Download The Volvox glsA gene - Development

649
Development 126, 649-658 (1999)
Printed in Great Britain © The Company of Biologists Limited 1999
DEV0193
glsA, a Volvox gene required for asymmetric division and germ cell
specification, encodes a chaperone-like protein
Stephen M. Miller and David L. Kirk*
Department of Biology, Washington University, St. Louis, MO, 63130, USA
*Author for correspondence (e-mail: [email protected])
Accepted 4 December 1998; published on WWW 20 January 1999
SUMMARY
The gls genes of Volvox are required for the asymmetric
divisions that set apart cells of the germ and somatic
lineages during embryogenesis. Here we used transposon
tagging to clone glsA, and then showed that it is expressed
maximally in asymmetrically dividing embryos, and that it
encodes a 748-amino acid protein with two potential
protein-binding domains. Site-directed mutagenesis of one
of these, the J domain (by which Hsp40-class chaperones
bind to and activate specific Hsp70 partners) abolishes the
capacity of glsA to rescue mutants. Based on this and other
considerations, including the fact that the GlsA protein is
associated with the mitotic spindle, we discuss how it might
function, in conjunction with an Hsp70-type partner, to
shift the division plane in asymmetrically dividing cells.
INTRODUCTION
and Quatrano, 1993; Guo and Kemphues, 1996; Kraut et al.,
1996; McGrail and Hays, 1997; Skop and White, 1998; Waddle
et al., 1994; White and Strome, 1996; Zwaal et al., 1996).
However, we still are far from having any sort of overview of
the range of mechanisms that may be involved in regulating
division symmetry.
The spherical multicellular alga Volvox carteri has features
that make it appealing as an additional, and conceivably
simpler, model for studying the control of division symmetry.
The two cell types of the Volvox spheroid (mortal somatic cells
and immortal germ cells) are set apart during embryogenesis
by a highly regular pattern of visibly asymmetric divisions, and
there is no indication that these quantitatively asymmetric
divisions are complicated by any qualitative asymmetry.
Indeed, several lines of evidence indicate that in V. carteri it is
just the amount, and not the quality, of cytoplasm that a cell
possesses at the end of cleavage that determines whether it will
activate the germinal or somatic pathway of gene expression
and cytodifferentiation (Kirk et al., 1993).
An asexual V. carteri adult consists of approximately 2000
small, biflagellate somatic cells located at the surface, and
approx. 16 large, asexual reproductive cells (‘gonidia’) located
just below the surface of a transparent glycoprotein-rich sphere
(Kirk, 1998; Starr, 1970). Each mature gonidium produces an
embryo containing all the cells that will be present in an adult
of the next generation by initiating a program of rapid cleavage
divisions, a stereotyped subset of which are visibly asymmetric
and set apart large/small sister-cell pairs that function as
gonidial and somatic initials, respectively. At the end of
cleavage the gonidial initials are approximately three times the
diameter of somatic initials. Studies to date all indicate that it
Precise positioning of cell division planes plays a crucial role
in the development of many organisms, by determining the
sizes, shapes, cytoplasmic compositions, and/or spatial
relationships of the daughter cells. Cell-division geometry is
particularly important in those cases in which cytoplasmic
determinants are asymmetrically distributed inside the
predivisional cell, or when potential sources of fatedetermining signals are asymmetrically distributed outside of
it (Horvitz and Herskowitz, 1992). As a rule, developing plants
(in which readjustment of cellular relationships via cell
migration is not an option) are even more dependent on defined
and regular patterns of cell division geometry than developing
animals are.
In most eukaryotes the plane of cell division can be predicted
from the position of the mitotic spindle. However, in animals
it is the positions occupied by centrosomes at prophase that
determine the orientation of both the spindle and (via the polar
asters that they organize) the division plane (Raff and Glover,
1989; Strome, 1993), and in plants it is the ‘preprophase band’
of circumferential microtubules that predicts the orientation of
both the spindle and the division plane (Lloyd, 1991), but in
few cases do we have a detailed understanding of how the
locations of centrosomes or preprophase bands are specified at
critical stages of development.
In recent years significant progress has been made in
identifying gene products in various model organisms that
participate at some level in determining the geometry and/or
consequences of particular embryonic cell divisions (Broadus
and Doe, 1997; Di Laurenzio et al., 1996; Doe, 1996; Goodner
Key words: Cell division, Green algae, Hsp40, J protein, Volvox
carteri
650
S. M. Miller and D. L. Kirk
is this size difference that is critical for deciding cell fate: cells
>8 µm at the end of cleavage – no matter where or how they
have been formed – always develop into gonidia, whereas
smaller cells always become somatic cells (Kirk et al., 1993).
Thus, it is clear that cell division symmetry plays a central role
in V. carteri development.
Mutational analysis has revealed a class of genes
(gonidialess, gls) whose products are required for asymmetric,
but not for symmetric, cell division (Kirk et al., 1991). In Gls
mutants all cell divisions are symmetric, and fully cleaved
embryos contain only small blastomeres that differentiate as
somatic cells. These mutations can only be recovered and
maintained in strains having the Regenerator (Reg) phenotype,
in which somatic cells are able to redifferentiate as functional
germ cells (see Kirk et al., 1999). As a first step toward learning
how the gls loci act to control asymmetric division in V. carteri,
we have used transposon tagging to identify and recover and
characterize the glsA gene, and have found that it encodes a
protein with a chaperone domain (the J domain) that must be
functional for the GlsA protein to play its essential role in
asymmetric cell division.
MATERIALS AND METHODS
Volvox strains and cultivation conditions
The standard Volvox strains, media and culture conditions used, the
methods used for inducing and isolating putative transposon-tagged
mutants, for nuclear co-transformation, and selection of Nit+ mutants
were all as described by Kirk et al. (1999). The Gls mutants studied
here were all isolated from 24°C cultures of strain 22reg1 (a stable
Reg derivative of CRH22) and screened for their ability to generate
Gls+ revertants when grown at 32°C and/or 24°C.
DNA methods
Volvox genomic DNA was prepared as described by Miller et al.
(1993) and then further purified by spermine precipitation and
phenol/chloroform extraction. Southern blot analysis was as
previously described by Miller et al. (1993) and DNA sequencing was
as described by Kirk et al. (1999).
A partial genomic library of gel-purified BamHI restriction
fragments of strain 22gls1 DNA in pBluescript KS+ (KS+; Stratagene)
was screened with a Jordan probe, yielding a plasmid, B3.4-1, that
contained the novel 3.4-kb BamHI restriction fragment of strain
22gls1. Phage λ clones bearing glsA sequence were then isolated by
screening an existing Volvox genomic library (Mages et al., 1988) with
a probe derived from B3.4-1, according to Sambrook et al. (1989).
Plasmids LV304 and LV307 were constructed by subcloning the 8.3kb SalI and 9.5-kb XhoI fragments of λglsA4, respectively, into KS+.
Plasmid LV377 was constructed by replacing the 0.1-kb EcoRVBstEII fragment from the 5′ end of the LV304 insert with the 1.6-kb
EcoRV-BstEII 5′ glsA fragment of LV307.
