Download Acetylglutamate kinase is required for both gametophyte function

JIPB
Journal of Integrative
Plant Biology
Acetylglutamate kinase is required for both
gametophyte function and embryo development
in Arabidopsis thaliana
FA
State Key Laboratory for Hybrid Rice, College of Life Sciences, Wuhan University, Wuhan 430072, China
†
These authors contributed equally to this work.
*Correspondence: Xiongbo Peng ([email protected])
doi: 10.1111/jipb.12536
Abstract The specific functions of the genes encoding
arginine biosynthesis enzymes in plants are not well
characterized. We report the isolation and characterization of Arabidopsis thaliana N-acetylglutamate kinase
(NAGK), which catalyzes the second step of arginine
biosynthesis. NAGK is a plastid-localized protein and
is expressed in most developmental processes in
Arabidopsis. Heterologous expression of the Arabidopsis
NAGK gene in a NAGK-deficient Escherichia coli strain
fully restores bacterial growth on arginine-deficient
medium. nagk mutant pollen tubes grow more slowly
than wild type pollen tubes and the phenotype is
restored by either specifically complementation NAGK in
pollen or exogenous supplementation of arginine. nagk
female gametophytes are defective in micropylar pollen
tube guidance due to the fact that female gametophyte
cell fate specification was specifically affected. Specific
expression of NAGK in synergid cells rescues the defect
of nagk female gametophytes. Loss-of-function of NAGK
results in Arabidopsis embryos not developing beyond
the four-celled embryo stage. The embryo-defective
phenotype in nagk/NAGK plants cannot be rescued by
watering nagk/NAGK plants with arginine or ornithine
supplementation. In conclusion, the results reveal a
novel role of NAGK and arginine in regulating gametophyte function and embryo development, and provide
valuable insights into arginine transport during embryo
development.
INTRODUCTION
nitrogen storage, arginine is a precursor of compounds
that act as second messengers in developmental
processes; such compounds include polyamines
(Takahashi and Kakehi 2010) and nitric oxide
(Crawford 2006; Grun et al. 2006; Neill et al. 2008).
Arginine plays a major metabolic role in seed maturation
and germination, and in phloem and xylem transport,
and accumulates under stress conditions (Kalamaki
et al. 2009a, 2009b). Therefore, arginine and its
metabolism are of central importance in plant biology,
but the genes regulating its biosynthesis are only
partially known in plants.
Arginine synthesis and its regulation have been
characterized in prokaryotes, fungi and animals (Cunin
et al. 1986; Davis 1986; Caldovic and Tuchman 2003). The
biosynthesis of arginine in microorganisms is
Edited by: Li-Jia Qu, Peking University, China
Received Feb. 10, 2017; Accepted Mar. 14, 2017; Online on Mar. 15,
2017
FA: Free Access, paid by JIPB
© 2017 Institute of Botany, Chinese Academy of Sciences
www.jipb.net
XXX 2017 | Volume XXXX | Issue XXXX | XXX-XX
Free Access
Nitrogen is commonly the limiting essential element in
plant growth (Cleland and Harpole 2010). It becomes
increasingly important to investigate the mechanisms
of nitrogen uptake, storage and recycling and to
understand the interplay of these processes with the
regulation of plant development. Due to its high
nitrogen to carbon ratio among the amino acids
necessary for proteins biosynthesis, arginine is an ideal
element for nitrogen storage (Llacer et al. 2008).
Arginine provides a significant portion of the stored
nitrogen in proteins or as free amino acid in seeds,
bulbs, and other plant parts (Micallef and Shelp 1989).
In addition to being an important amino acid
required in protein synthesis and an intermediate for
Research Article
Jie Huang†, Dan Chen†, Hailong Yan, Fei Xie, Ying Yu, Liyao Zhang, Mengxiang Sun and Xiongbo Peng*
2
Huang et al.
accomplished in eight enzymatic steps and can be
divided in two processes (Cunin et al. 1986; Caldovic and
Tuchman 2003). First, ornithine is synthesized from
glutamate either in a cyclic or a linear pathway, followed
by the synthesis of arginine from ornithine. The first
reaction in arginine biosynthesis is N-acetylation of
glutamate by N-acetylglutamate synthase (NAGS). The
second reaction is the phosphorylation of N-acetylglutamate by N-acetylglutamate kinase (NAGK) to produce
N-acetylglutamate-5-phosphate which is subsequently
converted to N-acetylglutamate-5-semialdehyde, a reaction catalyzed by N-acetylglutamate-5-phosphate
reductase (NAGPR). In the fourth reaction, an amino
group is transferred to N-acetylglutamate-5-semialdehyde by N2-acetylornithine aminotransferase (NAOAT)
to produce N2-acetylornithine which is subsequently
converted to ornithine by N2-acetylornithine: glutamate
acetyltransferase (NAOGAcT) or N2-acetylornithine
deacetylase (NAOD). Then ornithine is converted to
citrulline by ornithine transcarbamylase (OTC). Argininosuccinate is then formed from citrulline and aspartate
by argininosuccinate synthase (ASSY). In the last
reaction, fumarate is cleaved from argininosuccinate
by argininosuccinate lyase (ASL) to produce arginine
(Slocum 2005).
The enzymes involved in plant arginine biosynthesis
have partly been identified in silico and biochemically
(Slocum 2005; Winter et al. 2015), but less is known
about the specific functions of the genes encoding
these enzymes (Winter et al. 2015). Only some of the
Arabidopsis genes involved in arginine biosynthesis
have been studied with the use of mutants. The
TUMORPRONE5 (TUP5, At1g80600) gene of Arabidopsis encodes a NAOAT (Fremont et al. 2013). tup5 loss-offunction mutant lines showed a strongly reduced free
arginine content and a short root growth phenotype.
Molesini et al. analyzed NAOD’s activity in Arabidopsis
after downregulation of a putative NAOD gene
(At4g17830) using T-DNA insertion mutants and RNA
silencing (Molesini et al. 2015). All NAOD-suppressed
plants showed consistently reduced ornithine content,
early flowering and impaired seed sets. The Venosa3
(VEN3, At1g29900) and Venosa6 (VEN6, At3g27740)
genes encode for the large and small subunits of the
carbamoyl phosphate synthetase, respectively (MollaMorales et al. 2011). Carbamoyl phosphate and ornithine
are substrates of OTC to produce citrulline (Slocum
2005). The ven3 and ven6 mutants displayed a reticulate
XXX 2017 | Volume XXXX | Issue XXXX | XXX-XX
Figure 1. Putative arginine biosynthesis pathway in
plants
The enzymes catalyzing the reaction steps of arginine
biosynthesis are indicated beside arrows. ASL, argininosuccinate lyase; ASSY, argininosuccinate synthase; NAGS,
N-acetylglutamate synthase; NAGK, N-acetylglutamate
kinase; NAGPR, N-acetylglutamate-5-phosphate reductase; NAOAT, N2-acetylornithine aminotransferase;
NAOGAcT, N2-acetylornithine, glutamate acetyltransferase; NAOD, N2-acetylornithine deacetylase; OTC, ornithine transcarbamylase.
leaf phenotype that was correlated with a defect in
mesophyll development (Molla-Morales et al. 2011). A
T-DNA insertion in the OTC gene caused increased
sensitivity to ornithine (Quesada et al. 1999). In
addition, the rice ASL mutant osred1 showed a short
root phenotype (Xia et al. 2014). These findings suggest
that the genes that involved in specific step of arginine
biosynthesis play specific roles in particular plant
developmental processes.
