indeed, some of the early demonstrations of RNAi therapeutic effects in small animals may
have been due to off-target effects (11, 12). However,
chemical modifications of the RNA molecule can largely
eliminate off-target effects without compromising target
gene knockdown.
Silencing of gene expression in vitro is a great tool for
functional and validation studies (13, 14). Nevertheless,
understanding gene expression in a disease model by validating specific genes’ role in vivo along with the potential to
induce therapeutic gene silencing opens new avenues for
utilizing RNAi as a novel therapeutic modality and brings
the era of personalized medicine a step further from a vision
to a potential reality.
Introducing RNAi in medicine is achieved by designing
specific RNAi molecules such as miRNA mimics and siRNAs.
RNAi-induced gene silencing mirrors the inhibitory effects
of conventional pharmaceuticals, primarily protein-based
drugs such as antibodies and vaccines and small molecules,
which mainly block their targets’ function. However, some
disease-related molecules do not have enzymatic function or
have a conformation that is not accessible to conventional
drugs or small molecule compounds, and hence, these
molecules are considered ‘non-druggable’ targets. Nondruggable molecules have been successfully targeted by
RNAi approaches in vivo (15–19), demonstrating an exclusively allele-specific gene silencing (20, 21). In addition,
blocking the target’s gene expression rather than its activity
is more efficient, as single mRNA molecule translates multiple copies of protein. Another advantage of RNAi over
conventional pharmaceuticals is the ease of synthesis and
production of potent regulators. As opposed to proteinbased drugs, RNAi synthesis does not necessitate cellular
expression systems or refolding steps. As for small molecule-based drugs, the major disadvantage is the slow and
difficult process for identification and optimization (22),
whereas the identification of functional and specific RNAi
constructs is rapid and involves well-demonstrated strategies
and algorithms that facilitate their optimization.
Although most proteins and some small molecule-based
drugs do not require intracellular access to obtain therapeutic
function, RNAi-based therapeutics necessitates intracellular
delivery, an additional challenging task for the development
of a new efficient RNAi-based therapeutic.
Despite the promise, developing RNAi for therapeutics
has proven challenging. Like most drug development, there
is no rapid solution, and many pharmaceutical companies
that invested considerable sums in developing RNA-based
drugs have discontinued their investigations.
Although many of the hurdles in developing RNAi-based
therapeutics have been already addressed, the main challenge is figuring out the way of delivering small RNAs into
cells in a therapeutically relevant manner with minimal
adverse effects. Small RNAs being considered therapeutic
drugs include not only siRNAs but also mimics of endogenous microRNAs for suppressing the expression of many
genes. The delivery hurdle that needs to be solved for
administering siRNAs and imperfectly paired microRNA
mimics is essentially the same, although antagonizing
endogenous microRNAs using single-stranded antisense oligonucleotides may be somewhat simpler. When injected
intravenously, RNAi molecules are rapidly cleared by renal
filtration and are susceptible to degradation by extracellular
RNases. The RNAi half-life can be increased substantially by
chemical modifications to eliminate susceptibility to endogenous exonucleases and endonucleases and by incorporating
the RNA into a larger moiety, above the molecular weight
cutoff for kidney filtration. However, entering the cell is still
the biggest hurdle. Because of their large molecular weight
(approximately 13.5 kDa), net negative charge, and hydrophilicity, naked RNAi molecules do not cross the plasma
membrane (5, 11). Although cells can endocytose many
types of modified RNAs, another important bottleneck is
getting the RNA efficiently out of the endosomes into the
cytosol where the RNAi machinery resides. It has been
shown that the amount of siRNAs that can be bursting from
the endosomes when lipid-based nanoparticles are used as
delivery system is enormously small (1–2%), making this
186
© 2013 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd
Immunological Reviews 253/2013
Peer Manipulating leukocyte function with RNAi
process ineffective (23). In addition, unless modified, siRNAs are recognized by Toll-like receptors (TLRs) (11, 24)
and other cellular soluble protein sensors such as MDA5 and
RIG-I (25), which activate cellular cascades that stimulate
the immune system and cause a global suppression effect on
gene expression, generating off-target effects, and causing
misinterpretation of the gene expression analysis (14). Many
excellent reviews have been published (5, 6, 14, 26, 27)
describing these challenges and the use of different strategies
to overcome some of these hurdles using innovative nanotechnology and protein engineering. In spite of the progress
in systemic RNAi delivery to the liver and solid tumors, systemic delivery of RNAi to leukocytes remains challenging.
Delivery of RNAi molecules to leukocytes holds great promise
for streamlining drug discovery by facilitating in vivo drug target
validation and for facilitating the development of an RNAibased therapy platform for leukocyte-implicated diseases such
as inflammation, blood cancers such as leukemia, lymphoma,
and myeloma, and leukocyte-tropic viral infections such as
human immunodeficiency virus (HIV), ebola, and dengue
(14, 28–30). In this review, progress in the delivery of RNAi
molecules to leukocytes, which are notoriously difficult to
transduce with RNAi, is described. Focus is given to various
strategies that have been developed, among them several of the
strategies developed by our group to efficiently deliver and
transduce subsets of leukocytes for various applications. Special
emphasis is made on the challenges and potential opportunities
to manipulate leukocyte function with RNAi.
A
B
C
D
E
F
G
H
Multiple strategies for RNAi delivery into leukocytes
Fig. 1. RNAi delivery strategies available for leukocytes. (A) siRNA
encapsulated in PEGylated polysome nanoparticles with ligand
molecules attached to the PEG; (B) a complex of siRNAs with the
peptide transduction domain–dsRNA-binding domain (PTD-DRBD)
fusion protein; (C) siRNA synthetically linked to an aptamer; (D)
siRNA synthetically conjugated to a CpG oligonucleotide; (E) an
atelocollagen–siRNA complex; (F) the 9 arginine (9R) strategy is
shown with either an integrin-targeted and stabilized nanoparticle
(I-tsNP)-entrapping siRNA (G), a single-chain variable fragment
(scFv)-protamine fusion protein loaded with siRNAs (H), or with a
ligand (data not shown).
Leukocytes and hematopoietic cancer cells are among the
most challenging targets for RNAi delivery, as these cells are
highly resistant to conventional transfection reagents and are
dispersed in the body, making it challenging to achieve the
successful localization of RNAi molecules (be it single- or
double-stranded RNA) to the target cells or to deliver these
molecules passively via systemic administration (30, 31).
Therefore, active-targeted delivery systems are being developed, in which specific antibodies, ligands, and ligand mimetics are used to mediate the targeting and internalization
of the RNAi payloads into cells (Fig. 1). Some of these strategies have been shown to deliver siRNAs into leukocytes
in vitro, including PEGylated nanoscale liposomes decorated
with ligands that bind to receptors expressed on leukocytes
(Fig. 1A). In addition, Huang and King (32) described a
P-selectin-coated nanoscale-liposome system that entrapped
siRNAs. Their work has shown that these P-selectin-, PEG-
coated nanoscale liposomes could be absorbed onto the
inner surface of microrenathane tubing. The coated surface
could specifically capture targeted cells from physiological
shear flow, efficiently deliver encapsulated siRNA into
adherent cells, and effectively silence the target gene
neutrophil elastase. With this approach, the investigators
created a highly localized concentration for RNAi delivery in
the circulatory system, providing circulating target cells
© 2013 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd
Immunological Reviews 253/2013
187
Peer Manipulating leukocyte function with RNAi
adequate time to interact with the therapeutic payloads.
Another efficient delivery strategy makes use of the peptide
transduction domain–double-stranded RNA-binding domain
(PTD-DRBD) fusion protein (Fig. 1B). In this approach, the
DRBD binds to the siRNAs, thus masking the negative
charge of the molecules, whereas the PTD mediates the cellular uptake of the complex (33). Moreover, siRNAs can
also be delivered into leukocytes via conjugation to RNA aptamers that bind to specific target molecules, such as glycoprotein 120 (34, 35), without interfering with the binding
of the siRNAs to Dicer (Fig. 1C). In addition to these strategies, other approaches have also been demonstrated for
delivering RNAi into leukocytes and are discussed below.