Plasmid LV399, which contains a variant of the LV377 insert, in
which the region encoding the conserved HPD tripeptide of the GlsA
J domain has been to mutated to encode QPA, was generated as
follows. Plasmid LV300-2′ was synthesized by a PCR utilizing two
45-mers, pMut1 (5′AGACATGTCTGGAGAACCAGCCGGCTAAGGCCCTCATTAATGTCA3′) and pMut2 (5′TCCGGTAGGCCGCCCTGATCTGGGCCTCGGAAGCGGTCCACCGCT3′) as primers
and the 3.6-kb plasmid LV300-2 as template. LV300-2 contains the
650-bp BamHI-ApaI fragment of glsA (Fig. 3) cloned into KS+.
Primer pMut1 contains 2 nucleotide mismatches with respect to its
glsA target sequence, so that successful full-length amplification of
the plasmid, followed by ligation of the fragment ends to each other,
created a plasmid identical to LV300-2 except at the position of the
two nucleotide mismatches. The insert of LV300-2′ was sequenced to
verify that the two mismatches directed by pMUT1, and no other
mutations, were incorporated into glsA sequence. Plasmid LV399 was
generated by replacing the corresponding portion of plasmid LV377
with the mutated version from LV300-2′.
Plasmid LV388, with an insert encoding a GlsA variant tagged with
the influenza hemagglutinin (HA) epitope (Atassi and Webster, 1983;
Field et al., 1988), was generated as follows. Oligonucleotides pHA1 (5′GTCACCTACCCGTACGACGTCCCGGACTACGCC3′) and
pHA-2 (5′GTGACGGCGTAGTCCGGGACGTCGTACGGGTAG3′)
were annealed (Sambrook et al., 1989) to form small double-stranded
DNA fragments having BstEII compatible ends. These were ligated
to BstEII-digested LV377, and recombinant plasmids that contained
both a regenerated BstEII restriction site and a novel AatII restriction
site were sequenced to determine the number of inserts present and
to verify that the reading frame was intact.
RT-PCR and semi-quantitative RT-PCR
RNA samples were isolated as described by Kirk and Kirk (1985)
from somatic cells, gonidia or embryos isolated from synchronous
cultures at the developmental stages of interest and were then used to
generate first-strand cDNAs using a reverse-transcriptase kit
(Stratagene). PCRs used primers gls32 (5′CATCCTTAGCGACCCAGCCAAG3′) and gls33 (5′GCCGCCTCCACGTCCTCCTC3′) to
generate a 370-bp glsA-specific product, and primers c38-1 and c382 (Kirk et al., 1999) to generate the 355-bp S18-specific (ribosomal
protein-encoding) product that served as a control. Production,
electrophoretic separation, and quantitation of PCR products were all
as described by Kirk et al. (1999).
Protein-accumulation studies with HA-tagged GlsA
Strain 22gls1-NRG was isolated as a Nit+ Reg+ Gls+ derivative of
22gls1 following co-transformation with three plasmids carrying the
nitA gene, the wild-type regA gene (Kirk et al., 1999), and the gene
encoding the HA-tagged version of GlsA. Extracts of 22gls1-NRG
gonidia, embryos and somatic cells that had been isolated at selected
developmental stages by the methods of Tam and Kirk (1991) and
then prepared for and subjected to SDS-PAGE by standard methods
(Sambrook et al., 1989) were transferred to nitrocellulose membranes
(Micron Separations, Inc., Westborough, MA) for western blot
analysis. SuperSignal® substrate (Pierce Biochemicals, Rockford, IL)
was used to detect western signals according to the manufacturer’s
recommendations, using 10% nonfat dried milk as the blocking agent.
Primary antibody (anti-HA monoclonal 12CA5, provided by L. Ellis,
Washington Univ.) was diluted 1:500 in blocking solution, and
secondary antibody (goat anti-mouse:horseradish peroxidase
conjugate; Biorad Laboratories, Melville, NY) was diluted 1:5,000 in
blocking solution.
All aspects of the preparation of 22gls1-NRG samples for indirect
immunofluorescent examination were as described by Kirk et al.
(1999), except that primary antibody labeling was with a mixture of
a 1:10 dilution of the 12CA5 monoclonal antibody and a 1:1,000
dilution of a rabbit polyclonal to Chlamydomonas β-tubulin (kindly
contributed by Joel Rosenbaum’s laboratory) and the secondary
antibody labeling was with a mixture of Cy™2-labeled goat antirabbit IgG and Cy™3-labeled goat anti-mouse IgG (Amersham), both
at 2 µg/ml.
RESULTS
Identification and characterization of a candidate
transposon-tagged Gls mutant
Two attributes of Jordan facilitate its use as a gene-tagging
agent: (i) its transposition can be induced 30-fold or more by
The Volvox glsA gene
mild environmental stresses (such as cultivation at 24°C, which
is near the lower limit for growth of V. carteri; S. M. Miller,
unpublished observations), and (ii) many mutations caused by
Jordan insertions are revertible (Miller et al., 1993, plus
unpublished observations). When replicate cultures of the
regA−, nitA− strain 22reg1 were grown for several generations
at 24°C and screened microscopically, 24 independent Gls
mutants were recovered. Five of these were highly revertible,
and one, 22gls1, reverted much more frequently at 24°C than
at 32°C, indicating that it was an excellent candidate to harbor
a Jordan insertion in a gls gene.
In common with about 10% of >100 Gls mutants that we
have isolated, 22gls1 exhibits a slightly leaky (‘quasi-Gls’)
phenotype: approximately half of all 22gls1 spheroids contain
zero or one gonidia, most of the rest contain two or three
gonidia, individuals with four gonidia are rare, and all
spheroids, regardless of the number of gonidia they themselves
contain, generate progeny with zero to four gonidia in similar
frequencies. 22gls1 also has a cold-sensitive growth defect. At
32°C it grows as vigorously as its Reg progenitor, its Gls+
revertants, and other GlsReg strains. However, at 24°C 22gls1
grows far more slowly than any of those other strains, never
completes more than one life cycle, and soon bleaches and
becomes moribund. Systematic studies have failed to identify
a single cold-sensitive phase: cells within a single spheroid
cease growing and bleach in a wholly asynchronous, stochastic
manner. The only robustly growing spheroids that appear in
22gls1 cultures at 24°C are ones that have undergone a stable
reversion to Gls+. The fact that the Gls phenotype of 22gls1
and its cold-sensitive growth defect invariably co-revert
provides strong evidence that they result from the same genetic
lesion.
Microscopic analysis of cleaving 22gls1 embryos confirmed
that the Gls phenotype results from a defect in asymmetric cell
division at 32°C: embryos that have produced one to four large
cells by asymmetric divisions are seen with the same frequency
as adults with that number of gonidia (Fig.
1 and data not shown).
Isolation of the glsA gene
DNA blots probed with Jordan revealed a
3.4-kb BamHI fragment in 22gls1 DNA
that was not present in DNA from 22reg1
or any of several Gls+ revertants tested
(data not shown). Repeated loss of the
novel Jordan-containing fragment of
22gls1 in conjunction with reversion of the
Gls phenotype provided strong evidence
that those two traits were causally related.