NAGK catalyzes the second reaction of arginine
biosynthesis (Figure 1) and is the target of arginine in
the negative feedback loop of the arginine biosynthetic
pathway (McKay and Shargool 1981). Besides its
important role in arginine biosynthesis, NAGK has an
important function in the balance of nitrogen and
carbon by interacting with PII signaling proteins (Winter
et al. 2015). PII signaling proteins interact with
www.jipb.net
NAGK is critical for gametophytes and embryo development
enzymes, transcription factors, and ammonia channels,
and regulate their activities and carbon/nitrogen
homeostasis (Forchhammer 2008; Uhrig et al. 2009;
Huergo et al. 2013). A high nitrogen level will be sensed
by the PII protein, which favors PII-NAGK complex
formation leading to arginine synthesis and nitrogen
storage, while limited nitrogen levels prevent the
formation of the PII-NAGK complex, resulting in
decreased enzyme activity of NAGK and an increase
in the feedback inhibition of the complex by arginine
(Burillo et al. 2004; Chen et al. 2006; Feria Bourrellier
et al. 2009; Winter et al. 2015). Although plant NAGK
have been identified in silico, biochemical and structural
analyses (Burillo et al. 2004; Slocum 2005; Chen et al.
2006; Winter et al. 2015), little is known about plant
NAGK including its gene expression and function in
plant development.
In the present investigation, we studied the role of
the AT3G57560 gene, a putative Arabidopsis NAGK.
Heterologous expression of the Arabidopsis NAGK
restored NAGK-deficient Escherichia coli growth on
arginine-deficient medium. Loss-of- function of NAGK
resulted in slow growth of male gametophytes,
decreasing the ability of female gametophytes for
pollen tube guidance and abortion of early embryos.
The results indicated the essential role of NAGK in these
reproductive processes.
RESULTS
A T-DNA insertion in NAGK affected seed development
To screen genes required for gametes and embryo
development in Arabidopsis thaliana, we established a
T-DNA insertion mutant library that contains one
insertion site with hygromycin resistance in the
genomic DNA of qrt1 plant background (Preuss
et al. 1994). A heterozygous mutant with aborted
seeds was isolated (Figure 2B). We identified the
flanking sequence of the T-DNA insertion site of the
mutated gene by thermal asymmetrical interlaced PCR
(Liu et al. 1995) and found that the T-DNA was inserted
in AT3G57560, a gene predicted to encode the NAGK,
which catalyzes the second reaction of arginine
biosynthesis. The T-DNA insertion site is 47bp
upstream of the ATG start codon, and thus we
designated the mutant nagk (Figure 2A). The authenticity of the T-DNA insertion site was confirmed by PCR
www.jipb.net
3
Figure 2. Embryo developmental processes are impaired in nagk/NAGK plants
(A) Diagram of the NAGK genomic DNA and the
insertion sites for the T-DNA. The T-DNA in nagk/NAGK
plants inserted into the promoter at 47 bp upstream of
the ATG start codon of NAGK gene (AT3g57560). (B–D)
Micrographs of siliques of wild type plants (B), nagk/
NAGK plants (C) and genomic complemented lines (D).
Siliques of wild type and genomic complemented line
show only normally fertilized seeds (B and D), while
nagk/NAGK plant siliques showing normally fertilized
ovules, aborted fertilized ovules (indicated by stars) and
aborted unfertilized ovules (indicated by arrows) (C).
(E) and (F) Micrographs of normally fertilized ovules
and aborted fertilized ovules 5 d after fertilization in
nagk/NAGK plant. When embryo develops to torpedoshaped embryo in normally fertilized ovules (E), the
mutant embryo in aborted fertilized ovules remained in
four-celled stage (F). Scale bar ¼ 1 mm for (B) to (D),
50 mm for (E) and 20 mm for (F).
using DNA from nagk. nagk/nagk mutant plants could
not be recovered in the offspring of nagk/NAGK plants,
suggesting the nagk/nagk embryos or/and nagk
gametes are lethal.
Only normally fertilized ovules were found in wild
type siliques (Figure 2B), while in the siliques of nagk/
NAGK plants, three types of ovules were observed:
normally fertilized ovules, aborted fertilized ovules and
aborted unfertilized ovules (Figure 2C). The ratio of these
three types ovules are shown in Table 1. The aborted
fertilized ovules were expected to contain the homozygous nagk/nagk embryos. To verify this, we crossed nagk/
NAGK plants with wild type plants. The crosses resulted in
no aborted fertilized ovules in the hybrid siliques
XXX 2017 | Volume XXXX | Issue XXXX | XXX-XX
4
Huang et al.
Table 1. Ovule phenotype of self-pollination and reciprocal cross between nagk/NAGK plants and wild type plants
Female
Male
Normally fertilized ovules
(ratio)
Aborted fertilized ovules
(ratio)
Unfertilized ovules
(ratio)
Wild type
nagk/NAGK
nagk/NAGK
Wild type
Wild type
nagk/NAGK
Wild type
nagk/NAGK
438 (97.33%)
656 (70.69%)
799 (79.66%)
357 (100%)
0 (0%)
91 (9.81%)
0 (0%)
0 (0%)
2 (0.67%)
181 (19.50%)
204 (20.34%)
0 (0%)
(Table1), proving that the small aborted fertilized ovules
enclosed the homozygous nagk/nagk embryos.
Normally fertilized ovules and aborted fertilized
ovules were separated from nagk/NAGK plants 5 d after
fertilization and then observed by whole-mount clearing technique. In normally fertilized ovules, embryos
had developed into torpedo-shaped embryos (Figure
2E), while in small aborted fertilized ovules the embryos
remained at the four-celled stage (Figure 2F), indicating
nagk is embryo lethal.
To further confirm that defective seed development
phenotype was caused by the loss of function of
AT3G57560, a genomic fragment of AT3G57560 was
cloned in a kanamycin resistant vector and introduced
into nagk/NAGK plants. The seedlings showing both
kanamycin resistance and hygromycin resistance were
designated complementation lines, and were transplanted to soil. In the complementation lines, normal
seed development was restored (Figure 2D). These
results indicated that the AT3G57560 genomic fragments could successfully complement the nagk/NAGK
plants phenotype.
NAGK is a plastid-localized protein expressed in the
majority of developmental processes in Arabidopsis
The iPSORT prediction program predicted that NAGK is
targeted to plastid (Bannai et al. 2002). To confirm
NAGK localization, plants co-expressing 35S::NAGK-GFP
and the plastid marker 35S::Plastid-RFP were produced
by crossing and examined with confocal laser scanning
microscopy. In root cells, NAGK-GFP was found to colocalize with the plastid-localized RFP (Figure 3A–D),
indicating that NAGK is a plastid-localized protein. In
petal cells, NAGK-GFP was found to locate to sub-plastid
(Figure 3E–H), indicating that arginine synthesis catalyzed by NAGK is compartmented within the plastid of
petal cells. The results indicated that NAGK is a nuclearencoded and plastid-localized protein.
XXX 2017 | Volume XXXX | Issue XXXX | XXX-XX
Real time RT–PCR analysis showed that transcripts
for NAGK are expressed in the root, shoot, leaf and
flower (Figure 4A). To further analyze the expression
pattern of NAGK, we fused a 2010 bp fragment of its
native promoter to the GUS reporters and produced
pNAGK::GUS. The transgenic T2 progeny of pNAGK::GUS
homozygous lines showed high GUS activity in the root
of seedlings and relative weaker signal in the leaf
(Figure 4B). Regarding inflorescence developmental
stages, the GUS signal was observed in the whole
inflorescence (Figure 4C) and mature pollens (Figure
4D). To further verify the expression pattern of NAGK in
plants, we analyzed transgenic Arabidopsis plants
containing a protein fusion construct in which the
NAGK promoter and the entire NAGK coding sequence
were fused to GFP (pNAGK::NAGK-GFP). This construct
was sufficient to rescue the mutant phenotype of the
nagk/NAGK plants, suggesting that expression of this
construct mimics that of the endogenous gene. As
shown in Figure 4E, pNAGK::NAGK-GFP expression was
detected in the root. To determine whether pNAGK::
NAGK-GFP is expressed in reproductive organs, we
analyzed its expression in flowers at stage 12c or after
fertilization. pNAGK::NAGK-GFP expressed in pollens
(Figure 4F), female gametophytes (Figure 4G) and
embryos (Figure 4H), suggesting NAGK plays a role in
these tissues.