CpG-conjugated siRNA
Unmethylated CpG oligonucleotides (Fig. 1D) internalize
efficiently into dendritic cells, myeloid cells, and B-lymphocytes following binding to TLR9. In a study by Kortylewski
et al. (36), CpG oligonucleotides were conjugated to an siRNA targeting the immune suppressor gene STAT3. This conjugate was demonstrated to silence Stat3 in mice, leading to
the activation of tumor-associated dendritic cells, macrophages, and B-lymphocytes that mediate potent antitumor
immune responses, and resulting in tumor cell apoptosis.
However, the siRNA in this study was unmodified, and thus
its half-life was reduced and its therapeutic effect limited.
Atelocollagen-complexed siRNA
Atelocollagen is a type I collagen from calf dermis that does
not cause antigenicity or toxicity in animals as a result of
pepsin digestion of the antigenic telopeptides. The positively
charged lysine and hydroxylysine residues, which are rich in
collagen, are thought to mediate the formation of the atelocollagen–siRNA complex. Ishimoto et al. (37) demonstrated
that when siRNAs were administrated intravenously with atelocollagen (Fig. 1E), the incorporation of the siRNAs into
murine macrophages, monocytes, and fibroblasts was facilitated, without causing adverse effects such as the induction
of type I interferon or liver and renal damage.
Cationic nona-D-arginine peptide fused to antibody
fragments and complexed to siRNAs
(Fig. 1F). This study demonstrated the ability of an RNAibased therapy to control and suppress HIV replication, without inducing toxicity in target cells. In another study (39),
the 9R peptide fused to a dendritic cell-targeting 12-mer peptide delivered siRNAs targeting tumor necrosis factor-a (TNF-a)
effectively in vivo, to suppress the production of TNF- a by
dendritic cells upon induction in mice. Kim et al. (40)
reported that TNF-a -targeted siRNAs, delivered to macrophages in vivo using a 9R peptide fused to the ACh receptorbinding peptide, reduced lipopolysaccharide (LPS)-induced
TNF-a levels in the blood and brains of injected mice and led
to a significant reduction in neuronal apoptosis. This strategy
was used for delivering siRNAs against targets in the brain
(41) using the Rabies’ peptide RVG, but strategies for delivering RNAi into the brain are beyond the scope of this review.
Antibody–protamine fusion proteins as RNAi delivery
vectors to leukocytes
The Lieberman laboratory (7) devised one of the first strategies utilizing a receptor-mediated approach to deliver siRNAs directly into specific cell types in 2005. By fusing Fab
antibody fragment (F105) against HIV-1 envelope (gp160)
to human truncated protamine, a protein that nucleates
DNA in the sperm, Song et al. (7) designed antibody–protamine fusion protein (Fig. 1H) for systemically delivering a
mixture of anti-oncogenic siRNAs into mice grafted with
gp160-expressing B16 melanoma cells. The fusion protein
complexed siRNAs and selectively targeted gp160-expressing
B16 cells and suppressed tumor growth (7). This strategy
was used later on by us to develop a strategy for targeting
activated leukocytes, as discussed below (42).
Despite the promising results obtained from these RNAi
delivery strategies, the whole spectrum of hematopoietic
cells, including subsets of leukocytes, has not been fully
addressed. In addition, the low payload delivered with these
strategies might undermine their potential clinical efficacy.
To circumvent these problems for delivering RNAi payloads
to leukocytes, we have utilized leukocyte cell-specific integrins and have developed integrin-targeted stabilized nanoparticles (8) (Fig. 1G).
Integrins as receptor targets for RNAi delivery
Kumar et al. (38) described a single-chain variable fragment
(scFv) form of anti-CD7, a T-cell-specific receptor that was
modified with cysteine at its C-terminus to enable its conjugation to the cationic nona-D-arginine (9R) peptide for selective
targeted delivery of siRNAs payloads into mouse T cells in vivo
Integrins are the largest family of cell adhesion molecules
that mediate cell–cell and cell–matrix interactions across a
wide range of normal physiological and pathophysiological
setting (43, 44). Integrins are a/b heterodimeric cell surface proteins; 15 a-subunits and 8 b-subunits have been
188
© 2013 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd
Immunological Reviews 253/2013
Peer Manipulating leukocyte function with RNAi
identified in vertebrates, forming at least 24 distinct a/b
heterodimers. The b2 and b7 integrins are exclusively
expressed on the leukocyte surface. Integrins on leukocytes
mediate the adhesive interactions critical for cell migration
to sites of inflammation. Antibodies to integrins on leukocytes have been used to inhibit inflammatory reactions in
the clinical setting. Two humanized antibodies, efalizumab
(RaptivaTM) and natalizumab (TysabriTM), have been FDA
approved for the treatment of autoimmune diseases (45,
46). In this way, antibodies ‘targeting’ leukocyte integrins
have been used to interfere with the adhesive interactions
of leukocytes for the treatment inflammatory disorders. To
extend the utility of leukocyte integrin targeting across a
broad range of leukocyte-implicated diseases (such as
inflammation, allergy, blood cancers, and viral infection),
we developed a strategy for targeting leukocytes via integrins expressed on hematological cells for siRNA delivery
(42). This concept is supported by a number of lines of
evidence. (i) Exclusive expression: a subset of integrins
(i.e. b2 and b7 integrins) is exclusively expressed on leukocytes (47–49) enabling the selective targeting of hematopoietic cells. (ii) Efficient receptor internalization:
integrins are constitutively internalized and recycled in
leukocytes. Integrin recycling supports internalization of
bound antibodies and peptides (50, 51), a prerequisite
for activating RNAi pathway with siRNAs. (iii) Integrins
undergo substantial activation-dependent conformational
changes. Of the major classes of adhesion receptors,
including the immunoglobulin domain superfamily (IgSF),
the cadherins, and other transmembrane adhesion receptors (e.g. claudins and occludins), integrins are unique in
achieving rapid and reversible upregulation from a basal,
inactive state to a maximally adhesive state upon cell
stimulation (43, 52, 53). Other adhesion receptors require
in-membrane diffusion (both active and passive) and/or
regulation of cell surface expression levels to modulate
the magnitude of adhesion. The dramatic increase in affinity is obtained by a series of conformational changes that
increase the affinity of the integrin for ligand and
enhance the accessibility of the ligand-binding site (47,
54) (Fig. 2).
The aberrant affinity modulation of integrins has been
demonstrated in a variety of leukocyte-associated diseases.
Targeting the high-affinity form of integrins is expected to
enable selective RNAi delivery for aberrantly activated leukocytes. By leaving naive cells unaffected, selective targeting
would be advantageous in reducing iatrogenic immune
defects.
© 2013 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd
Immunological Reviews 253/2013
Fig. 2. Model for global conformational changes of the extracellular
portion of integrin LFA-1 (aLb2). (Left side) Bent, low-affinity
conformation; (Right side) Extended conformation with open
headpiece and open high-affinity I domain, the ligand-binding domain
(labeled with green). This figure is modified from (124).
Using leukocyte function-associated antigen-1 (LFA-1)
antibody–protamine fusion protein (Fig. 1H) that complexes
siRNAs via positively charged protamine moiety and direct
the siRNAs-fusion protein complex to the target, we have
shown that integrins can be used for siRNA delivery to activated leukocytes (42) using an activation-dependent conformational monoclonal antibody, AL-57(55), that was
converted into a scFv and fused to protamine. A strategy to
target only activated leukocytes holds great promise for specific in vivo gene silencing while avoiding delivery to resting
leukocytes and thus potentially can mitigate the risk of offtarget effects in general and global immunosuppression in
particular.