Therefore, the novel 3.4-kb fragment was
cloned, yielding the plasmid B3.4-1, and
genomic DNA flanking the transposon was
isolated. When this genomic DNA was
used to probe a blot containing BamHIdigested DNAs of 22reg1, 22gls1, and six
independent Gls+ revertants of 22gls1, the
fragment detected in 22gls1 was found to
be larger by 1.6 kb (the size of Jordan,
Miller et al., 1993) than it was in 22reg1 or
any of the six revertants (Fig. 2A). This
result provided strong evidence that we had
651
cloned the copy of Jordan that is responsible for the Gls
phenotype of strain 22gls1, and that the DNA flanking Jordan
in B3.4-1 represented a portion of the gls locus of interest.
Genomic clones that hybridized with fragments isolated
from B3.4-1 were tested for their ability to rescue the Gls
phenotype of 22gls1 by biolistic co-transformation, using the
nitA (nitrate-reductase encoding) gene as the selectable marker
(Schiedlmeier et al., 1994). A Gls+ Nit+ strain recovered after
bombardment with λglsA4 was found to possess both the 3.4kb BamHI fragment representing the Jordan-inactivated
version of the gene, and a 1.8-kb fragment corresponding to
the wild-type allele (Fig. 2B), demonstrating that its Gls+
phenotype was the result of transformation rescue, not
reversion of the transposon-induced mutation. This, in turn,
proved that λglsA4 contains a functional copy of the gls gene
of interest. We call this gene glsA.
The boundaries of glsA were defined more closely when
several subclones derived from λglsA4 and a longer clone,
λglsA5, were tested for their ability to rescue the Gls
phenotype of 22gls1 by transformation and it was shown that
clones LV304, LV307, and LV377 were capable of such rescue,
but LV322 was not (Fig. 3B). However, plasmid LV377, which
contains an insert extending to both the right and left of the
region of overlap of the LV304 and LV307 inserts, was found
to be >15 times as efficient at rescuing the Gls phenotype than
LV304 and LV307 were (67% vs. approx. 4%
cotransformation, respectively). The source of this discrepancy
was discovered when sequencing of the glsA cDNA was
completed and it was established that the region of overlap
between LV304 and LV307 contains very little upstream DNA,
and does not contain the entire glsA transcription unit (Fig.
3B,C).
DNA sequence of the coding region of glsA
All attempts to detect a glsA message on northern blots, or to
isolate glsA cDNAs from existing Volvox libraries were
Fig. 1. The Gls phenotype of strain 22gls1. Representative young adults (A-C) and postcleavage, pre-inversion embryos (D-F), of the wild-type (EVE; A and D), Gls (22gls1; B
and E), and revertant (22gls1R4; C and F) strains. Note that the 22gls1 embryo in E
contains only one large cell (presumptive gonidium).
652
S. M. Miller and D. L. Kirk
Fig. 2. Analysis of revertants and putative transformants of 22gls1.
(A) Southern blot of BamHI-digested DNAs from 22gls1, its
progenitor (22reg1), and 6 of its Gls+ revertants (R1-R6) probed with
P1 (see Fig. 3B). (B) Southern blot of BamHI-digested DNAs from
22reg1, 22gls1, and 5 Gls+ strains recovered following transformation
of 22gls1 with λglsA4 (T1), LV304 (T2 and T3), and LV307 (T4 and
T5) probed with P1.
glsA transcript abundance peaks during early
embryogenesis
To determine the extent to which glsA message levels are
spatially and temporally regulated, we used semi-quantitative
RT-PCR to measure the relative abundance of glsA transcripts
in somatic cells and gonidia/embryos throughout the life cycle.
This revealed that glsA transcript levels in gonidia are low
during most of the life cycle, increase sharply at the beginning
of embryogenesis, and peak 4 hours later, at a time that
coincides roughly with the occurrence of the asymmetric cell
divisions at the sixth, seventh and eighth cleavage cycles (Fig.
4A). In contrast, glsA transcript levels were low in somatic cells
throughout the life cycle. (The small peak seen in the somatic
sample at the time glsA transcript is maximally abundant in
embryos (Fig. 4A) could be accounted for if this sample had
contained as many as one embryo per 104 somatic cells, which
is a level of contamination we can not rule out.)
GlsA protein is present and associated with the
mitotic spindle during cleavage
A transgenic, morphologically wild-type strain (22gls1-NRG)
that makes a GlsA protein tagged with the influenza
hemagglutinin (HA) epitope was used for a western-blot analysis
of stage- and cell-type-specific abundance of GlsA. Extracts of
all embryos examined contained substantial amounts of a protein
recognized by the anti-HA antibody that migrated as an approx.
100-kDa band on SDS-PAGE (Fig. 4B). This same protein was
present, but in greatly diminished quantity, in 24-hour-old
juvenile spheroids (which contain both somatic cells and young
gonidia), but it could not be detected in somatic cells, in gonidia
that had been isolated 2-4 hours prior to the onset of cleavage,
or in embryos from a control strain (EVE) not bearing the tagged
glsA gene. These results indicate that synthesis of GlsA protein
begins in mature gonidia just as they prepare to initiate cell
division, and then continues through most of the cleavage period.
It is unknown whether the weak signal detected in juveniles
reflects continuing synthesis, or just residual GlsA that had been
synthesized a day earlier, during embryogenesis.
unsuccessful, indicating that the glsA transcripts must be of
very low abundance. We therefore sequenced the 8.3-kb SalI
fragment from genomic clone LV304, subjected the sequence
to BLAST analysis (Altschul et al., 1990) and learned that
glsA appeared to encode a protein related to several in the
database. When primers designed to amplify this putative
coding sequence were used to perform RT-PCR with RNA
from cleaving embryos, four overlapping PCR products were
produced (Fig. 3C). Sequencing confirmed that these putative
glsA PCR products not only encoded the polypeptide that had
been detected by BLAST analysis, they appeared to represent
the entire coding region of the glsA locus (which consists of
16 exons and 15 introns) and encode a 748-residue, approx.
82-kDa protein (Fig. 3C). The AUG identified in Fig. 3C is
almost certainly the authentic initiation codon, because there
is an in-frame stop codon 60 bp upstream of it in the cDNA,
and the next AUG codon is 474 codons downstream. The
codon bias of the open reading frame (ORF)
encoding the predicted GlsA protein agrees
Jordan
1 kb
well with the codon bias of previously
*
X
B
R
S
N
A BN C
N
X
A
characterized volvocalean ORFs (Schmitt et al.,
1992), and no reasonable candidate ORFs
Rescue
λglsA5
could be detected in the other two reading
LV322
+
λglsA4
frames. Both the genomic and the cDNA
B
+
LV307
sequences have been submitted to GenBank
+
LV304
+
(accession
numbers:
AF110134
and
LV377
P1
P2
AF110135, respectively).