AtNAGK rescued a NAGK-Deficient E. coli mutant
To test whether AtNAGK has the predicted function of a
NAGK, we examined its ability to restore arginine
autotrophy in the NAGK-deficient E. coli mutant strain
JW5553-1 (Baba et al. 2006). For heterologous expression of the Arabidopsis NAGK, the coding region of
AtNAGK cDNAs with or without the transit peptide
sequences (NAGKDTP) were amplified and cloned into
the expression vector pET-28a to produce a NAGK
plasmid and a NAGKDTP plasmid. As expected, the
www.jipb.net
NAGK is critical for gametophytes and embryo development
5
Figure 3. Localization of NAGK-GFP protein is in the plastid
Plant coexpressing NAGK-GFP and the chloroplast marker chloroplast-RFP were examined with confocal laser
scanning microscopy. (A–D) Colocalization in root cells. (A) Bright field of root cells. (B) Red fluorescent signal from
the plastid marker plastid-RFP. (C) Green fluorescent signal from NAGK-GFP. (D) Merged picture with green and red
signals showing colocalization. (E–H) Colocalization in petal cells. (E) Bright filed of petal cells. (F) Red fluorescent
signal from the plastid marker chloroplast-RFP. (G) Green fluorescent signal from NAGK-GFP. (H) Merged picture
with green and red signals showed that NAGK-GFP located into sub-chloroplast. Scale bar ¼ 40 mm.
JW5553-1 and JW5553-1 transformed with the empty
vector pET-28a or NAGK plasmid or NAGKDTP plasmid
were able to grow on medium containing arginine
(Figure 5A). The JW5553-1 and JW5553-1 transformed
with the empty vector pET-28a were unable to grow on
medium lacking arginine (Figure 5B). In contrast, the
JW5553-1 transformed with the NAGK plasmid or
NAGKDTP plasmid became arginine autotrophic (Figure
5B), indicating that Arabidopsis NAGK is an evolutionarily
conserved enzyme that functions as a NAGK to catalyzes
the synthesis of N-acetylglutamate-5-phosphate from
N-acetylglutamate.
nagk mutation affected both male and female
gametophytes
Our study showed that 44.14% (n ¼ 1,330) of nagk/NAGK
plants progeny seeds showed hygromycin resistance
(Hygr) (Table 2). The ratio was much lower than the
expected 75% ratio. In addition, nagk/NAGK plants siliques
showed aborted unfertilized ovules (Figure 1C). These
www.jipb.net
results suggested that nagk mutation affected the
development of gametophytes in addition to embryos.
To determine whether nagk mutation affected the
female gametophyte or the male gametophyte, we
assessed the nagk mutant transmission efficiency
through male/female gametophyte by reciprocal
crosses of nagk/NAGK plants and wild type plants. As
shown in Table 2, the Hygr ratio of the crossed line’s
seeds was 30.57% (n ¼ 700) when nagk/NAGK plants
were used as female parent, indicating a defect exists in
female gametophytes. However, the Hygr ratio
dropped to 4.05% (n ¼ 1,286) when nagk/NAGK plants
were used as male parent, demonstrating a stronger
defect occurred in the male gametophyte (Table 2).
nagk mutation lowered pollen tube competitiveness
We carried out a semi-in vitro pollen growth assay to
determine the defects occurring in the male gametophytes of nagk/NAGK plants. We pollinated pollen grains
of nagk/NAGK plants on wild type stigma. Pollinated
XXX 2017 | Volume XXXX | Issue XXXX | XXX-XX
6
Huang et al.
6.57% (n ¼ 198) of the pollen tubes were nagk pollen
tubes (marked by GFP) (Figure 5C). These results
indicated that nagk lowered pollen tube competitiveness due to nagk pollen tubes growing much slower
than wild type pollen tubes. As a result, few nagk
mutant pollen tubes could enter the ovules, leading to a
decrease of nagk mutant transmission efficiency
through male gametophytes.
Figure 4. The expression pattern of NAGK
(A) Real time RT-PCR analysis showed that transcripts
for NAGK were expressed in roots, shoot and flower,
with lower expression in leave. (B–D) GUS expression
pattern in different plant parts of transgenic pro NAGK::
GUS lines. (B) 14-d-old seedling. Strong GUS signal was
observed in root and shoot meristems. Leave showed a
relative weaker GUS signal. (C) The inflorescence
showed a strong GUS signal. (D) Pollens showed a
strong GUS signal. (E–H) GFP expression pattern in
different plant parts of transgenic pNAGK::NAGK-GFP.
(E) pNAGK::NAGK-GFP line showed GFP signal in plastids
of root. (F) pNAGK::NAGK-GFP line showed GFP signal in
plastids of pollens. (G) pNAGK::NAGK-GFP line showed
GFP signal in plastids of the ovule. Note female
gametophytes (surrounded by white line) showed
GFP signal. (H) pNAGK::NAGK-GFP expressed in plastids
of the embryo. Scale bar ¼ 4 mm for B; 2 mm for C;
50 mm for D; 100 mm for E and 20 mm for F–H.
pistils were cut 1 h later, and cultured on solid medium.
Pollen tubes could grow out of the cut end of the pistils
for several millimeters 6 h after pollination, but only
XXX 2017 | Volume XXXX | Issue XXXX | XXX-XX
Specific expression of NAGK in pollens and exogenous
application of arginine rescued the nagk pollen tube
growth phenotype
To test whether the decreased competitiveness of
mutant pollen tubes could be recovered by specific
expression of NAGK in nagk pollens, we transformed
nagk/NAGK plants with the pLAT52::NAGK construct. T2
pLAT52 complementation lines (nagk/NAGK, pLAT52::
NAGK/pLAT52::NAGK) were screened for the semi-in
vitro pollen growth assay. pLAT52 complementation line
(Figure 5D, 44.69%, n ¼ 179) showed significant difference (P < 0.01, Student’s t-test) in the ratio of GFP
pollen tubes penetrated through style when compared
to nagk mutant (Figure 5C, 6.57%, n ¼ 198). We further
crossed wild type with the pollens of the two pLAT52
complementation lines, respectively, to determine the
transmission efficiency of Hygr through the male
gametophytes. The results showed that the male
transmission efficiency of Hygr increased from 4.05%
(Table 2, data of the first arrow) to about 48% in both
two pLAT52 complementation lines (Table 2, data of
the fourth and fifth arrows). Together, these
results confirmed that nagk mutant lowered pollen
tube competitiveness in the style, and the decreased
competitiveness of nagk pollen tubes could be recovered by specifically compensating NAGK in pollens.
Since NAGK is a key enzyme for arginine biosynthesis,
it is reasonable to conclude that the insufficient arginine
in nagk pollen tubes decreases their competitiveness. We
investigated whether exogenous applications of arginine
(1 mmol/L) could rescue the defect of the nagk pollens.
The ratio of GFP pollen tubes (nagk background) that
penetrated through style increased to 39.13% (n ¼ 207)
when arginine was added into the medium (Figure 5E),
which is much higher than that of nagk pollen tubes
without exogenous arginine (6.57%, n ¼ 198, Figure 5C).
The results indicated that arginine deficiency is the major
cause for the defect of nagk pollen tubes.
www.jipb.net
NAGK is critical for gametophytes and embryo development
7
Figure 5. Arabidopsis NAGK is an evolutionarily conserved enzyme that functions as a NAGK involved in arginine
synthesis
(A, B) AtNAGK restores arginine autotrophy in the NAGK-deficient Escherichia coli mutant strain JW5553-1.