A potential drawback of the antibody–protamine fusion
protein approach is a low payload (5 siRNA molecules per
delivery carrier) that could undermine its clinical usefulness
(7, 42). In addition, each fusion protein needs to be prepared with the use of laborious molecular biology techniques, protein engineering, and purification methods.
Thus, to increase the amount of payloads and achieve robust
targeted gene silencing in leukocytes in vivo, we have devised
a strategy based on lipid nanoparticles that were surface
modified with an anti-integrin monoclonal antibody, termed
integrin-targeted and stabilized nanoparticles (I-tsNP) (8)
(Figs 1G and 3).
I-tsNPs as leukocyte-specific vehicles
I-tsNPs are prepared from neutral lipids and extruded to
about 85 nm in diameter to become unilamellar vesicles
(8, 56, 57). These lipid nanoparticles (LNPs) are then
surface modified with the glycosaminoglycan hyaluronan
189
Peer Manipulating leukocyte function with RNAi
Fig. 3. A schematic illustration of the processes involved in generating I-tsNP. Multilamellar vesicle (MLV) is extruded to form a unilamellar
vesicle (ULV) with a diameter of approximately 85 nm. Hyaluronan is covalently attached to ULV. An antibody to the integrin is covalently
attached to hyaluronan, generating I-tsNP. siRNAs are encapsulated by rehydrating lyophilized b7 I-tsNP siRNAs. This figure is modified from (8).
(HA) (Fig. 3). As cationic lipids and polymers that form lipoplex and polyplex are non-natural and cause multilines of
toxic effects (including cytokine induction, interferon
response, and liver toxicities) (58–60), the use of a neutral
lipid to form LNPs, which will not elevate cytokines, provoke a type I interferon response, activate lymphocytes, or
trigger liver enzyme release provides a safer system. In addition, as I-tsNPs are small unilamellar lipid-based vesicles,
which posses a defined size, they are easy to downsize by
extrusion and provide a reproducible nanoscale system compared with lipoplex and polyplex that self-assemble with the
RNAi payload.
Coating the LNPs with high molecular weight (HMw) HA
endows the carriers with several key advantages. HMw HA
is a built-in cryoprotectant that stabilizes the particles during
a cycle of lyophilization and rehydration by exchanging
hydrogen bonds with water molecules during the lyophilization process (61) and in the circulation when they are
administrated intravenously (62–64). HMw HA do not trigger a type I interferon response or cytokine induction and
do not activate complement when bound on the surface of
LNPs (65). HA also serves as a scaffold for antibody attachment to endow the LNPs’ targeting capabilities (8, 57).
Anti-b7 integrin monoclonal antibodies were attached to the
HMw HA-coated LNPs. This basically created a platform
technology, as one can easily change the monoclonal antibody on the surface of these HA-coated LNPs, and thus it is
possible to direct the LNPs and their payloads into subsets
of leukocytes, as detailed below.
The siRNAs were encapsulated within the I-tsNP upon
rehydration of lyophilized particles with deionized water
containing protamine-condensed siRNAs, achieving approximately 80% encapsulation efficacy as well as a payload of
approximately 4000 siRNA molecules per particle. The
siRNAs entrapped in the I-tsNP were protected from degradation and demonstrated effective silencing even after
190
pre-incubation with RNAse A or 50% serum for 2 h prior
to the transfection of cells (8). Furthermore, I-tsNP encapsulating siRNA did not induce interferon responses, trigger
cytokine induction, or activate lymphocytes in human
peripheral blood mononuclear cells (PBMCs) (8). A single
intravenous administration of 2.5 mg/kg Ku70-siRNAs, a
DNA repair protein that ubiquitously expressed in all cells,
served as a model target, induced approximately 80% reduction of protein expression levels in lymphocytes from the
lamina propria, Peyer’s Patch, mesenteric lymph nodes, and
spleen. Silencing of Ku70 was not observed in gut mononuclear leukocytes driven from b7-integrin knockout mice
identically treated, demonstrating the high specificity of the
targeting strategy. Ku70 was used as a surrogating marker
for validating the I-tsNP as a delivery system for siRNA in
gut leukocytes. Using this strategy, we validated the role of
cyclin D1 in leukocytes during inflammatory bowel disease
(IBD).
Manipulating leukocyte function with RNAi: Cyclin D1
as a test case
Cyclin D1 (CyD1) is part of the cyclin proteins family,
which function as the regulatory subunits of cyclin/cyclindependent kinase (CDK) holoenzymes that regulates entry
into and progression through the cell cycle (66–69). CyD1
expression is induced upon stimulation by growth factors,
amino acids, hormones, and several oncogenes such as Ras,
Src, ErbB2, and SV40 T antigen (66–70). Its binding partners are CDK4 and CDK6, and activated CyD1/CDK4 and
CyD1/CDK6 complex phosphorylate the retinoblastoma protein to induce the expression of target genes essential for Sphase entry, resulting in facilitation of the progression from
G1 to S phase (66, 70). CyD1 is also known to modulate
local chromatin structure and transcription of genes involved
in proliferation and differentiation through CDK-independent association with histone acetylases (e.g. CBP, P/CAF)
© 2013 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd
Immunological Reviews 253/2013
Peer Manipulating leukocyte function with RNAi
and deacetylases (69, 71). Amplification or overexpression
of CyD1 is important in the development of many cancers
including breast, prostate, colon parathyroid adenoma, lymphoma, and melanoma (13, 67, 69, 71–73).
To suppress aberrant proliferation of leukocytes in inflammation, treatment with b7 I-tsNP-entrapped CyD1-siRNA
reduced CyD1 mRNA expression in stimulated splenocytes,
leading to potent suppression of proliferation both in vitro
and in vivo upon intravenous administration of CyD1-siRNA
(2.5 mg/kg) entrapped in b7 I-tsNP (8). Surprisingly, CyD1
knockdown blocked not only the proliferation but also the
agonist-enhanced expression of T-helper 1 (Th1) cytokines
interferon-c (IFN-c) , interleukin-2 (IL-2), IL-12, and TNFa, but not alter those of the Th2 cytokines IL-4 and IL-10.
This specific inhibition in cytokine expression was not
observed with other D-type cyclin family members (cyclin
D2 or cyclin D3 knockdown) (8).
To further understand if this observation is cell cycledependent process, cells were treated with aphidicolin,
which blocks the cell cycle. Phorbol myristate acetate
(PMA)/ionomycin treatment caused upregulation of CyD1
as well as Th1 and Th2 cytokines. CyD1 knockdown
selectively suppressed Th1 cytokines in aphidicolin-treated
and PMA/ionomycin-activated cells. This cell cycle-independent suppression of Th1 cytokines was also observed
with the individual application of four different CyD1-siRNAs that targeted non-overlapping sequences in CyD1
mRNA (8), thereby ruling out the possibility that the
blockade of Th1 cytokines was due to an off-target effect.
Thus, CyD1 knockdown could preferentially suppress proinflammatory Th1 cytokine expression independently of
any changes in the cell cycle. To validate the anti-inflammatory effects by CyD1 blockade in vivo, we injected ItsNP-entrapped CyD1-siRNA (2.5 mg/kg) into mice with
dextran sulfate sodium-induced colitis. I-tsNP-delivered
CyD1-siRNA potently reduced CyD1 mRNA as well as
TNF-a and IL-12 mRNA levels comparable with that of
the uninflamed gut. Remarkably, I-tsNP-delivered CyD1siRNA led not only to a drastic reduction in intestinal tissue damage but also to a potent suppression of leukocyte
infiltration into the colon. CyD1-siRNAs entrapped in isotype control particles (IgG-sNP) did not induce silencing
in the gut. These data have convincingly demonstrated
that entrapment of condensed siRNAs inside these nanoparticles, in tandem with the targeting of the leukocyte
integrin, which readily internalizes bound particles,
enabled both highly efficient intracellular delivery and
gene silencing in vivo in hematopoietic cells.