The truncated glsA gene carried on plasmid
AUG
UAA
LV304, which rescues the Gls phenotype of
C
mutant 22gls1 with low efficiency, contains just
27 bp of 5′ untranslated region. Presumably the
Fig. 3. The glsA locus. (A) Map of the locus showing only those restriction sites that
truncated gene must utilize cryptic promoter and
were used for manipulation of clones discussed in this report. The labeled triangle
start site sequences in the plasmid, or become
indicates where Jordan is inserted in 22gls1. A, ApaI; B, BamHI; C, ScaI; S, SalI; N,
juxtaposed fortuitously to such elements when
NgoMI; R, EcoRV; X, XhoI; N*, NgoMI site that was created in the mutant plasmid
it integrates into the genome, in order to
LV399. (B) Clones used in transformation rescue and DNA blot studies. The region
function properly. Plasmid LV307, which
of overlap among the clones capable of mutant rescue is indicated by the vertical
carries a truncated glsA gene predicted to
dashed lines. Cross-hatched boxes indicate fragments (P1 and P2) used to probe
encode a protein that is missing its carboxy
DNA blots. (C) Exon/intron structure of the glsA gene. Boxes represent proteinterminal 124 amino acids, is also inefficient at
coding exons, and inverted carets represent introns. Lines at bottom indicate
overlapping fragments of cDNA that were generated by RT-PCR and sequenced.
rescue.
The Volvox glsA gene
Examination of early-cleavage 22gls1-NRG embryos by
indirect immunofluorescence with the anti-HA antibody
revealed clearly that the antigen is most concentrated in the
vicinity of the mitotic spindle in early, symmetrically dividing
embryos (Fig. 4D). A smaller quantity of antigen is also
detected, however, in a crescent-shaped region of the cytoplasm
posterior to (i.e., on the chloroplast side of) the nucleus.
(Neither of these staining patterns are seen in control embryos
lacking HA-tagged GlsA.) So far, technical difficulties have
prevented a detailed analysis of whether the protein is localized
differently in asymmetrically vs. symmetrically dividing
blastomeres in the 6th, 7th and 8th cleavage cycles.
The Jordan insertion in mutant 22gls1 results in
aberrantly spliced glsA transcripts
Sequencing revealed that in strain 22gls1 Jordan is inserted in
the fourth intron of glsA, 15 bp upstream of the fifth exon (Fig.
3A). To test the supposition that insertion of the transposon this
close to an intron-exon boundary might interfere with splicing,
we used RT-PCR to amplify for sequencing the relevant portion
of the glsA transcripts from the wild-type and mutant strains.
Whereas a single 370-bp product is detected following a PCR
using primers that straddle the site of the Jordan insertion and
the wild-type RT template, a pair of products are detected when
the mutant RT template is used: a smaller (approx. 300-bp)
product that lacks the fifth exon, and a larger (approx. 450-bp)
product containing the 370 bp present in the wild-type product,
plus 62 bp derived from the transposon and its target-site
duplication, and the 15 bp of intron lying between the transposon
and the fifth exon. Both aberrant transcripts in the mutant are
predicted to encode truncated proteins because of frameshifts.
Therefore, the transposon insertion in 22gls1 apparently
incapacitates the splice acceptor site at the junction of intron 4
and exon 5, leading to the production of two improperly spliced,
defective transcripts. We cannot eliminate the possibility,
however, that a small number of properly spliced transcripts are
produced, accounting for the quasi-gonidialess phenotype of
strain 22gls1.
653
M (Fig. 5B). We will review what is known about the functions
of such domains in the Discussion.
One of the proteins most similar to GlsA (BLAST
probability score approx. 10−52) is MPP11, a human ‘M-phase
phosphoprotein’ that is phosphorylated during mitosis and then
– like GlsA – associates with the spindle (Matsumoto-Taniura
et al., 1996). The remaining four sequence homologs of GlsA
and MPP11 include two from mouse, one from C. elegans, and
one from Saccharomyces cerevisiae. The presence of GlsA
sequence homologs in organisms as divergent as algae, yeast,
nematodes and humans suggests that GlsA-related proteins
might be found in all eukaryotes.
A
Asymmetric divisions
60
x
Gonidia/embryos
x Somatic cells
50
Relative 40
Abundance
of glsA
Transcript
30
20
10
0
x
x x x
x
40 44 48/0 4 8
Cleavage
period
x
x
x
x
x
12 16 20 24 28 32 36 40
Hour in life cycle
glsA encodes a protein highly similar to several
known J proteins, including human MPP11
BLAST analysis (Altschul et al., 1990) of
the glsA coding sequence revealed that the
polypeptide it encodes, GlsA, includes an
approx. 70-aa motif, the J domain, that is
found in a large family of proteins, called J
proteins, that includes the Hsp40 class of
molecular chaperones, as well as many other
proteins believed to have chaperone-like
functions (Caplan et al., 1993). In all
reported test cases, the J domain is
indispensable for the function of the J
protein in which it occurs. The J domain of Fig. 4. Accumulation of glsA RNA and GlsA protein in time and space. (A) Relative
GlsA is identical to the consensus J-domain abundance of glsA RNA in both cell types measured by semi-quantitative RT-PCR. The
sequence at all nine amino acid positions that somatic cells present from hour zero (the beginning of the cleavage period) through hour
12 are those of the parental spheroids within which the embryos are developing; at later
are known to be highly conserved, including stages 2 generations of somatic cells (differing in age by 48 hours) are present.
three that are invariant in all known J (B) Western-blot analysis of GlsA protein in embryos and postembryonic juveniles of
proteins (Fig. 5A). Of the many J proteins in strain 22gls1-NRG. (C-E) Indirect immunofluorescence images of a dividing 4-cell embryo
the data base, five share extensive regions of of strain 22gls-NRG stained with anti-β-tubulin (C), anti-HA (D) and DAPI (E). Note that
similarity with GlsA outside the J domain, in the HA-tagged protein is localized predominantly in the vicinity of the mitotic spindle.
3 regions that we designate WR1, WR2, and Scale bar, 10 µm.
654
S. M. Miller and D. L. Kirk
Q
A
*
*
A
B GlsA
***
*
GlsA
DnaJ
DP Y SL L GL A N ER W TA S E A Q I RA A Y R K TC L E N H P DK A L I
GlsA
DnaJ
N VT D E AE R ER I V EH F KT I QD A Y DI L SD P A K R R EF D S T D
J
M
WR1
WR2
MIDA1
DY Y E I L G V S K - - - T A E E R E I R K A Y K R L A M K Y H P DR N Q G
MPP11
*
*
*
D KE A E AK - -- - - -- F KE I KE A Y EV L TD S Q K R A AY D Q Y G
Zrf1
CeZrf
Zuotin
Fig. 5. Comparison of GlsA with other J proteins. (A) The J domains of GlsA and E. coli DnaJ. Identical residues are boxed and shaded; similar ones
are boxed and unshaded. Large asterisks indicate residues that are fully conserved in all J domains; small asterisks indicate highly conserved
residues. Arrows indicate residues that were mutated in plasmid LV399. (B) Domain structure of GlsA and five proteins of highly similar sequence.
The function(s) of the WR (tryptophane repeat) domains is unknown; the functions of the J and M domains and the MPP11 and MIDA1 proteins are
discussed in the text. The species of origin and the GenBank accession numbers of the other three proteins are: Zrf1, mouse, 1731448; CeZrf, C.
elegans, 1572812; Zuotin, S. cerevisiae, 418611.