(A) Escherichia coli on medium containing arginine. (B) Escherichia coli on medium lacking arginine. 1, JW5553-1; 2,
JW5553-1 transformed with the empty expression vector pET-28a; 3, JW5553-1 transformed with vector containing
the coding region of AtNAGK cDNAs. 4, JW5553-1 transformed with vector containing the coding region of AtNAGK
cDNAs without the transit peptide sequences. (C–E) nagk mutant weakens pollen tube competitiveness. Pollens
from different lines were pollinated to the stigma of wild type. CLSM images of pollen tubes growth were obtained
after 6 h on semi-in vitro conditions. (C) Pollinated with pollens from nagk/NAGK plants showed pollen tubes of nagk
mutant (marked by GFP) are less and shorter than wild type pollen tubes (without GFP). (D) Pollinated with pollens
from LAT52 complement line (nagk/NAGK plants transformed with pLAT52::NAGK) showed that pollen tubes of nagk
mutant (marked by GFP) grew similar to that of wild type (without GFP). (E) Pollinated with pollens from nagk/NAGK
plants and supplemented with arginine showed that pollen tubes of nagk mutant (marked by GFP) grew similar to
that of wild type (without GFP). Scale bar ¼ 100 mm for (C) to (E).
nagk/NAGK plants were defective in micropylar pollen
tube guidance
Aborted unfertilized ovules were found in the siliques of
nagk. To determine the mechanism through which nagk
mutant affects female gametophytes, we investigated
whether pollen tube guidance was impaired in nagk/
NAGK plants. By aniline blue staining, we found that
100% of the ovules (n ¼ 199) had pollen tube entry in
Table 2. Segregation of the nagk1 mutation in selfed, reciprocally crossed with wild type or pLAT52
complementation lines offspring populations
Parental genotype
Progeny genotype
Female
Male
Hygr
Total seeds
Hygr ratio
nagk/NAGK
nagk/NAGK
wild type
wild type
wild type
nagk/NAGK
wild type
nagk/NAGK
LAT52::NAGK-1
LAT52:: NAGK 2
587
214
50
174
221
1,330
700
1,286
358
467
44.14%
30.57%
4.05%
48.6%
47.30%
www.jipb.net
XXX 2017 | Volume XXXX | Issue XXXX | XXX-XX
8
Huang et al.
Figure 6. nagk/NAGK plants formed morphologically normal but dysfunctional female gametophytes
(A, B) Aniline blue staining showed pollen tube guidance in ovules. Ovules attracted pollen tubes (indicated by
arrows) in wild type (A), but some ovules of nagk/NAGK plants lost their ability to guide pollen tubes entering the
micropyle and were unfertilized. (B) The stars in (A) and (B) indicated micropylar end of the ovules. (C, D) Cleared
whole mounts of female gametophytes. (C) A wild type ovule with mature embryo sac at stage FG7. Note the polar
nuclei fused to form a diploid central nucleus and antipodal nuclei were degenerated. (D) A mutant ovule with
normal mature embryo sac at stage FG7. (E–H) Expression of FGR 7.0 in wild-type (E and G) and nagk (F and H)
female gametophytes. Scale bar ¼ 20 mm.
wild-type pistils (Figure 6A), while 17.71% of ovules
(n ¼ 288) had no pollen tube entry in mutant pistils
(Figure 6B). These observations revealed that some
mutant ovules lost their ability to guide pollen tube
growth to the micropyle, resulting in aborted unfertilized ovules in nagk/NAGK plants.
nagk/NAGK plants formed morphologically normal but
dysfunctional female gametophytes
To determine the mechanism leading to the loss of
ability to guide pollen tubes in mutant ovules, we firstly
analyzed female gametophytes at the terminal developmental stage (stage FG7) (Christensen et al. 1997).
We emasculated flowers at stage 12c (Smyth et al. 1990;
Christensen et al. 1997), waited 24 h, and observed
ovules by whole-mount clearing. Wild-type female
gametophytes at this stage have one egg cell, two
synergid cells and one central cell (Figure 6C); the
three antipodal cells undergoing cell death are hardly
detected (Christensen et al. 1997). In nagk female
gametophytes, the egg cell, two synergid cells and one
XXX 2017 | Volume XXXX | Issue XXXX | XXX-XX
central cell appeared similar to those of wild type plants
(Figure 6D). The results indicated that nagk female
gametophytes could reach the terminal developmental
stage morphologically.
It is possible that these morphologically normal
female gametophytes have alterations in cell fate
specification, thus losing their ability of guiding pollen
tube growth. To test the possibility, we crossed a
€lz
triple marker of female gametophytes FGR7.0 (Vo
et al. 2013) with nagk/NAGK plants and analyzed their
segregation patterns in the F2 generations. Typical
marker patterns in FGR7.0 ovules are shown in Figure
6E and 6G. In transgenic plant lines heterozygous for
the nagk mutation and homozygous for the FGR7.0,
75.68% of ovules (n ¼ 370) displayed the same
fluorescent pattern as FGR7.0, while 12.97% of ovules
showed a weak fluorescent signal (Figure 6F, H),
and 11.35% of ovules showed no fluorescent signal.
The above phenotypic analysis indicated that nagk
specifically affects cell fate specification in female
gametophytes.
www.jipb.net
NAGK is critical for gametophytes and embryo development
9
Figure 7. Aborted ovules in nagk/NAGK plants could be rescued by specific expression of NAGK in the synergid
cells
(A) An ovule expressing pDD31::NAGK-GFP in the synergids. NAGK-GFP is localized to plastid. (B) Ovules phenotype in
wild type plants, nagk/NAGK plants, two independent transformant lines of pDD31::NAGK-GFP in the nagk/NAGK
plants background (DD31 line 1 and DD31 line 2), and nagk/NAGK plants was watered with ornithine or arginine
supplementation. Scale bar ¼ 10 mm.
Specific expression of NAGK in the synergid cells
rescued the mutant phenotype
Synergid cells play an important role in pollen tube
guidance (Higashiyama et al. 2001; Kasahara et al. 2005;
Okuda et al. 2009). Since nagk specifically affected
female gametophytes cell fate specification and pollen
tube guidance, it was reasonable to investigate whether
synergid cells were dysfunctional in nagk/NAGK plants.
We restricted the expression of NAGK to the synergid
cell using a synergid cell–specific DD31 promoter
(Steffen et al. 2007). We introduced the transgene
pDD31::NAGK-GFP into the nagk/NAGK plants (Figure 7A).
Two independent transgenic plants (DD31 lines 1 and 2)
were obtained and they showed significant decrease of
the unfertilized ovules (5.2% and 7.1%) compared with
nagk (19.50%) (Figure 7B). Our results suggested that
NAGK was required for the synergid cell functional
specification, which was necessary for pollen tube
guidance.
Aborted ovules could not be rescued by watering
nagk/NAGK plants with ornithine or arginine
supplementation
We investigated whether supplemental arginine could
rescue aborted ovules in nagk/NAGK plants. Solution
containing 1mM arginine was supplied to the roots of
nagk/NAGK plants during daily watering. We detected
www.jipb.net
the development of ovules in siliques that were formed
after arginine being added. The results showed the ratio
of aborted ovules in the nagk/NAGK plants watered with
arginine is similar to that of nagk/NAGK plants without
exogenous arginine (Figure 7B), indicating that the
exogenous application of arginine could not rescue the
aborted ovules of nagk/NAGK plants.
As ornithine is an intermediate in arginine biosynthesis, we also tested its ability to rescue nagk/NAGK
plants. The results showed that the ratio of aborted
ovules in the nagk/NAGK plants watered with 1mM
ornithine is similar with that of nagk/NAGK plants (Figure
7B), indicating that the exogenous application of
ornithine could not rescue the aborted ovules of
nagk/NAGK plants.