© 2013 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd
Immunological Reviews 253/2013
In a recent study (13), we continued to explore the use
of RNAi against CyD1 as a potential therapeutic target for
blood cancers such as mantle cell lymphoma (MCL).
MCL is an incurable B-cell non-Hodgkin’s lymphoma,
characterized by the t (11, 14) (q13;q32) translocation
that juxtaposes the proto-oncogene CCND1, which encodes
CyD1, downstream of the immunoglobulin heavy chain
gene promoter. This leads to overexpression of CyD1,
which is not expressed in normal B cells (74). CyD1 functions as an important regulator of the cell cycle G1-S transition. Complexes of CyD1 and CDK4 or CDK6
phosphorylate retinoblastoma 1, thus leading to release of
E2F transcription factors, which enable the subsequent progression of the cell into S phase (75, 76). These complexes also titrate the CDK inhibitors p27kip1 and p21
away, therefore increase the kinase activity of cyclin ECDK2 complexes, which enhance the transition into S
phase (77). The overexpression of CyD1, together with its
established role as cell cycle progression regulator, highlights this gene as a potential central player in the pathogenesis of MCL (78). In our recent study (13), we used
optimized siRNA or dicer substrates against CyD1 to
potently downregulate CyD1 expression in well-characterized MCL cell lines. Knocking down CyD1 resulted in significant growth retardation, cell cycle arrest, and, most
importantly, induction of apoptosis. These results mark
CyD1 as a target for MCL and emphasize the therapeutic
potential hidden in its silencing.
I-tsNP: a leukocyte-specific platform technology for
delivery of RNAi payloads
To explore whether I-tsNPs can be defined as a platform
technology for delivering RNAi payloads to leukocytes, we
have changed the monoclonal antibody on the surface of
the nanoparticles from anti-b7 integrin to anti-aLb2 integrin
(LFA-1) that is highly expressed on all leukocytes and evaluated these LFA-1 I-tsNPs for systemic delivery of siRNA in a
humanized mouse model (57, 79). We demonstrated that
intravenous administration of LFA-1 I-tsNPs resulted in
selective uptake of siRNAs by T cells and macrophages, the
prime targets of HIV. In addition, intravenous administration of anti-CCR5 siRNA entrapped in LFA-1 I-tsNPs resulted
in leukocyte-specific gene silencing that was sustained for
10 days. Finally, humanized mice challenged with HIV after
anti-CCR5 siRNA treatment showed enhanced resistance to
infection, as assessed by the reduction in plasma viral load
and disease-associated CD4+ T-cell loss. This study (57)
demonstrated the potential in vivo applicability of LFA-1-targeted
191
Peer Manipulating leukocyte function with RNAi
siRNA delivery as anti-HIV prophylaxis but also validated
the I-tsNPs as a leukocyte-specific RNAi platform.
The potential drawbacks of I-tsNPs
Assembly of a leukocyte-specific platform for RNAi delivery
is a daunting task. From a chemistry, manufacturing, and
controls standpoint, translating the I-tsNPs technology to a
clinical setting is challenging. Each step of this assembly
should be closely monitored (80, 81). More specifically, the
I-tsNPs platform has several building blocks: lipids that form
the LNPs; the glycosaminoglycan, HA, that stabilizes the
nanoparticles and acts as a built-in cryoprotectant and as a
scaffold for mAb binding; monoclonal antibodies that act as
targeting moieties; human recombinant protamine that condense the nucleic acids; and the RNAi payloads. In addition
to these challenges, risk of exposed monoclonal antibody Fc
portion on the I-tsNP surface may cause potential immune
toxicity and uptake by innate immune cells and antigen-presenting cells in a non-specific manner. Clustering of receptors by anti-integrin monoclonal antibody can trigger
outside-in signaling event, which may cause immune stimulation and trigger proliferation. To reduce these risks, we
are currently developing F(ab′)2 fragments that are coupled
with different chemistries to the I-tsNP surface. In addition,
we are using as internal controls non-blocking integrin
monoclonal antibodies as F(ab′)2 fragments and probing for
lymphocyte activation, interferon response, and cytokine
induction, as well as exploring complement activation in
human sera. Currently, we have not observed any signs of
immunotoxicity with these novel systems.
Hyaluronan as a targeting agent to tumors highly
expressing CD44
we chose these cells as representative cells to examine the
ability of the GAGs to deliver RNAi and induce potent and
specific gene silencing.
We first determined the expression level of CD44, HA
ligand in these AML cells and found, as expected, a very
high expression level of CD44 (CD44high; data not shown).
Next, we labeled the HA, the GAG’s shell, with Alexa 488
and entrapped Cy3-siRNAs (Fig. 4A) in the particles’ clusters.
Confocal microscopy analysis was done 45 min post transfection, revealing high transfection efficiency in all cells
with co-localization of the siRNAs and the GAGs within the
cytoplasm of the AML cells (Fig. 4A). We then wanted to
verify that indeed functional knockdown could be detected
using qualitative polymerase chain reaction (QPCR). As control cells, we used CV-1 cells that lack CD44 (62), verified
by flow cytometry analysis (data not shown). CyD1-siRNAs
A
B
We have recently shown that the HA coating on lipid nanoclusters, termed gagomers (GAGs), which are lipid clusters that do not form bilayer structures but hexagonal tubes,
endow these carriers the ability to distinguish between cancerous and non-cancerous cells taken from the same patient
with head and neck tumors (82). These particles were also
efficient in entrapping and delivering RNAi payloads and
inducing gene silencing in human lung adenocarcinoma
cells (83).
To determine whether these GAGs can also target primary
acute myeloid leukemia (AML), fluorescence-assisted cell
sorting-purified AML cells from two patients were used
(This study protocol was approved by the ethics board of
Sheba Medical Center in Ramat Gan, Israel). AML cells represent notoriously difficult cells to transduce with RNAi, so
Fig. 4. Gagomers (GAGs) uptake and RNAi efficacy in primary
acute myeloid leukemia (AML) cells. (A). Representative confocal
microscopy analysis showing staining of GAGs (HA-labeled with Alexa
488 and entrapping Cy3-siRNAs) of primary FACS-sorted AML cells,
which are CD44high from a patient that was newly diagnosed with
AML. Microscopy was done 45 min post transfection after extensive
washing and without cell fixation. (B). Representative relative gene
expression of primary AML cells and CV-1 control cells (CD44 ) that
were incubated with 50 nM CyD1-siRNA or control siRNA entrapped
in the GAGs. After 24-h transfection, total RNA was isolated using EZRNA kit (biological industries, Israel) and cDNA was generated with
high capacity cDNA kit (Life Technologies, Carlsbad, CA, USA)
according to the manufacturers’ protocols. qRT-PCR was performed
with Fast SYBRâ Green Master Mix and the ABI StepOnePlusTM
instrument (Life Technologies).CCND1 (F:GAGGAGCCCCAACAACTTC
C, R:GTCCGGGTCACACTTGATCAC) expression was normalized to the
housekeeping genes eIF3a (F:TCCAGAGAGCCAGTCCATGC, R:CCTGC
CACAATTCA TGCT) and eIF3c (F: ACCAAGAGAGTTGTCCGCAGTG, R:
TCATGGCATTACG GATGGTCC). Analysis was done with the StepOneTM
software V 2.1 (Life Technologies) using the multiple endogenous
controls option.
192
© 2013 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd
Immunological Reviews 253/2013
Peer Manipulating leukocyte function with RNAi
were used as surrogated markers or control, non-targeted
siRNAs. All siRNAs were used at a concentration of 50 nM.