The J domain is indispensable for GlsA function
To test whether the J domain plays an essential role in the
asymmetric-division function of GlsA, we generated a mutant
glsA gene that encodes a defective J domain within an otherwise
wild-type protein. The residues that are invariant in all known J
domains are a his-pro-asp tripeptide approximately 30 residues
from the amino end of the domain (Fig. 5A). Replacement of this
histidine with glutamine inactivates two prototypical J proteins:
the DnaJ/Hsp40 of E. coli, and its S. cerevisiae homolog, Ydj1
(Sell et al., 1990; Tsai and Douglas, 1996). We introduced this
same mutation into glsA (along with a second mutation that
converts the aspartate to alanine, in order to generate a novel
NgoMI restriction site), and used a plasmid bearing the mutant
gene (LV399) to attempt rescue of the Gls phenotype of strain
22gls1 via co-transformation. Plasmid LV377, with the wild-type
gene, was used in parallel to transform equal aliquots of a single
sample of mutant spheroids. Whereas 38 of 57 Nit+ transformants
were converted to Gls+ by the control plasmid, LV377, none of
41 Nit+ transformants were converted to Gls+ by plasmid LV399.
DNA blot analysis revealed that 7 of the 10 Nit+ Gls−
transformants from the latter group that we tested had stably
incorporated the mutant glsA transgene (representative data in
Fig. 6A), indicating that the failure to rescue the phenotype was
not due to a failure to incorporate the mutant gene. As expected,
all Gls+ Nit+ transformants that were tested contained both the
endogenous and transgenic copies of the glsA gene (Fig. 6B). We
conclude that the J domain of GlsA is indispensable for its
function in repositioning the cleavage plane during asymmetric
cell divisions.
glsA is not the only locus that can mutate to
produce a Gls phenotype
Gls strains have not been amenable to Mendelian analysis,
probably because the cellular composition and arrangement of
a Gls spheroid precludes the sequential sperm-somatic cell and
sperm-egg interactions that are required for completing
fertilization (Coggin et al., 1979; Starr, 1969). As a result, we
have been unable to determine by conventional Mendelian
methods how many loci are defined by the Gls mutants in our
collection. However, the cloned glsA locus permitted us to
begin to address this question. First we tested the ability of the
glsA gene carried on plasmid LV377 to rescue the Gls
phenotype of two independent mutants, 22gls4 and 22gls5, and
found it was unable to rescue either of them. Then we used the
glsA gene to probe Southern blots containing genomic DNAs
from over 40 independent Gls mutants, including 10 that are
highly revertible (and hence likely to be transposon induced).
Fig. 6. Mutation of the J domain renders GlsA nonfunctional.
(A) Southern blot of NgoMI-digested DNAs probed with P2, (see Fig.
3B) demonstrating that plasmid LV399 was incorporated into many
Nit+ Gls− transformants. Arrows indicate wild-type (2.6 kb), mutant
(4.2 kb), and transgene (0.9 and 1.7 kb) glsA fragments. (B) Southern
blot of BamHI-digested DNAs probed with P1, demonstrating that
stable incorporation of plasmid LV377 accompanied rescue of Gls
phenotype in all five Nit+ Gls+ transformants (T1-T5). T6 is a Nit+
Gls− transformant included as a control. Arrows indicate wild-type
(1.8 kb) and mutant (3.4 kb) fragments.
The Volvox glsA gene
655
Fig. 7. One possible
mechanism of action of GlsA.
2MTR
In Volvox and its relatives, the
4MTR
4MTR
AA
position assumed by the basal
BB
AA
AA
AAAAAA
body apparatus (BBA) – and
2MTR BB
2MTR
2MTR BB
2MTR
AAAAAA
70
more specifically by the 4BB
AAAAAA
p
BB
n
Hs mai
AA
AAAAAA
membered microtubule rootlets
AA
AAAAAA
DoAAAAAAA
ain
J
4MTR
4MTR
AAAAAAA
(4MTRs) that are attached to
om
D
AAAAAAA
in
e e
M
BBA location at telophase
BBA location at telophase
the basal bodies (BB) – by the
sit ran
AAAAAAA
M mb
e
AAAAAAA
preceding a symmetric
preceding an asymmetric
m
end of telophase n defines the
GlsA AAAAAAA
division of -a wild type or
division in a wild type
AAAAAAA
plane of division n+1 (Kirk,
glsA embryo
embryo
4MTR
1998). One mechanism of GlsA
action would be that while the BBA is moving about during the telophase preceding an asymmetric division, GlsA molecules bound (via their J
domains) to Hsp70 molecules on the BBA contact and bind (via their M domains) to eccentrically localized membrane proteins, M, thereby
tethering the BBA to an off-center site. Other possible mechanisms are discussed in the text.
None of the strains tested had detectable polymorphisms at the
glsA locus, consistent with the notion that mutations in a gene
or genes other than glsA caused the Gls phenotype of at least
some of these mutants.
DISCUSSION
glsA encodes a J protein that is required for
asymmetric cell division
We have established that the glsA gene encodes a polypeptide
containing the well defined approximately 70-aa motif, the J
domain, that is found in a diverse family of proteins, most
notably the Hsp40 class of molecular chaperones (Caplan et
al., 1993). We have also shown that inactivating this domain
by in vitro mutagenesis abolishes the ability of glsA to restore
to V. carteri embryos the capacity for asymmetric division that
is essential for establishing its two cell types – germ and soma.
The fact that the five proteins in the data base that are most
similar in sequence and domain structure to the deduced GlsA
protein are found in organisms as different from the green alga
V. carteri as yeast, nematodes and humans raises the possibility
that this recently discovered subfamily of J proteins may be
ubiquitous in eukaryotes, and may even have some generalized
role in cell division. Should that be so, what is learned about
the role of GlsA in Volvox cell division may have considerably
broader significance than it might have appeared initially.
The prototypical J protein is E. coli DnaJ/Hsp40, which is
required, together with DnaK/Hsp70, for replication of phage
λ. In that role and many others, including protection of cells
from potentially lethal heat shock, DnaJ binds to DnaK, targets
it to specific substrates, and stimulates its ATPase activity (Cyr
et al., 1994). The J domain is the region required both for
binding to DnaK and for stimulating its ATPase activity. Other
domains present in DnaJ include a cysteine-rich region (CRR)
required for its substrate recognition and protein folding
activities, and a ‘hinge’ region. Homologs of DnaJ/Hsp40 and
DnaK/Hsp70 have been found in every organism examined,
and many of these DnaJ homologs that also possess the CRR
and hinge regions are believed to be functional homologs of E.
coli Hsp40, involved in mediating the stress response (Cyr et
al., 1994).