DISCUSSION
AtNAGK encodes a plastid-localized N-acetylglutamate
kinase
NAGK catalyzes the second step in the arginine
biosynthetic pathway. The reaction catalyzed by
NAGK involves two substrates, ATP and NAG, in which
NAGK transfers the phosphate group from ATP to NAG
to form N-acetylglutamyl-phosphate. Based on its
sequence similarity to NAGK from other species,
XXX 2017 | Volume XXXX | Issue XXXX | XXX-XX
10
Huang et al.
AtNAGK has been proposed to function in the arginine
biosynthetic pathway and be localized to plastid in
Arabidopsis (Slocum 2005). We showed that AtNAGKGFP fusion protein was localized to plastid. This is
consistent with the database prediction of a plastid
localization of NAGK and immuno-histological staining
observations (Chen et al. 2006). We showed that the
phenotype of our T-DNA mutant line was indeed due
to an insertion mutation in a gene encoding the
Arabidopsis NAGK required for arginine biosynthesis.
The validity of our mutant and the function of AtNAGK
were supported by the finding that the nagk pollen
tube phenotype could be complemented by supplementation with arginine, which is synthesized downstream of NAGK. Furthermore, we showed that
Arabidopsis NAGK could rescue a NAGK-deficient
E. coli mutant. Recombinant AtNAGK can catalyze
ATP and NAG to form N-acetylglutamyl-phosphate in
vitro (Chen et al. 2006). Together, these results
indicated that Arabidopsis NAGK is an evolutionarily
conserved enzyme that functions as a plastid-localized
NAGK to catalyze the synthesis of N-acetylglutamate5-phosphate from N-acetylglutamate.
AtNAGK is required for embryo development
Phenotype analysis of nagk/NAGK plants revealed the
requirement of NAGK for early embryo development.
The homozygous nagk/nagk plants could not be
recovered, and in small aborted fertilized ovules the
embryos remained at the four-celled stage nagk/NAGK
plants. These results indicated that arginine was
essential for embryo development.
The embryo lethal phenotype of nagk/NAGK plants
indicated that surrounding maternal tissues were
unable to provide sufficient arginine to support
continued embryo development, suggesting embryos
at least need a certain degree of arginine autotrophy.
Embryo lethality had been also reported in other amino
acid biosynthesis mutants, including mutants in lysine
biosynthesis (Song et al. 2004; Hudson et al. 2006),
histidine biosynthesis (Muralla et al. 2007) and proline
kely et al. 2008). Mutants of
biosynthesis genes (Sze
four different histidine biosynthetic genes (HISN2,
HISN3, HISN4, HISN6A) were shown to exhibit an
embryo-defective phenotype that could be rescued by
watering heterozygous plants with histidine supplementation. In contrast, nagk embryo-defective phenotype could not be rescued by watering heterozygous
XXX 2017 | Volume XXXX | Issue XXXX | XXX-XX
plants with arginine or ornithine. These results suggested that Arabidopsis embryos are completely arginine autotrophic and little arginine was transported by
the maternal tissue to the early embryos.
Arginine is required for synergid functional
specification for pollen tube guidance
In the sexual reproduction of flowering plants,
successful double fertilization depends on the delivery
of two immotile sperm cells through the tip growth of
pollen tube to the female gametophyte. Early studies
based on mutant analysis showed that the pollen tube is
precisely guided by female gametophyte to achieve
fertilization (Hulskamp et al. 1995; Ray et al. 1997;
Shimizu and Okada 2000). Cell ablation experiment
indicated that two synergid cells are essential for the
attraction of the pollen tube to the ovule in Torenia
fournieri (Higashiyama et al. 2001). Then the pollen tube
attractants, defensin-like cysteine-rich LURE peptides,
secreted from the synergid cell were identified in
Torenia fournieri and Arabidopsis thaliana (Okuda et al.
2009; Takeuchi and Higashiyama 2012). Recently two
groups identified several molecules located on the
pollen tube membrane as the receptors of AtLURE1
(Takeuchi and Higashiyama 2016; Wang et al. 2016).
Aniline blue staining showed that 17.71% ovules lost
their ability to guide pollen tubes in nagk/NAGK plants.
We further showed that 24.32% of ovules displayed
abnormal female gametophyte marker FGR7.0 in nagk/
NAGK plants. These results indicated that about 20%
female gametophytes cannot fulfill their functional
specification in nagk/NAGK plants. The female gametophytes in nagk/NAGK plants, however, were morphologically normal compared to those of the wild type,
suggesting functional specification of female gametophytes is uncoupled from their morphology.
Loss of function of NAGK resulted in a pollen tubes
guidance defect, while restricting the expression of
NAGK to the synergid cell in nagk/NAGK plants rescued
the phenotype. Regarding NAGK’s role in arginine
synthesis, we suggested that arginine was required for
synergid functional specification, which appeared
necessary for pollen tube guidance. This may provide
a novel clue for the establishment of signals in synergid
cells for male and female gametophyte interaction.
It is interesting to know how the arginine plays its
regulatory role in these critical developmental processes.
Based on the work described above arginine does not
www.jipb.net
NAGK is critical for gametophytes and embryo development
only act as an essential nutrient, since other amino acid
biosynthesis mutants are embryo lethality but do not
show synergid cell defects (Song et al. 2004; Hudson
kely et al. 2008).
et al. 2006; Muralla et al. 2007; Sze
However, we don’t have sufficient evidence yet to
confirm its function as a signaling molecule in these
processes. Obviously, further much more works are
required to clarify whether arginine serves as an essential
nutrient or a signaling molecule in plant reproduction.
MATERIALS AND METHODS
Plant materials and growth conditions
The nagk allele was isolated from our mutant library
with hygromycin resistance (Wu et al. 2012; Xie et al.
2016; Yan et al. 2016). The transgenic line FGR7.0, a
reporter that combines the marker genes for synergids,
€lz et al.
egg cell, and central cell on one plasmid (Vo
2013), was kindly provided by Professor Rita Groß-Hardt
(University of T€
ubingen, Germany). Seeds were surface
sterilized with 20% bleach for 10 min, and washed three
times with sterile distilled water. Seeds were stratified
for 3 d at 4 °C, and then sown on 1/2 MS plates with 1.0%
(w/v) sucrose. Agar plates were placed in a growth
room with a photoperiod of 16 h light/8 h dark. For
kanamycin selection, 50 mg/L of kanamycin (Sigma) was
supplemented to the media. Similarly, 50 mg/L of
hygromycin (Roche) was added for hygromycin selection. For Basta selection, 10-d old seedlings were
selected by spraying them with 0.1% BASTA herbicide
in the greenhouse, and repeated two times at 4-d
intervals. Plants were grown in soil in a greenhouse
under long-day conditions (16 h light/8 h dark) at 22 °C.
Cloning of the T-DNA flanking sequence of the nagk
The T-DNA flanking sequence in the nagk mutant was
cloned by TAIL-PCR (Liu et al. 1995). The authenticity of
the cloned sequence was confirmed by PCR using a pair
of primers located around the T-DNA border region
(nagk-T1: CTGTTTTATTTCCCGCTACAAGATG; LB-S: CCAA
AATCCAGTACTAAAATCCAG). nagk-T1 is a gene-specific
primer and LB-S is a T-DNA specific primer.