QPCR was performed 24 h post transfection. Representative
bars are shown in Fig. 4B. Although CyD1 is not the target
of choice in this highly complex disease, the expression
level of CyD1 in the patient sample was quite high compared with the normalized housekeeping genes. Knocking
down CyD1 in the patient sample was specific, as evidenced
by the control siRNA, and specific to these cells, as CV-1
that lacking the receptor CD44 did not reduce the expression level of CyD1 in a significant manner. These results
support this new delivery strategy for RNAi that can be
widely used for both leukocytes and non-leukocyte cells,
but more experiments are needed to validate and examine
potential adverse effects in human PBMCs and in vivo in
mouse models.
Challenges in delivery of RNAi payloads to leukocytes
Immunostimulatory effects of the RNAi payloads and
their carriers
Double-stranded RNA induces an immune response as a
defense mechanism against viral infection (4) upon interaction with RNA-binding proteins such as TLRs and protein
kinase receptor (PKR). This recognition occurs on the cell
surface or within the cell (in the cytoplasm or endosome
compartments) and leads to innate immunity activation,
i.e. production of pro-inflammatory cytokines, such as IL-6
and TNF-a, and triggering type I IFN responses (84). siRNAs can stimulate the immune system in a sequence-independent manner such as induction of TLR3 (85) and IFN
pathways (86), as well as in a sequence-dependent way as
in the case of uridine (U) or guanosine adenine/uridine
(GA/GU)-rich regions recognition via TLR7 and TLR8 (87–
89). Immunostimulatory effects can also be length dependent. Whereas short siRNAs (12 and 16 nt long) have been
reported to poorly stimulate immune cells, longer constructs
increased significantly cytokine production – independent of
their sequence (88). It is important to note that immunostimulation by siRNA is cell type dependent (87, 90), for
example, although non-immune cells do not express TLRs
or express them at low levels, they retain the ability to recognize exogenous RNAs via alternative pathways such as the
PKR pathway (91). Besides optimizing the sequence (92),
structure (93, 94), or length (88) of the siRNA, chemical
modifications can also be applied for mitigating immunogenicity (95). Of note, immunogenic siRNA sequences could
be deliberately applicable in specific treatments such as viral
© 2013 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd
Immunological Reviews 253/2013
infections or cancer (91), where activation of the immune
system is required to ameliorate the disease.
Among non-viral delivery systems for RNAi, cationic lipids have been widely used as part of the formulation (96–
98). Cationic lipids are lipid bilayer-forming vesicles with a
positive surface charge. Common cationic lipids that were
extensively studied included 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP) and N-(1-(2,3- Dioleoyloxy)propyl) -N,N,N-trimethyl-ammoniummethyl sulfate (DOTMA),
3b-[N-(N’, N’-Dimethy lainin(ethyl) carbamoyl cholesterol
(DC-Chol), and Dimethyldioctadecylammonium bromide,
but the variety of cationic lipids and lipid-like novel materials is enormous (99, 100).
Cationic liposomes showed a superior adjuvant effect
compared with anionic or neutral liposomes as demonstrated in vivo in animal models (101, 102). As cationic liposomes can activate the complement system and cause rapid
clearance by macrophages of the mononuclear phagocytic
system (97), these cationic particles can be used to enhance
and modulate the immune response in a desirable direction
and represent an efficient tool when designing tailor-made
adjuvant for a specific disease target. The use of cationic
liposomes in vivo elicited dose-dependent toxicity, as demonstrated by the multivalence cationic liposome LipofectAMINE2000 in a comparison with the monovalence cationic
lipids, such as DOTAP (103, 104). Although it was found
that DOTAP-based cationic liposomes also caused severe
damage to the mitochondria (105), the specific mechanism
by which this cytotoxicity occurs remains unknown and
might involve different cellular pathways depending on the
particular cell type. In addition, mice treated with positively
charged LNPs containing DOTAP showed increased liver
enzyme release and mild body weight loss compared with
mice treated with neutral or negatively charged LNPs (30,
58). Intravenous administration of cationic LNPs induced
type I IFN response and elevated mRNA levels of interferon
responsive genes 15- to 25-fold higher than neutral and
negatively charged NPs in mouse splenocytes. Treatment
with cationic LNPs provoked a dramatic pro-inflammatory
response by inducing Th1 cytokine expression (IL-2, IFN c,
and TNFa) 10- to 75-fold higher than treatment with control particles (neutral or negatively charged particles). Using
TLR4 knockout mice, it was shown that the induction of
cytokines and IFN response to cationic liposomes decreased
dramatically (58), strengthening the hypothesis suggested
by Russchart (106) several years ago that cationic liposomes
can agonize TLR4.
193
Peer Manipulating leukocyte function with RNAi
PEGylated liposomes, which are mildly negatively charged
under physiological conditions (107), have been used extensively as drug delivery carriers. Their advantage in improving
circulation time of the entrapped therapeutic payload is well
known (108, 109). However, it was observed that when
PEGylated liposomes were injected into mice, rats, and rhesus
monkeys repeatedly, they lost this long circulation feature and
accumulated in the liver, a phenomenon termed accelerated
blood clearance (ABC) (110, 111). Ishida et al. (112) suggested a possible mechanism of action for the ABC phenomenon demonstrating an PEG-specific IgM response by
splenocytes isolated from animals following the first injection
of empty PEGylated liposomes. These antibodies were found
to bind to the PEG on a second injected liposome dose, subsequently activating the complement system. An opsonization
of liposomes by C3 fragment occurred, which led to an
enhanced uptake of the liposomes by specialized macrophages
in the liver known as the Kupffer cells (112).
The surface charge of the LNPs affects also the tissue specificity of the particle uptake. Macrophages seem to preferentially take up negatively charged LNPs (107, 113, 114).
Different malignant cell lines have different uptake patterns
with respect to positive, neutral, or negative charges, and in
vivo uptake patterns can differ further (114). Anionic liposomes interact with a limited fraction of dendritic cells in vitro,
whereas cationic liposomes interact with a high percentage of
the dendritic cells, probably by means of electrostatic binding
to the negatively charged surface heparane sulfate proteoglycans resulting in intracellular localization (115).
1,2-dioleoyl-sn-glycero-3-phosphatidylcholine (DOPC), a
neutral phospholipid-forming liposome, was used to deliver
siRNAs payloads in vivo into tumor cells (96, 116–119) 10and 30-fold more effectively than cationic, DOTAP-based
liposomes, and naked siRNA, respectively (120). DOPCbased nanoscaled liposomes (approximately 100 nm in
diameter) did not induce any detectable toxicity and were
found to be safe in orthotopic mouse models, making them
highly attractive for further therapeutic development (121).
Phagocytic cells fervently take up anionic liposomes via an
unclear mechanism. When entrapping siRNAs, the loading
efficiency into these liposomes is quite low, probably due to
the negative charge of these molecules (6, 30, 114).
A complete understanding of the best liposomal design
for delivery of therapeutic substances is still evolving. It is
possible that with RNAi delivery, the use of a neutral lipid,
such as DOPC, which will enter the cells via a mechanism
that will not involve endosomes, will allow a balance
between efficient uptake of the therapeutic payload into a
liposome at preparation, uptake of the liposome into a particular cell type, and the release of the payload from the
liposome inside the cell cytoplasm, as was demonstrated for
multiple targets using siRNAs entrapped in DOPC-based particles (118, 119, 122).
From challenge to cautious optimism
Understanding the complicated nature of the immune system with its unique arms can open the door for utilizing
different RNAi delivery platforms to manipulate the
immune response. In a recent study (123), it was demonstrated that hydrophobicity can dictate the immune
response. A small library of gold NPs was synthesized and
characterized. These gold NPs had increased hydrophobic
carbon chains on their surface and had almost a linear
behavior (both in vitro and in vivo) when interacting with
subsets of leukocytes. LNPs are one of the most veteran
delivery vehicles used already in clinical practice for many
years, and several new classes of LNPs including hybrid systems (lipid polymers) are under clinical evaluation with
therapeutic and imaging payloads. Adequate and comprehensive understanding of the specific interaction between
LNPs with T cells, B cells, dendritic cells, macrophages, and
monocytes at the cellular and molecular level and appropriate assays to probe immune suppression or stimulation,
such as cytokine induction, interferon response, lymphocyte
activation, coagulation cascades, and complement activation,
will aid in designing safer vehicles for discovery, validation,
and therapeutic applications in leukocytes. The arsenal of
RNAi delivery platforms already available for use in leukocytes is increasing, but it will be wise to use next generation sequencing methods and microarrays to globally
examine what effects these delivery platforms may have on
subsets of leukocytes before we use those strategies to
manipulate leukocyte function.