But what of proteins, like GlsA, that share with DnaJ only
the J domain? Whereas Hsp70s are all very similar in structure,
eukaryotic J proteins are extremely variable, modular proteins:
the J domain (which is usually near the N terminus) can be
combined with many different C-terminal modules. Studies of
the various J proteins and Hsp70 homologs of yeast (Brodsky
and Schekman, 1993; Caplan et al., 1992; Schlenstedt et al.,
1995; Zhong and Arndt, 1993) have led to the view that small
differences in J domain sequence specify which Hsp70
isoforms various J proteins will pair with, and different Cterminal domains act as ‘adapters’ that determine where the
Hsp70/J-protein complex will localize in the cell, what
substrates it will bind to, and what functions it will execute
(Kelley, 1998; Silver and Way, 1993). Over time, the number
of roles that various J proteins and Hsp70s have been found to
play in the life of the cell has grown continuously. Beyond the
role they were initially found to play in thermoprotection (by
binding and preventing aggregation of thermally unfolded
proteins, promoting proper refolding of some, and targeting
others for proteolysis), J protein/Hsp70 complexes are now
known to be involved in protein synthesis, targeting and
translocation of specific proteins into various organelles, and
assembly of a diverse array of multi-protein complexes (Caplan
et al., 1993; Craig et al., 1994; Cyr et al., 1994). Moreover,
they can interact with other Hsps (such as Hsp60 or Hsp90) to
promote yet more activities (Kimura et al., 1995; Lewis et al.,
1992).
In all such cases, no role has ever been defined for the J
domain other than as a site required for binding to and
activating an Hsp70 partner. But in order to act as an adapter
capable of targeting a specific Hsp70 to a particular substrate
or intracellular site, a J protein requires a second binding site.
A second domain in GlsA that is a candidate to serve such a
function is what we call the ‘M domain’, because it was first
identified in MIDA1 (one of two mouse homologs of GlsA) as
the binding site by which MIDA1 attaches to the ‘Id’ protein
and thereby inhibits the activity of Id as a positive regulator of
growth and a negative regulator of differentiation in
erythroleukemic cells (Shoji et al., 1995). Our working
hypothesis is that the M domain of GlsA serves as a second
protein-binding site that is used by GlsA to bind its cognate
Hsp70 to a specific cellular target. Therefore, we are presently
using biochemical and molecular genetic methods to isolate
proteins that bind GlsA, in a search for its postulated cognate
Hsp70 and second-target molecules.
Meanwhile, we may ask: where in the cell might the protein
partners of GlsA be located, and how might they act in concert
to shift the division plane?
656
S. M. Miller and D. L. Kirk
A possible mechanism of action for GlsA
Several considerations lead us to speculate that the GlsAHsp70 interaction occurs right on the cell-division apparatus,
and that it plays a relatively direct role in establishing the cell
division plane. These considerations include: (1) One of the
closest homologues of GlsA in the data base, the human mitotic
phase phosphoprotein 11, or MPP11, has been found in
association with the mitotic spindle after it has been
phosphorylated by a cyclin-dependent kinase (MatsumotoTaniura, 1996). (2) Although we have yet to establish whether
GlsA is also phosphorylated during M phase, we have
demonstrated here (Fig. 4C-E) that it certainly is associated
with the mitotic spindle in symmetrically dividing blastomeres
of early Volvox embryos – although it remains to be determined
how this localization may be modified in cells preparing to
divide asymmetrically. (3) There is growing recognition that
Hsp70s have important roles in regulating MT polymerization,
centrosome function and mitotic spindle assembly: In
Chlamydomonas, the closest unicellular relative of Volvox, an
Hsp70 has been found at the tip of the flagellum, at the site
where axonemal MTs are assembled (Bloch and Johnson,
1995), and an Hsp70 is part of a complex that is required in
yeast for the proper assembly of mitotic spindles (Ursic and
Culbertson, 1991). Furthermore, a constitutively expressed
Hsp70 localizes to the centrosomes of mitotic animal cells
(Brown et al., 1996a), and a stress-induced Hsp70 that localizes
to the centrosome following heat shock is required for
restoration of structure and microtubule organizing (MTOC)
function to a thermally inactivated centrosome (Brown et al.,
1996b). It remains to be determined whether J proteins are
paired with the Hsp70 species that are now known to be present
in such MTOCs, but given the many other Hsp70 functions that
are known to require J-protein partners, it is reasonable to
assume that this one does also. (4) We have recently established
that anti-Hsp70 antibodies stain the mitotic-spindle regions of
cleaving Volvox embryos in a pattern similar to that illustrated
in Fig. 4 for HA-tagged GlsA (data not shown).
All these considerations lead us to speculate that GlsA may
function in asymmetric division by complexing with an Hsp70
that is a structural component of the Volvox division apparatus,
and that formation of this complex ultimately leads to
formation of a cleavage furrow at an off-center location.
Visualization of the ways in which a GlsA-Hsp70 complex on
the division apparatus might lead to formation of an eccentric
furrow will be facilitated by a brief discussion of the nature of
the cell division apparatus in the Volvocales (the order of green
flagellates to which Volvox belongs), because the volvocalean
division apparatus is as different from the division apparati of
plants or animals as those are from one another (reviewed in
more detail, with fuller documentation, by Kirk, 1998).
In all volvocalean cells, the basal bodies (BBs) act as the
organizational centers of the cell throughout the cell cycle,
being connected directly or indirectly to all other organelles via
a complex (yet highly regular) array of cytoskeletal elements
that constitute parts of the basal-body apparatus, or BBA, which
is the centrosome equivalent of the volvocalean cell. Whereas
these BBs sit at the bases of the flagella during interphase,
during mitosis the cells are devoid of flagella, yet the BBs
remain attached to the plasmalemma – and to an array of other
organelles – while serving as centrioles at the poles of the
mitotic spindle. With respect to division-plane specification, the
most important cytoskeletal attachments to the BBs are a
cruciate array of four ‘microtubule rootlets’ (MTRs) that radiate
from the BBs beneath the plasmalemma. Rootlets containing
two and four microtubules (2MTRs and 4MTRs, respectively)
alternate in this cruciate array (Fig. 7). The location of the
2MTRs throughout interphase predicts the axis in which the
next mitotic spindle will elongate, whereas the position of the
4MTRs not only predicts, it specifies the plane in which the cell
will next divide (Ehler et al., 1995). The reason that these
relationships are generalizable is that during prophase
volvocalean BBs separate (as the spindle forms and elongates
between them) in the direction that is defined by their associated
2MTRs, whereas during telophase the 4MTRs act as the
MTOCs for two parallel sheets of ‘cleavage microtubules’ that
define the plane in which the cleavage furrow will ingress (Ehler
and Dutcher, 1998; Gaffal and el-Gammal, 1990). While
cytokinesis is progressing, the (newly duplicated) BBs perform
an additional series of directed movements that are of particular
importance in the present context: while still attached to the
plasmalemma, they move in a complex three-dimensional
trajectory back toward and along the developing cleavage
furrow, while undergoing a partial rotation, eventually settling
down in predictable locations and orientations – whereupon a
new cruciate array of MTRs is formed around them. The reason
that this complex (and as yet incompletely described) set of
telophase movements of the BBA seems particularly important
to us is because all present indications are that the locations and
orientations that are assumed by the BBs and their new MTRs
at the end of this set of movements in division cycle n determine
the plane of division n+1. In most volvocalean cell cycles, the
new BBA formed at the end of any division cycle is positioned
in such a way that the next division will be symmetrical. But
our working hypothesis is that it is at this particular stage – at
telophase of division n – that GlsA and the proteins with which
it associates act to position the BBA eccentrically, thereby
preparing the cell to divide asymmetrically during division
cycle n+1.