Vector construction and plant transformation
Plasmid P092, P093, P094, 35S::EGFP construct and 35S::
RFP construct were produced as previously described
(Xie et al. 2016; Yan et al. 2016). To generate the
www.jipb.net
11
genomic complementation construct, a 3,533-bp wildtype genomic sequence containing the AT3g57560
gene, 2,010-bp upstream of the ATG codon and 479bp downstream of the TAA codon sequences, was PCRamplified with primers NAGK-F1: NNNNGGTACCTTCCAACAAGAAGAGAGCAGTAGAG and NAGK-R1: NNNNGAATT
CCAGAGCTAAACAAACAAACAAATGAG from genomic
DNA and then was cloned into the P092 plasmid. To
investigate the expression pattern of NAGK, we
amplified NAGK promoter with primers NAGK-F1 and
NAGK-R2: NNNNCTCGAGTCCTGAACCTTACCGGAGAAGG
and clone it upstream of GUS in P093 to generate
pNAGK::GUS. To produce the pNAGK::NAGK-GFP construct, we amplified the NAGK promoter and the entire
NAGK coding sequence with primers NAGK-CDS2:
NNNNCTCGAGTCCAGTAATCATAGTTCCAGCTCCTTC and
NAGK-F1 from genomic DNA and cloned it into P094.
To examine the subcellular localization of NAGK, the
NAGK ORF was amplified with primers NAGK-CDS1:
NNNNGGTACCGCCACCATGGCCACCGTCACATCC and NA
GK-CDS2 from genomic DNA and cloned into 35S::EGFP
plasmid to generate a 35S::NAGK-EGFP construct. To
produce the plastid marker line, we amplified and cloned
the 168bp DNA fragment containing the plastid-targeted
pre-sequence of RECA1 gene AT1G79050 (Cerutti et al.
1992) with primers RECA-1: NNNN GGTACCGCCACCATGGATTCACAGCTAGTCTTGTCTC and RECA-2: NNNNCTGCAGGAGTTTCTTCGCGGCGTAG into 35S::RFP to generate 35S::
Plastid-RFP construct. To specifically express NAGK in the
pollens, the nopaline synthase (NOS) terminator was
amplified with primers NOST-1: NNNNAAGCTTACCAGCTCGAATTTCCCCG and NOST-2: NNNNGAATTCCCGATCTAGTAACATAGATGACACC and cloned into P092 to produce
P105. Then the promoter of pollen specific gene LAT52
(Twell et al. 1989) was amplified with primers LAT-23:
NNNN CCAACGCGTTGGTGTCGACATACTCGACTCAGAAG
LAT-24: NNNNGAGCTCTTTAAATTGGAATTTTTTTTTTTGG
and cloned into P105 to generate P175. Then the NAGK
ORF was cloned into P175 to generate and pLAT52::NAGKNosT construct
To specifically express NAGK in synergid cells, we
amplified a synergid cell–specific DD31 promoter
(Steffen et al. 2007) using primers DD31-1: NNNNC
CAACGCGTTGGACCCACACGAAGAATCGGAC and DD31-2:
NNNNGAGCTCTTTTTTTATGGATGTAAGAATACTT TTAGTATTG and cloned it into P094 to produce pDD31::GFP.
Then the NAGK ORF was cloned into pDD31::GFP to
generate and pDD31::NAGK-GFP construct.
XXX 2017 | Volume XXXX | Issue XXXX | XXX-XX
12
Huang et al.
All constructs were transformed into Agrobacterium
tumefaciens strain GV3101, and then transformed into
Arabidopsis plants by floral dipping (Clough and Bent
1998).
Phenotype characterization of embryo and female
gametophyte development
To detect the embryo development, seeds of 5 d after
fertilization were dissected from siliques and cleared
using a chloral hydrate solution (Breuninger et al. 2008).
To detect the female gametophyte development, we
emasculated flowers at stage 12c (Christensen et al.
1997), waited 24 h, and observed ovules by wholemount clearing (Wu et al. 2012). The cleared seeds were
placed under a microscope (Olympus) fitted with
differential interference contrast optics for imaging.
Semi-in vitro pollen tube growth assays
Semi-in vitro pollen tube growth assay was performed
as previously described (Palanivelu and Preuss 2006).
Pollen germination medium containing 1 mmol/L CaCl2,
1 mmol/L Ca(NO3)2, 1 mmol/L MgSO4, 0.01% H3BO4, 18%
sucrose and 1% agarose, which was modified from
recent reports (Dou et al. 2016; Liao et al. 2016). After
hand-pollination, pistils were cut at the shoulder region
of the ovaries. Cut pistils were incubated on pollen tube
growth medium with or without arginine (1 mmol/L)
at 28 °C.
synthesized using oligo-dT and M-MLV reverse transcriptase (Invitrogen). Quantitative PCR analysis was
performed using FastStart Essential DNA Green Master
(Roche) on a CFX ConnectTM Real-Time System
(BioRad). Each experiment was repeated three times
and samples were normalized using UBQ10 expression.
Data acquisition and analyses used the Bio-Rad CFX
Manager software; relative expression levels were
measured using the 2(-DDCt) analysis method and the
error bars represent the variance of three replicates.
The primers used for detection of NAGK mRNA
expression are NAGK–D1: TCGTCTTCTCACAGCACGAC
and NAGK–D2: AGCGGACGTAACACAGATGG. The primers
used for detection of UBQ10 mRNA expression are
UBQ10-D1: GGCCTTGTATAATCCCTGATGAATAAG and
UBQ10–D2: AAAGAGATAACAGGAACGGAAACATAGT.
Analysis of subcellular localization of NAGK
The iPSORT prediction program predicted that NAGK is
targeted to the plastid. To confirm its plastid localization, transgenic plants containing p35S::NAGK-EGFP
construct were crossed with a transgenic mitochondrial
marker line expressing 35S::Plastid-RFP. The root cells
and petal cells of the F1 progeny were visualized using a
FV1000 confocal laser-scanning microscope (CLSM;
Olympus). GFP fluorescence was detected with excitation at 488 nm and emission at 510–530 nm; RFP
fluorescence was detected with excitation at 568 nm
and emission at 590–620 nm.
Histochemical analysis of GUS activity
The histochemical analysis of GUS activity was performed as previously described (Vielle-Calzada et al.
2000). Plant tissues were incubated at 37 °C in GUS
staining solution (2 mmol/L 5-bromo-4-chloro-3-indolyl
glucuronide (X-Gluc) in 50 mmol/L sodium phosphate
buffer, pH 7.0) containing 0.1% Triton X-100, 2 mmol/
L K4Fe(CN)6 and 2 mmol/L K3Fe(CN)6. The stained tissues
were then transferred to 70% (v/v) ethanol solution.
Samples were mounted with clearing solution and
placed under a microscope (Olympus) fitted with
differential interference contrast optics for imaging.
Aniline blue Staining of Pollen Tubes
To visualize pollen tubes, siliques were fixed immediately in Carnoy’s fixative (acetic-acid/methanol, 1:3)
twice. The fixed sample was rinsed twice with distilled
water and then put in 5M NaOH overnight. Siliques were
then rinsed twice with distilled water and subsequently
stained with 0.1% aniline blue (Sigma–Aldrich) for 4 h.
The ovary walls of the stained siliques were removed
with a fine needle under a stereoscope. Then the
samples were observed using a microscope (Olympus)
equipped with an epifluorescence UV filter set.
Quantitative RT-PCR
Total RNA of root, shoot, inflorescence and leaf were
individually extracted using the RNAqueous Phenol-free
total RNA Isolation kit (Ambion) according to the
manufacturer’s protocol. After digestion with RNasefree DNase I (Promega), the first strand of cDNA was
Analysis of the expression pattern of pNAGK::
NAGK-GFP
For fluorescent marker line analysis, ovules of Arabidopsis at specific development periods were collected
and put on a 30 mm diameter culture plate with a drop
of 10% glycerin added to 80 mmol/L sorbitol. A sharp
XXX 2017 | Volume XXXX | Issue XXXX | XXX-XX
www.jipb.net
NAGK is critical for gametophytes and embryo development
capillary glass tube was used as a dissection tool to
extract the embryos from maternal tissues (Yan et al.
2016). The isolated embryos, pollens, ovules and roots
of pNAGK::NAGK-GFP lines were visualized using a
FV1000 confocal laser-scanning microscope (CLSM;
Olympus). GFP fluorescence was detected with excitation at 488 nm.