References
1. Elbashir SM, Harborth J, Lendeckel W, Yalcin
A, Weber K, Tuschl T. Duplexes of 21nucleotide RNAs mediate RNA interference in
cultured mammalian cells. Nature
2001;411:494–498.
194
2. Amarzguioui M, Rossi JJ, Kim D. Approaches for
chemically synthesized siRNA and vectormediated RNAi. FEBS Lett 2005;579:5974–5981.
3. Dykxhoorn DM, Lieberman J. Knocking down
disease with siRNAs. Cell 2006;126:231–235.
4. Sledz CA, Williams BR. RNA interference in
biology and disease. Blood 2005;106:787–794.
5. de Fougerolles A, Vornlocher HP, Maraganore J,
Lieberman J. Interfering with disease: a progress
© 2013 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd
Immunological Reviews 253/2013
Peer Manipulating leukocyte function with RNAi
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
report on siRNA-based therapeutics. Nat Rev
Drug Discov 2007;6:443–453.
Peer D, Lieberman J. Special delivery: targeted
therapy with small RNAs. Gene Ther
2011;18:1127–1133.
Song E, et al. Antibody mediated in vivo delivery
of small interfering RNAs via cell-surface
receptors. Nat Biotechnol 2005;23:709–717.
Peer D, Park EJ, Morishita Y, Carman CV,
Shimaoka M. Systemic leukocyte-directed siRNA
delivery revealing cyclin D1 as an antiinflammatory target. Science 2008;319:627–630.
Palliser D, et al. An siRNA-based microbicide
protects mice from lethal herpes simplex virus 2
infection. Nature 2006;439:89–94.
Song E, et al. RNA interference targeting Fas
protects mice from fulminant hepatitis. Nat Med
2003;9:347–351.
Robbins M, et al. Misinterpreting the therapeutic
effects of small interfering RNA caused by
immune stimulation. Hum Gene Ther
2008;19:991–999.
Kleinman ME, et al. Sequence- and targetindependent angiogenesis suppression by siRNA
via TLR3. Nature 2008;452:591–597.
Weinstein S, et al. RNA inhibition highlights
cyclin d1 as a potential therapeutic target for
mantle cell lymphoma. PLoS ONE 2012;7:
e43343.
Daka A, Peer D. RNAi-based nanomedicines for
targeted personalized therapy. Adv Drug Deliv
Rev 2012;64:1508–1521.
Zimmermann TS, et al. RNAi-mediated gene
silencing in non-human primates. Nature
2006;441:111–114.
Dorn G, et al. siRNA relieves chronic neuropathic
pain. Nucleic Acids Res 2004;32:e49.
Shen J, et al. Suppression of ocular
neovascularization with siRNA targeting VEGF
receptor 1. Gene Ther 2006;13:225–234.
Filleur S, et al. SiRNA-mediated inhibition of
vascular endothelial growth factor severely limits
tumor resistance to antiangiogenic
thrombospondin-1 and slows tumor
vascularization and growth. Cancer Res
2003;63:3919–3922.
Gaudilliere B, Shi Y, Bonni A. RNA interference
reveals a requirement for myocyte enhancer
factor 2A in activity-dependent neuronal survival.
J Biol Chem 2002;277:46442–46446.
Miller VM, et al. Allele-specific silencing of
dominant disease genes. Proc Natl Acad Sci USA
2003;100:7195–7200.
Gonzalez-Alegre P, Bode N, Davidson BL,
Paulson HL. Silencing primary dystonia:
lentiviral-mediated RNA interference therapy for
DYT1 dystonia. J Neurosci 2005;25:10502–
10509.
Bumcrot D, Manoharan M, Koteliansky V, Sah
DW. RNAi therapeutics: a potential new class of
pharmaceutical drugs. Nat Chem Biol
2006;2:711–719.
Bramsen JB, et al. A large-scale chemical
modification screen identifies design rules to
generate siRNAs with high activity, high stability
and low toxicity. Nucleic Acids Res
2009;37:2867–2881.
24. Robbins M, Judge A, MacLachlan I. siRNA and
innate immunity. Oligonucleotides 2009;19:89–
102.
25. Behlke MA. Chemical modification of siRNAs for
in vivo use. Oligonucleotides 2008;18:305–319.
26. Dykxhoorn DM, Palliser D, Lieberman J. The
silent treatment: siRNAs as small molecule drugs.
Gene Ther 2006;13:541–552.
27. Kim DH, Rossi JJ. Strategies for silencing human
disease using RNA interference. Nat Rev Genet
2007;8:173–184.
28. Behlke MA. Progress towards in vivo use of
siRNAs. Mol Ther 2006;13:644–670.
29. Dykxhoorn DM, Lieberman J. The silent
revolution: RNA interference as basic biology,
research tool, and therapeutic. Annu Rev Med
2005;56:401–423.
30. Goldsmith M, Mizrahy S, Peer D. Grand
challenges in modulating the immune response
with RNAi nanomedicines. Nanomedicine
2011;6:1771–1785.
31. Goffinet C, Keppler OT. Efficient nonviral gene
delivery into primary lymphocytes from rats and
mice. FASEB J 2006;20:500–502.
32. Huang Z, King MR. An immobilized
nanoparticle-based platform for efficient gene
knockdown of targeted cells in the circulation.
Gene Ther 2009;16:1271–1282.
33. Eguchi A, et al. Efficient siRNA delivery into
primary cells by a peptide transduction domaindsRNA binding domain fusion protein. Nat
Biotechnol 2009;27:567–571.
34. Zhou J, Li H, Li S, Zaia J, Rossi JJ. Novel dual
inhibitory function aptamer-siRNA delivery
system for HIV-1 therapy. Mol Ther
2008;16:1481–1489.
35. Zhou J, et al. Selection, characterization and
application of new RNA HIV gp 120 aptamers
for facile delivery of Dicer substrate siRNAs into
HIV infected cells. Nucleic Acids Res
2009;37:3094–3109.
36. Kortylewski M, et al. In vivo delivery of siRNA
to immune cells by conjugation to a TLR9
agonist enhances antitumor immune responses.
Nat Biotechnol 2009;27:925–932.
37. Ishimoto T, et al. Downregulation of monocyte
chemoattractant protein-1 involving short
interfering RNA attenuates hapten-induced
contact hypersensitivity. Mol Ther 2008;16:387–
395.
38. Kumar P, et al. T cell-specific siRNA delivery
suppresses HIV-1 infection in humanized mice.
Cell 2008;134:577–586.
39. Subramanya S, et al. Targeted delivery of small
interfering RNA to human dendritic cells to
suppress dengue virus infection and associated
proinflammatory cytokine production. J Virol
2010;84:2490–2501.
40. Kim SS, et al. Targeted delivery of siRNA to
macrophages for anti-inflammatory treatment.
Mol Ther 2010;18:993–1001.
41. Kumar P, et al. Transvascular delivery of small
interfering RNA to the central nervous system.
Nature 2007;448:39–43.
42. Peer D, Zhu P, Carman CV, Lieberman J,
Shimaoka M. Selective gene silencing in activated
leukocytes by targeting siRNAs to the integrin
© 2013 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd
Immunological Reviews 253/2013
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
lymphocyte function-associated antigen-1. Proc
Natl Acad Sci USA 2007;104:4095–4100.