We can visualize at least three quite different ways in which
a GlsA-Hsp70 complex on the BBA might act, in conjunction
with other factors, to prepare a blastomere for asymmetric
division: (1) In the simplest version, as the BBA with its
associated GlsA-Hsp70 complex is moving about at the end of
division cycle n, GlsA makes contact with and binds to its
second ligand, ‘M’ (which is located on the plasmalemma at
an eccentric site) and this causes the BBA to become tethered
to this eccentric site (Fig. 7). (2) Alternatively, GlsA might act
as an adapter that links the BBA Hsp70 to a cytoplasmic
protein, such as a microtubule motor protein, that is required
to move the BBA along the underside of the plasmalemma to
its predestined off-center location. (Such a scheme would
involve an interesting mechanistic parallel to asymmetric
division in early C. elegans embryos, where a microtubule
motor appears to be involved in moving the centrosomal
apparatus with respect to an eccentric binding site on the
membrane after division n, to prepare the cell for division n+1;
Waddle et al., 1994). (3) Finally, in parallel with the roles of
certain other J-protein-Hsp70 partnerships in protein synthesis
and several other cellular functions (Caplan et al., 1993; Craig
et al., 1994; Cyr et al., 1994), the postulated GlsA-Hsp70
complex of Volvox may function by directing the assembly of
The Volvox glsA gene
a multi-protein complex (presumably BBA associated) that
will then act, independently of GlsA and Hsp70, to effect
eccentric positioning of the BBA. Sorting out which if any of
these possibilities is realized in dividing Volvox embryos will
require identification and characterization of molecules to
which GlsA binds, as well as elucidation of the spatial
distribution of GlsA and its binding partners in blastomeres
that are preparing to divide asymmetrically.
In summary, because asymmetric cell division is so crucial
to Volvox cell fate determination, the isolation of the glsA gene
is an important step in our attempts to understand how the
division of labor between the two cell types of this model
organism is programmed and executed. But it is only a first
step. The study of additional gls genes, and of factors that
interact with GlsA, will be required to provide a more complete
picture of how positioning of the cell division plane is
controlled in Volvox, and possibly in other multicellular
organisms as well.
We thank L. Duncan, M. Kirk, G. Köhl, J. McNally, I. Nishii, B.
Taillon and C. Wagner for helpful discussions and/or comments on an
earlier version of the manuscript, P. Bommarito, M. B. Karr and W.
Müller for technical support, L. Ellis for providing the anti-HA
monoclonal antibody, J. Rosenbaum for providing the anti-β-tubulin
polyclonal antibody and I. Nishii for advice regarding preparation of
V. carteri embryos for immunocytology. This work was supported by
an NSF postdoctoral fellowship (#BIR-92-03682) to S. M., and by
research grants from the NSF (no. MCB-9304447) to D. K., and from
the USDA (no. 97-3504-4626) to D. K. and S. M.
REFERENCES
Altschul, S. F., Gish, W., Miller, W., Myers, E. W. and Lipman, D. J. (1990).
Basic local alignment search tool. J. Mol. Biol. 215, 403-410.
Atassi, M. Z. and Webster, R. G. (1983). Localization, synthesis, and activity
of an antigenic site on influenza hemaglutinin. Proc. Natl. Acad. Sci. USA
80, 840-844.
Bloch, M. A. and Johnson, K. A. (1995). Identification of a molecular
chaperone in the eukaryotic flagellum and its localization to the site of
microtubule assembly. J. Cell Sci. 108, 3541-3545.
Broadus, J. and Doe, C. Q. (1997). Extrinsic cues, intrinsic cues, and
microfilaments regulate asymmetric protein localization in Drosophila
neuroblasts. Curr. Biol. 7, 827-835.
Brodsky, J. L. and Schekman, R. (1993). A sec63-BiP complex from yeast
required for protein translocation in a reconstituted proteoliposome. J. Cell
Biol. 123, 1355-1363.
Brown, C. R., Doxsey, S. J., Hong-Brown, L. Q., Martin, R. L. and Welch,
W. J. (1996a). Molecular chaperones and the centrosome. A role for TCP1 in microtubule nucleation. J. Biol. Chem. 271, 824-832.
Brown, C. R., Hong-Brown, L. Q., Doxsey, S. J. and Welch, W. J. (1996b).
Molecular chaperones and the centrosome. A role for hsp 73 in centrosomal
repair following heat shock treatment. J. Biol. Chem. 271, 833-840.
Caplan, A. J., Cyr, D. M. and Douglas, M. G. (1992). YDJ1p facilitates
polypeptide translocation across different intracellular membranes by a
conserved mechanism. Cell 71, 1143-1155.
Caplan, A. J., Cyr, D. M. and Douglas, M. G. (1993). Eukaryotic
homologues of Escherichia coli DnaJ: a diverse protein family that functions
with HSP70 proteins. Mol. Biol. Cell 4, 555-563.
Coggin, S. J., Hutt, W. and Kochert, G. (1979). Sperm bundle-female
somatic cell interaction in the fertilization process of Volvox carteri f.
weismannia. J. Phycol. 15, 247-251.
Craig, E. A., Baxter, B. K., Becker, J., Halladay, J. and Ziegelhoffer, T.
(1994). Cytosolic hsp70s of Saccharomyces cerevisiae: roles in protein
synthesis, protein translocation, proteolysis, and regulation. In The Biology
of Heat Shock Proteins and Molecular Chaperones (ed. R. I. Morimoto, A.
Tissiéres and N. Georgopoulos), pp. 31-52. Plainview, NY: Cold Spring
Harbor Laboratory Press.
657
Cyr, D. M., Langer, T. and Douglas, M. G. (1994). DnaJ-like proteins:
molecular chaperones and specific regulators of Hsp70. Trends Biochem.
Sci. 19, 176-181.
Di Laurenzio, L., Wusocka-Diller, J., Malamy, J. E., Pysh, L., Helariutta,
Y., Freshour, G., Hahn, M. G., Feldman, K. A. and Benfey, P. N. (1996).
The SCARECROW gene regulates an asymmetric cell division that is
essential for generating the radial organization of the Arabidopsis root. Cell
86, 423-433.
Doe, C. Q. (1996). Spindle orientation and asymmetric localization in
Drosophila: Both Inscuteable? Cell 86, 695-697.
Ehler, L. L. and Dutcher, S. K. (1998). Pharmacological and genetic evidence
for a role of rootlet and phycoplast microtubules in the positioning and
assembly of cleavage furrows in Chlamydomonas reinhardtii. Cell Motil.
Cytoskeleton 40, 193-207.
Ehler, L. L., Holmes, J. A. and Dutcher, S. K. (1995). Loss of spatial control
of the mitotic spindle apparatus in a Chlamydomonas reinhardtii mutant
strain lacking basal bodies. Genetics 141, 945-960.
Field, J., Nikawa, J.-J., Broek, D., MacDonald, B., Rodgers, L., Wilson, I.
A., Lerner, R. and Wigler, M. (1988). Purification of a RAS-responsive
adenyl cyclase complex from Saccharomyces cerevisiae by use of an epitope
addition method. Mol. Cell. Biol. 8, 2159-2165.