Analysis of FGR7.0 in nagk female gametophytes
To analyze FGR7.0 expression in the nagk mutant
background, nagk/NAGK plants acted as females and
were crossed with plants homozygous for the reporter
construct FGR7.0. F1 plants heterozygous for the nagk
(hygromycin resistance) and hemizygous for FGR7.0
(Basta resistance) were allowed to self-cross. F2 plants
heterozygous for the nagk and homozygous for FGR7.0
were selected for fluorescence analysis. One-quarter of
these plants should also be homozygous for FGR7.0.
Analysis of FGR7.0 expression was performed at stage
FG7. Flowers were emasculated at stage 12c and pistils
were collected at 24 h after emasculation. The ovules
were dissected and visualized using a CLSM (Leica). GFP
fluorescence was detected with excitation at 488 nm
and emission at 510–550 nm; RFP fluorescence was
detected with excitation at 568 nm and emission at
590–620 nm.
Functional complementation of an E. coli mutant
defective in NAGK
The E. coli strain JW5553-1 with a deletion in argB
(homologous gene of NAGK) was provided by the Coli
Genetic Stock Center (CGSC) at Yale. The coding region of
AtNAGK cDNAs was amplified with the primers Q5-R1:
NNNNCCATGGGACGAGGTAAAACCATAGTTGTCAAAT and
Q5-R3: NNNNCTCGAGTTATCCAGTAATCATAGTTCCAGCTC
CTTC. In addition, the coding region of AtNAGK cDNAs
lacking the transit peptide sequences (NAGKDTP) was
amplified with the primers Q5-R2: NNNNCCATGGGAGCCACCGTCACATCCAATG and Q5-R3: NNNNCTCGAGTTATCCAGTAATCATAGTTCCAGCTCCTTC. The two fragments
were cloned into expression vector pET-28a respectively
to produce NAGK plasmid and NAGKDTP plasmid. The two
plasmids and the empty vector pET-28a were transformed
into JW5553-1. Transformed E. coli strains and JW5553-1
were grown on synthetic defined medium containing
20 mg arginine or without arginine to test arginine
autotrophy.
www.jipb.net
13
ACKNOWLEDGEMENTS
We thank Professor Rita Groß-Hardt for providing the
transgenic line FGR7.0. This work was supported by the
Fund of Key Basic Theory Research of Ministry of
Science and Technology of China (2013CB945100) and
the National Natural Science Foundation of China
(31570317, 31270362).
AUTHOR CONTRIBUTIONS
J.H., D.C., H.Y., F.X., Y.Y., L.Z. and X.P. performed the
experiments. X.P. and M.S. wrote the manuscript. X.P.
and M.S. designed the experiments. X.P. revised the
manuscript.
REFERENCES
Baba T, Ara T, Hasegawa M, Takai Y, Okumura Y, Baba M,
Datsenko KA, Tomita M, Wanner BL, Mori H (2006)
Construction of Escherichia coli K-12 in-frame, single-gene
knockout mutants: The Keio collection. Mol Syst Biol 2: 1–11
Bannai H, Tamada Y, Maruyama O, Nakai K, Miyano S (2002)
Extensive feature detection of N-terminal protein sorting
signals. Bioinformatics 18: 298–305
Breuninger H, Rikirsch E, Hermann M, Ueda M, Laux T (2008)
Differential expression of WOX genes mediates apical-basal
axis formation in the Arabidopsis embryo. Dev Cell 14: 867–876
Burillo S, Luque I, Fuentes I, Contreras A (2004) Interactions
between the nitrogen signal transduction protein PII and
N-acetyl glutamate kinase in organisms that perform
oxygenic photosynthesis. J Bacteriol 186: 3346–3354
Caldovic L, Tuchman M (2003) N-acetylglutamate and its
changing role through evolution. Biochem J 372: 279–290
Cerutti H, Osman M, Grandoni P, Jagendorf AT (1992)
A homolog of Escherichia coli RecA protein in plastids of
higher plants. Proc Natl Acad Sci USA 89: 8068–8072
Chen YM, Ferrar TS, Lohmeier-Vogel EM, Morrice N, Mizuno Y,
Berenger B, Ng KK, Muench DG, Moorhead GB (2006) The
PII signal transduction protein of Arabidopsis thaliana
forms an arginine-regulated complex with plastid N-acetyl
glutamate kinase. J Biol Chem 281: 5726–5733
Christensen CA, King EJ, Jordan JR, Drews GN (1997)
Megagametogenesis in Arabidopsis wild type and the Gf
mutant. Sex Plant Reprod 10: 49–64
Cleland EE, Harpole WS (2010) Nitrogen enrichment and plant
communities. Ann N Y Acad Sci 1195: 46–61
Clough SJ, Bent AF (1998) Floral dip: A simplified method for
Agrobacterium-mediated transformation of Arabidopsis
thaliana. Plant J 16: 735–7430
XXX 2017 | Volume XXXX | Issue XXXX | XXX-XX
14
Huang et al.
Crawford NM (2006) Mechanisms for nitric oxide synthesis in
plants. J Exp Bot 57: 471–478
Cunin R, Glansdorff N, Pierard A, Stalon V (1986) Biosynthesis
and metabolism of arginine in bacteria. Microbiol Rev 50:
314–352
Davis RH (1986) Compartmental and regulatory mechanisms
in the arginine pathways of Neurospora crassa and
Saccharomyces cerevisiae. Microbiol Rev 50: 280–313
Liu YG, Mitsukawa N, Oosumi T, Whittier RF (1995) Efficient
isolation and mapping of Arabidopsis thaliana T-DNA insert
junctions by thermal asymmetric interlaced PCR. Plant J 8:
457–463
Llacer JL, Fita I, Rubio V (2008) Arginine and nitrogen storage.
Curr Opin Struct Biol 18: 673–681
McKay G, Shargool PD (1981) Purification and characterization
of N-acetylglutamate 5-phosphotransferase from pea
(Pisum sativum) cotyledons. Biochem J 195: 71–81
Dou XY, Yang KZ, Ma ZX, Chen LQ, Zhang XQ, Bai JR, Ye D
(2016) AtTMEM18 plays important roles in pollen tube and
vegetative growth in Arabidopsis. J Integr Plant Biol 58:
679–692
Micallef BJ, Shelp BJ (1989) Arginine metabolism in developing soybean cotyledons: III. Utilization. Plant Physiol 91:
170–174
Feria Bourrellier AB, Ferrario-Mery S, Vidal J, Hodges M (2009)
Metabolite regulation of the interaction between Arabidopsis thaliana PII and N-acetyl-l-glutamate kinase. Biochem Biophys Res Commun 387: 700–704
Molesini B, Mennella G, Martini F, Francese G, Pandolfini T
(2015) Involvement of the putative N-acetylornithine
deacetylase from Arabidopsis thaliana in flowering and
fruit development. Plant Cell Physiol 56: 1084–1096
Forchhammer K (2008) P(II) signal transducers: Novel functional
and structural insights. Trends Microbiol 16: 65–72
Molla-Morales A, Sarmiento-Manus R, Robles P, Quesada V,
Perez-Perez JM, Gonzalez-Bayon R, Hannah MA, Willmitzer L, Ponce MR, Micol JL (2011) Analysis of ven3 and
ven6 reticulate mutants reveals the importance of
arginine biosynthesis in Arabidopsis leaf development.