Springer TA. Adhesion receptors of the immune
system. Nature 1990;346:425–434.
Hynes RO. Integrins: bidirectional, allosteric
signaling machines. Cell 2002;110:673–687.
Lebwohl M, et al. A novel targeted T-cell
modulator, efalizumab, for plaque psoriasis. N
Engl J Med 2003;349:2004–2013.
Sandborn WJ, et al. Natalizumab induction and
maintenance therapy for Crohn’s disease. N Engl
J Med 2005;353:1912–1925.
Shimaoka M, Springer TA. Therapeutic
antagonists and conformational regulation of
integrin function. Nat Rev Drug Discov
2003;2:703–716.
Shimaoka M, et al. Structures of the alpha L I
domain and its complex with ICAM-1 reveal a
shape-shifting pathway for integrin regulation.
Cell 2003;112:99–111.
Peer D. Induction of therapeutic gene silencing
in leukocyte-implicated diseases by targeted and
stabilized nanoparticles: a mini-review. J Control
Rel 2010;148:63–68.
Fabbri M, et al. Dynamic partitioning into lipid
rafts controls the endo-exocytic cycle of the
alphaL/beta2 integrin, LFA-1, during leukocyte
chemotaxis. Mol Biol Cell 2005;16:5793–5803.
Coffey GP, et al. In vitro internalization,
intracellular transport, and clearance of an antiCD11a antibody (Raptiva) by human T-cells. J
Pharmacol Exp Ther 2004;310:896–904.
Springer TA. Traffic signals for lymphocyte
recirculation and leukocyte emigration: the
multistep paradigm. Cell 1994;76:301–314.
Butcher EC, Picker LJ. Lymphocyte homing and
homeostasis. Science 1996;272:60–66.
Shimaoka M, Takagi J, Springer TA.
Conformational regulation of integrin structure
and function. Annu Rev Biophys Biomol Struct
2002;31:485–516.
Shimaoka M, et al. AL-57, a ligand-mimetic
antibody to integrin LFA-1, reveals chemokineinduced affinity up-regulation in lymphocytes.
Proc Natl Acad Sci USA 2006;103:13991–13996.
Ben-Arie N, Kedmi R, Peer D. Integrin-targeted
nanoparticles for siRNA delivery. Methods Mol
Biol 2012;757:497–507.
Kim SS, et al. RNAi-mediated CCR5 silencing by
LFA-1-targeted nanoparticles prevents HIV
infection in BLT mice. Mol Ther 2010;18:370–
376.
Kedmi R, Ben-Arie N, Peer D. The systemic
toxicity of positively charged lipid nanoparticles
and the role of Toll-like receptor 4 in immune
activation. Biomaterials 2010;31:6867–6875.
Peer D. Immunotoxicity derived from
manipulating leukocytes with lipid-based
nanoparticles. Adv Drug Deliv Rev
2012;64:1738–1748.
Landesman-Milo D, Peer D. Altering the immune
response with lipid-based nanoparticles. J Control
Rel 2012;161:600–608.
Peer D, Florentin A, Margalit R. Hyaluronan is a
key component in cryoprotection and
formulation of targeted unilamellar liposomes.
Biochim Biophys Acta 2003;1612:76–82.
195
Peer Manipulating leukocyte function with RNAi
62. Peer D, Margalit R. Loading mitomycin C inside
long circulating hyaluronan targeted nanoliposomes increases its antitumor activity in three
mice tumor models. Int J Cancer 2004;108:780–
789.
63. Peer D, Margalit R. Tumor-targeted hyaluronan
nanoliposomes increase the antitumor activity of
liposomal Doxorubicin in syngeneic and human
xenograft mouse tumor models. Neoplasia
2004;6:343–353.
64. Mizrahy S, Peer D. Polysaccharides as building
blocks for nanotherapeutics. Chem Soc Rev
2012;41:2623–2640.
65. Mizrahy S, et al. Hyaluronan-coated
nanoparticles: the influence of the molecular
weight on CD44-hyaluronan interactions and on
the immune response. J Control Rel
2011;156:231–238.
66. Stacey DW. Cyclin D1 serves as a cell cycle
regulatory switch in actively proliferating cells.
Curr Opin Cell Biol 2003;15:158–163.
67. Lee YM, Sicinski P. Targeting cyclins and cyclindependent kinases in cancer: lessons from mice,
hopes for therapeutic applications in human. Cell
Cycle 2006;5:2110–2114.
68. Knudsen KE, Diehl JA, Haiman CA, Knudsen ES.
Cyclin D1: polymorphism, aberrant splicing and
cancer risk. Oncogene 2006;25:1620–1628.
69. Fu M, Wang C, Li Z, Sakamaki T, Pestell RG.
Minireview: Cyclin D1: normal and abnormal
functions. Endocrinology 2004;145:5439–5447.
70. Tashiro E, Tsuchiya A, Imoto M. Functions of
cyclin D1 as an oncogene and regulation of
cyclin D1 expression. Cancer Sci 2007;98:629–
635.
71. Kozar K, Sicinski P. Cell cycle progression
without cyclin D-CDK4 and cyclin D-CDK6
complexes. Cell Cycle 2005;4:388–391.
72. Jing N, Tweardy DJ. Targeting Stat3 in cancer
therapy. Anticancer Drugs 2005;16:601–607.
73. Arnold A, Papanikolaou A. Cyclin D1 in breast
cancer pathogenesis. J Clin Oncol
2005;23:4215–4224.
74. Jares P, Colomer D, Campo E. Genetic and
molecular pathogenesis of mantle cell lymphoma:
perspectives for new targeted therapeutics. Nat
Rev Cancer 2007;7:750–762.
75. Hunter T, Pines J. Cyclins and cancer. II: Cyclin
D and CDK inhibitors come of age. Cell
1994;79:573–582.
76. Sherr CJ. Cancer cell cycles. Science
1996;274:1672–1677.
77. Sherr CJ, McCormick F. The RB and p53
pathways in cancer. Cancer Cell 2002;2:103–
112.
78. Fernandez V, Hartmann E, Ott G, Campo E,
Rosenwald A. Pathogenesis of mantle-cell
lymphoma: all oncogenic roads lead to
dysregulation of cell cycle and DNA damage
response pathways. J Clin Oncol 2005;23:6364–
6369.
79. Kim SS, Subramanya S, Peer D, Shimaoka M,
Shankar P. Antibody-mediated delivery of siRNAs
for anti-HIV therapy. Methods Mol Biol
2011;721:339–353.
80. Szoka F. Molecular biology. The art of assembly.
Science 2008;319:578–579.
196
81. Maclachlan I. siRNAs with guts. Nat Biotechnol
2008;26:403–405.
82. Bachar G, et al. Hyaluronan-grafted particle
clusters loaded with Mitomycin C as selective
nanovectors for primary head and neck cancers.
Biomaterials 2011;32:4840–4848.
83. Landesman-Milo D, et al. Hyaluronan grafted
lipid-based nanoparticles as RNAi carriers for
cancer cells. Cancer Lett 2012. doi: 10.1016/j.
canlet.2012.08.024.
84. Agrawal S, Kandimalla ER. Antisense and siRNA
as agonists of Toll-like receptors. Nat Biotechnol
2004;22:1533–1537.
85. Kariko K, Bhuyan P, Capodici J, Weissman D.
Small interfering RNAs mediate sequenceindependent gene suppression and induce
immune activation by signaling through toll-like
receptor 3. J Immunol 2004;172:6545–6549.
86. Sledz CA, Holko M, de Veer MJ, Silverman RH,
Williams BR. Activation of the interferon system
by short-interfering RNAs. Nat Cell Biol
2003;5:834–839.
87. Judge AD, Sood V, Shaw JR, Fang D, McClintock K,
MacLachlan I. Sequence-dependent stimulation of
the mammalian innate immune response by
synthetic siRNA. Nat Biotechnol 2005;23:457–462.