Gaffal, K. P. and el-Gammal S. (1990). Elucidation of the enigma of the
“metaphase band” of Chlamydomonas reinhardtii. Protoplasma 156, 139148.
Goodner, B. and Quatrano, R. S. (1993). Fucus embryogenesis: a model to
study the establishment of polarity. Plant Cell 5, 1471-1481.
Guo, S. and Kemphues, K. J. (1996). A non-muscle myosin required for
embryonic polarity in Caenorhabditis elegans. Nature 382, 455-458.
Horvitz, H. R. and Herskowitz, I. (1992). Mechanisms of asymmetric cell
division: two Bs or not two Bs, that is the question. Cell 68, 237-255.
Kelley, W. L. (1998). The J-domain family and the recruitment of chaperone
power. Trends Biocem. Sci. 23, 222-227.
Kimura, Y., Yahara, I. and Lindquist, S. (1995). Role of the protein
chaperone YDJ1 in establishing Hsp980-mediated signal transduction
pathways. Science 268, 1362-1365.
Kirk, D. L. (1998). Volvox: The Molecular Genetic Origins of Multicellularity
and Cellular Differentiation. Cambridge: Cambridge University Press.
Kirk, D. L., Kaufman, M. R., Keeling, R. M. and Stamer, K. A. (1991).
Genetic and cytological control of the asymmetric divisions that pattern the
Volvox embryo. Development Supplement 1, 67-82.
Kirk, M. M. and Kirk, D. L. (1985). Translational regulation of protein
synthesis, in response to light, at a critical stage of Volvox development.
Cell 41, 419-428.
Kirk, M. M., Ransick, A., McRae, S. E. and Kirk, D. L. (1993). The
relationship between cell size and cell fate in Volvox carteri. J. Cell Biol.
123, 191-208.
Kraut, R., Chia, W., Jan, L. Y., Jan, Y. N. and Knoblich, J. A. (1996). Role
of inscuteable in orienting asymmetric cell divisions in Drosophila. Nature
383, 50-55.
Lewis, V. A., Hynes, G. M., Zheng, D., Saibil, H. and Willison, K. (1992).
T-complex polypeptide-1 is a subunit of a heteromeric particle in the
eukaryotic cytosol. Nature 358, 249-252.
Lloyd, C. W. (1991). The Cytoskeletal Basis of Plant Growth and Form. New
York: Academic Press.
Mages, W., Salbaum, J. M., Harper, J. F. and Schmitt, R. (1988).
Organization and structure of Volvox α-tubulin genes. Mol. Gen. Genet. 213,
449-458.
Matsumoto-Taniura, N., Pirollet, F., Monroe, R., Gerace, L. and
Westendorf, J. M. (1996). Identification of novel M phase phosphoproteins
by expression cloning. Mol. Biol. Cell 7, 1455-1469.
McGrail, M. and Hays, T. S. (1997). The microtubule motor cytoplasmic
dynein is required for spindle orientation during germline cell divisions and
oocyte differentiation in Drosophila. Development 124, 2409-2419.
Miller, S. M., Schmitt, R. and Kirk, D. L. (1993). Jordan, an active Volvox
transposable element similar to higher plant transposons. Plant Cell 5, 11251138.
Raff, J. W. and Glover, D. M. (1989). Centrosomes, not nuclei, initiate pole
cell formation in Drosophila embryos. Cell 57, 611-619.
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning: A
Laboratory Manual, Second Edition Cold Spring Harbor, NY: Cold Spring
Harbor Laboratory Press.
Schiedlmeier, B., Schmitt, R., Müller, W., Kirk, M. M., Gruber, H., Mages,
W. and Kirk, D. L. (1994). Nuclear transformation of Volvox carteri. Proc.
Natl. Acad. Sci. USA 91, 5080-5084.
658
S. M. Miller and D. L. Kirk
Schlenstedt, G. S., Harris, S., Risse, B., Lill, R. and Silver, P. A. (1995). A
yeast DnaJ homologue, Scj1p, can function in the endoplasmic reticulum
with BiP/Kar2p via a conserved domain that specifies interaction with
Hsp70s. J. Cell Biol. 129, 979-988.
Schmitt, R., Fabry, S. and Kirk. D. L. (1992). In search of the molecular
origins of cellular differentiation in Volvox and its relatives. Int. Rev. Cytol.
139, 189-265.
Sell, S. M., Eisen, C., Ang, D., Zylicz, M. and Georgopoulos, C. (1990).
Isolation and characterization of dnaJ mutants of Escherichia coli. J.
Bacteriol. 172, 4827-4835.
Shoji, W., Inoue, T., Yamamoto, T. and Obinata, M. (1995). MIDA1, a
protein associated with Id, regulates cell growth. J. Biol. Chem. 270, 2481824825.
Silver, P. A. and Way, J. C. (1993). Eukaryotic DnaJ homologs and the
specificity of Hsp70 activity. Cell 74, 5-6.
Skop, A. R. and White, J. G. (1998). The dynactin complex is required for
cleavage plane specification in early Caenorhabditis elegans embryos. Curr.
Biol. 8, 1110-1116.
Starr, R. C. (1969). Structure, reproduction, and differentiation in Volvox
carteri f. nagariensis Iyengar, strains HK 9 and 10. Arch. Protistenkd. 111,
204-222.
Starr, R. C. (1970). Control of differentiation in Volvox. Dev. Biol. (suppl.) 4,
59-100.
Strome, S. (1993). Determination of Cleavage Planes. Cell 72, 3-6.
Stukenberg, P. T., Lustig, K. D., McGarry, T. J., King, R. W., Kiang, K.
and Kirschner, M. W. (1997). Systematic identification of mitotic
phosphoproteins. Curr. Biol. 7, 338-348.
Tam, L.-W. and Kirk, D. L. (1991). The program for cellular differentiation
in Volvox carteri as revealed by molecular analysis of development in a
gonidialess/somatic regenerator mutant. Development 112, 571-580.
Tsai, J. and Douglas, M. G. (1996). A conserved HPD sequence of the Jdomain is necessary for YDJ1 stimulation of Hsp70 ATPase activity at a site
distinct from substrate binding. J. Biol. Chem. 271, 9347-9354.
Ursic, D. and Culbertson, M. (1991). The yeast homologue to mouse TCP1 affects microtubule mediated processes. Mol. Cell. Biol. 11, 2629-2640.
Waddle, J. A., Cooper, J. A. and Waterston, R. H. (1994). Transient
localized accumulation of actin in Caenorhabditis elegans blastomeres with
oriented asymmetric divisions. Development 120, 2317-2328.
White, J. and Strome, S. (1996). Cleavage plane specification in C. elegans:
How to divide the spoils. Cell 84, 195-198.
Zhong, T. and Arndt, K. (1993). The yeast S1S1 protein, a DnaJ homolog,
is required for the initiation of translation. Cell 73, 1175-1186.
Zwaal, R. R., Ahringer, J., van Luenen, H. G. A. M., Rushforth, A.,
Anderson, P. and Plasterk, R. H. A. (1996). G proteins are required for
spatial orientation of early cell cleavages in C. elegans embryos. Cell 86,
619-629.