Plant J 65: 335–345
Fremont N, Riefler M, Stolz A, Schmulling T (2013) The
Arabidopsis TUMOR PRONE5 gene encodes an acetylornithine aminotransferase required for arginine biosynthesis
and root meristem maintenance in blue light. Plant Physiol
161: 1127–1140
Grun S, Lindermayr C, Sell S, Durner J (2006) Nitric oxide and
gene regulation in plants. J Exp Bot 57: 507–516
Muralla R, Sweeney C, Stepansky A, Leustek T, Meinke D
(2007) Genetic dissection of histidine biosynthesis in
Arabidopsis. Plant Physiol 144: 890–903
Higashiyama T, Yabe S, Sasaki N, Nishimura Y, Miyagishima S,
Kuroiwa H, Kuroiwa T (2001) Pollen tube attraction by the
synergid cell. Science 293: 1480–1483
Neill S, Bright J, Desikan R, Hancock J, Harrison J, Wilson I
(2008) Nitric oxide evolution and perception. J Exp Bot 59:
25–35
Hudson AO, Singh BK, Leustek T, Gilvarg C (2006) An LLdiaminopimelate aminotransferase defines a novel variant
of the lysine biosynthesis pathway in plants. Plant Physiol
140: 292–301
Okuda S, Tsutsui H, Shiina K, Sprunck S, Takeuchi H, Yui R,
Kasahara RD, Hamamura Y, Mizukami A, Susaki D, Kawano
N, Sakakibara T, Namiki S, Itoh K, Otsuka K, Matsuzaki M,
Nozaki H, Kuroiwa T, Nakano A, Kanaoka MM, Dresselhaus
T, Sasaki N, Higashiyama T (2009) Defensin-like polypeptide LUREs are pollen tube attractants secreted from
synergid cells. Nature 458: 357–361
Huergo LF, Chandra G, Merrick M (2013) P(II) signal
transduction proteins: Nitrogen regulation and beyond.
FEMS Microbiol Rev 37: 251–283
Hulskamp M, Schneitz K, Pruitt RE (1995) Genetic evidence for
a long-range activity that directs pollen tube guidance in
Arabidopsis. Plant Cell 7: 57–64
Kalamaki MS, Alexandrou D, Lazari D, Merkouropoulos G,
Fotopoulos V, Pateraki I, Aggelis A, Carrillo-Lopez A, RubioCabetas MJ, Kanellis AK (2009a) Over-expression of a
tomato N-acetyl-L-glutamate synthase gene (SlNAGS1) in
Arabidopsis thaliana results in high ornithine levels and
increased tolerance in salt and drought stresses. J Exp Bot
60: 1859–1871
Kalamaki MS, Merkouropoulos G, Kanellis AK (2009b) Can
ornithine accumulation modulate abiotic stress tolerance
in Arabidopsis? Plant Signal Behav 4: 1099–1101
Kasahara RD, Portereiko MF, Sandaklie-Nikolova L, Rabiger
DS, Drews GN (2005) MYB98 is required for pollen tube
guidance and synergid cell differentiation in Arabidopsis.
Plant Cell 17: 2981–2992
Liao HZ, Zhu MM, Cui HH, Du XY, Tang Y, Chen LQ, Ye, Zhang
XQ (2016) MARIS plays important roles in Arabidopsis
pollen tube and root hair growth. J Integr Plant Biol 58:
927–940
XXX 2017 | Volume XXXX | Issue XXXX | XXX-XX
Palanivelu R, Preuss D (2006) Distinct short-range ovule
signals attract or repel Arabidopsis thaliana pollen tubes in
vitro. BMC Plant Biol 6: 7
Preuss D, Rhee SY, Davis RW (1994) Tetrad analysis possible in
Arabidopsis with mutation of the QUARTET (QRT) genes.
Science 264: 1458–1460
Quesada V, Ponce MR, Micol JL (1999) OTC and AUL1, two
convergent and overlapping genes in the nuclear genome
of Arabidopsis thaliana. FEBS Lett 461: 101–106
Ray SM, Park SS, Ray A (1997) Pollen tube guidance by the
female gametophyte. Development 124: 2489–2498
Shimizu KK, Okada K (2000) Attractive and repulsive
interactions between female and male gametophytes in
Arabidopsis pollen tube guidance. Development 127:
4511–4518
Slocum RD (2005) Genes, enzymes and regulation of arginine
biosynthesis in plants. Plant Physiol Biochem 43: 729–745
Smyth DR, Bowman JL, Meyerowitz EM (1990) Early flower
development in Arabidopsis. Plant Cell 2: 755–767
Song JT, Lu H, Greenberg JT (2004) Divergent roles in
Arabidopsis thaliana development and defense of two
www.jipb.net
NAGK is critical for gametophytes and embryo development
homologous genes, aberrant growth and death2 and
AGD2-LIKE DEFENSE RESPONSE PROTEIN1, encoding
novel aminotransferases. Plant Cell 16: 353–366
Steffen JG, Kang IH, Macfarlane J, Drews GN (2007)
Identification of genes expressed in the Arabidopsis
female gametophyte. Plant J 51: 281–292
kely G, Abraham E, Cseplo A, Rigo G, Zsigmond L, Csiszar J,
Sze
Ayaydin F, Strizhov N, Jasik J, Schmelzer E, Koncz C,
Szabados L (2008) Duplicated P5CS genes of Arabidopsis
play distinct roles in stress regulation and developmental
control of proline biosynthesis. Plant J 53: 11–28
Takahashi T, Kakehi J (2010) Polyamines: Ubiquitous polycations with unique roles in growth and stress responses.
Ann Bot 105: 1–6
Takeuchi H, Higashiyama T (2012) A species-specific cluster of
defensin-like genes encodes diffusible pollen tube attractants in Arabidopsis. PLoS Biol 10: e1001449
Takeuchi H, Higashiyama T (2016) Tip-localized receptors
control pollen tube growth and LURE sensing in
Arabidopsis. Nature 531: 245–248
Twell D, Wing R, Yamaguchi J, McCormick S (1989) Isolation
and expression of an anther-specific gene from tomato.
Mol Gen Genet 217: 240–245
Uhrig RG, Ng KK, Moorhead GB (2009) PII in higher plants: A
modern role for an ancient protein. Trends Plant Sci 14:
505–511
€lz R, Heydlauff J, Ripper D, von Lyncker L, Groß-Hardt R
Vo
(2013) Ethylene signaling is required for synergid
Scan using WeChat with your
smartphone to view JIPB online
www.jipb.net
15
degeneration and the establishment of a pollen tube
block. Dev cell 25: 310–316
Vielle-Calzada JP, Baskar R, Grossniklaus U (2000) Delayed
activation of the paternal genome during seed development. Nature 404: 91–94
Wang T, Liang L, Xue Y, Jia PF, Chen W, Zhang MX, Wang YC, Li
HJ, Yang WC (2016) Corrigendum: A receptor heteromer
mediates the male perception of female attractants in
plants. Nature 536: 3600
Winter G, Todd CD, Trovato M, Forlani G, Funck D (2015)
Physiological implications of arginine metabolism in
plants. Front Plant Sci 6: 534
Wu JJ, Peng XB, Li WW, He R, Xin HP, Sun MX (2012)
Mitochondrial GCD1 dysfunction reveals reciprocal cell-tocell signaling during the maturation of Arabidopsis female
gametes. Dev Cell 23: 1043–1058
Xia J, Yamaji N, Che J, Shen RF, Ma JF (2014) Normal root
elongation requires arginine produced by argininosuccinate lyase in rice. Plant J 78: 215–226
Xie T, Chen D, Wu J, Huang X, Wang Y, Tang K, Li J, Sun M,
Peng X (2016) Growing slowly 1 locus encodes a
PLS-type PPR protein required for RNA editing and
plant development in Arabidopsis. J Exp Bot 67:
5687–5698
Yan H, Chen D, Wang Y, Sun Y, Zhao J, Sun M, Peng X (2016)
Ribosomal protein L18aB is required for both male
gametophyte function and embryo development in
Arabidopsis. Sci Rep 6: 31195
Scan with iPhone or iPad to
view JIPB online
XXX 2017 | Volume XXXX | Issue XXXX | XXX-XX