88. Hornung V, et al. Sequence-specific potent
induction of IFN-alpha by short interfering RNA
in plasmacytoid dendritic cells through TLR7.
Nat Med 2005;11:263–270.
89. Forsbach A, et al. Identification of RNA sequence
motifs stimulating sequence-specific TLR8dependent immune responses. J Immunol
2008;180:3729–3738.
90. Sioud M. Induction of inflammatory cytokines
and interferon responses by double-stranded and
single-stranded siRNAs is sequence-dependent
and requires endosomal localization. J Mol Biol
2005;348:1079–1090.
91. Schlee M, Hornung V, Hartmann G. siRNA and
isRNA: two edges of one sword. Mol Ther
2006;14:463–470.
92. Robbins M, Judge A, Liang L, McClintock K,
Yaworski E, MacLachlan I. 2′-O-methyl-modified
RNAs act as TLR7 antagonists. Mol Ther
2007;15:1663–1669.
93. Puthenveetil S, Whitby L, Ren J, Kelnar K, Krebs
JF, Beal PA. Controlling activation of the RNAdependent protein kinase by siRNAs using sitespecific chemical modification. Nucl Acids Res
2006;34:4900–4911.
94. Judge AD, Bola G, Lee AC, MacLachlan I. Design
of noninflammatory synthetic siRNA mediating
potent gene silencing in vivo. Mol Ther
2006;13:494–505.
95. Morrissey DV, et al. Potent and persistent in vivo
anti-HBV activity of chemically modified siRNAs.
Nat Biotechnol 2005;23:1002–1007.
96. Ozpolat B, Sood AK, Lopez-Berestein G.
Nanomedicine based approaches for the
delivery of siRNA in cancer. J Intern Med
2010;267:44–53.
97. Christensen D, Korsholm KS, Rosenkrands I,
Lindenstrom T, Andersen P, Agger EM. Cationic
liposomes as vaccine adjuvants. Expert Rev
Vaccines 2007;6:785–796.
98. Buyens K, et al. Liposome based systems for
systemic siRNA delivery: Stability in blood sets
the requirements for optimal carrier design. J
Control Rel 2012;158:362–370.
99. Shirazi RS, Ewert KK, Leal C, Majzoub RN,
Bouxsein NF, Safinya CR. Synthesis and
characterization of degradable multivalent
cationic lipids with disulfide-bond spacers for
gene delivery. Biochim Biophys Acta
2011;1808:2156–2166.
100. Akinc A, et al. A combinatorial library of lipidlike materials for delivery of RNAi therapeutics.
Nat Biotechnol 2008;26:561–569.
101. Nakanishi T, et al. Positively charged liposome
functions as an efficient immunoadjuvant in
inducing immune responses to soluble proteins.
Biochem Biophys Res Commun 1997;240:793–
797.
102. Vangasseri DP, Cui Z, Chen W, Hokey DA, Falo
LD Jr, Huang L. Immunostimulation of dendritic
cells by cationic liposomes. Mol Membr Biol
2006;23:385–395.
103. Chen Y, Bathula SR, Li J, Huang L.
Multifunctional nanoparticles delivering small
interfering RNA and doxorubicin overcome drug
resistance in cancer. J Biol Chem
2010;285:22639–22650.
104. Spagnou S, Miller AD, Keller M. Lipidic carriers
of siRNA: differences in the formulation, cellular
uptake, and delivery with plasmid DNA.
Biochemistry 2004;43:13348–13356.
105. Solmesky LJ, Shuman M, Goldsmith M, Weil M,
Peer D. Assessing cellular toxicities in fibroblasts
upon exposure to lipid-based nanoparticles: a
high content analysis approach. Nanotechnology
2011;22:494016.
106. Lonez C, Vandenbranden M, Ruysschaert JM.
Cationic liposomal lipids: from gene carriers to
cell signaling. Prog Lipid Res 2008;47:340–347.
107. Harel-Adar T, Ben Mordechai T, Amsalem Y,
Feinberg MS, Leor J, Cohen S. Modulation of
cardiac macrophages by phosphatidylserinepresenting liposomes improves infarct repair.
Proc Natl Acad Sci USA 2011;108:1827–1832.
108. Allen TM, Hansen C, Martin F, Redemann C,
Yau-Young A. Liposomes containing synthetic
lipid derivatives of poly(ethylene glycol) show
prolonged circulation half-lives in vivo. Biochim
Biophys Acta 1991;1066:29–36.
109. Klibanov AL, Maruyama K, Torchilin VP, Huang
L. Amphipathic polyethyleneglycols effectively
prolong the circulation time of liposomes. FEBS
Lett 1990;268:235–237.
110. Ishida T, Maeda R, Ichihara M, Irimura K,
Kiwada H. Accelerated clearance of PEGylated
liposomes in rats after repeated injections. J
Control Rel 2003;88:35–42.
111. Ishida T, Masuda K, Ichikawa T, Ichihara M,
Irimura K, Kiwada H. Accelerated clearance of a
second injection of PEGylated liposomes in mice.
Int J Pharm 2003;255:167–174.
112. Ishida T, Wang X, Shimizu T, Nawata K, Kiwada
H. PEGylated liposomes elicit an anti-PEG IgM
response in a T cell-independent manner. J
Control Rel 2007;122:349–355.
113. Gutman D, Epstein-Barash H, Tsuriel M, Golomb
G. Alendronate liposomes for antitumor therapy:
© 2013 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd
Immunological Reviews 253/2013
Peer Manipulating leukocyte function with RNAi
activation of gammadelta T Cells and inhibition
of tumor growth. Adv Exp Med Biol
2012;733:165–179.
114. Miller CR, Bondurant B, McLean SD, McGovern
KA, O’Brien DF. Liposome-cell interactions in
vitro: effect of liposome surface charge on the
binding and endocytosis of conventional and
sterically stabilized liposomes. Biochemistry
1998;37:12875–12883.
115. Foged C, Arigita C, Sundblad A, Jiskoot W, Storm
G, Frokjaer S. Interaction of dendritic cells with
antigen-containing liposomes: effect of bilayer
composition. Vaccine 2004;22:1903–1913.
116. Gray MJ, et al. Therapeutic targeting of
neuropilin-2 on colorectal carcinoma cells
implanted in the murine liver. J Natl Cancer Inst
2008;100:109–120.
117. Halder J, et al. Focal adhesion kinase
targeting using in vivo short interfering RNA
delivery in neutral liposomes for ovarian
carcinoma therapy. Clin Cancer Res
2006;12:4916–4924.
118. Landen CN Jr, et al. Therapeutic EphA2 gene
targeting in vivo using neutral liposomal small
interfering RNA delivery. Cancer Res
2005;65:6910–6918.
119. Merritt WM, et al. Effect of interleukin-8 gene
silencing with liposome-encapsulated small
interfering RNA on ovarian cancer cell
growth. J Natl Cancer Inst 2008;100:359–
372.
120. Gewirtz AM. On future’s doorstep: RNA
interference and the pharmacopeia of tomorrow.
J Clin Invest 2007;117:3612–3614.
© 2013 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd
Immunological Reviews 253/2013
121. Tanaka T, et al. Sustained small interfering RNA
delivery by mesoporous silicon particles. Cancer
Res 2010;70:3687–3696.
122. Villares GJ, et al. Targeting melanoma growth
and metastasis with systemic delivery of
liposome-incorporated protease-activated
receptor-1 small interfering RNA. Cancer Res
2008;68:9078–9086.
123. Moyano DF, et al. Nanoparticle hydrophobicity
dictates immune response. J Am Chem Soc
2012;134:3965–3967.
124. Salas A, Shimaoka M, Kogan AN, Harwood C,
von Andrian UH, Springer TA. Rolling adhesion
through an extended conformation of integrin
alphaLbeta2 and relation to alpha I and beta Ilike domain interaction. Immunity 2004;20:393–
406.
197