Download Novel leader exons of the cyclic adenosine 3 ,5

Molecular Human Reproduction Vol.8, No.11 pp. 965–976, 2002
Novel leader exons of the cyclic adenosine 3⬘,5⬘monophosphate response element modulator (CREM) gene,
transcribed from promoters P3 and P4, are highly testisspecific in primates*
Birgit Gellersen1, Rita Kempf1, Reinhild Sandhowe2, Gerhard F.Weinbauer2,3 and
Rüdiger Behr2,4,5
1IHF
Institute for Hormone and Fertility Research, University of Hamburg, D-22529 Hamburg and 2Institute of Reproductive
Medicine of the University of Münster, D-48149 Münster, Germany
3Present address: Covance Laboratories GmbH, D-48163 Münster, Germany
4Present address: Institute of Anatomy, Developmental Biology, University of Essen, D-45122 Essen, Germany
5To
whom correspondence should be addressed at: Institute of Anatomy, Developmental Biology, University of Essen,
Hufelandstraβe 55, D-45122 Essen, Germany. E-mail: [email protected]
Testicular expression of CREM is essential for spermatogenesis in the mouse. From a monkey testis cDNA library we isolated
a CREM transcript isoform with a novel 5⬘ exon θ2 which provides at its 3⬘-end an in-frame ATG to the downstream reading
frame. 5⬘-RACE on human testis cDNA indicated that exon θ2 is ≥113 bp in size. Moreover, a second novel leader exon, θ1, of
≥289 bp was identified and encodes a putative open reading frame of 26 amino acids. In-vitro translation and cellular expression
of CREM-θ1 and CREM-θ2 splice variants cloned from human testis yielded not only full length proteins but also shorter
repressor products resulting from downstream translation initiation. Upon co-transfection, products of CREM-θ2 cDNA
repressed protein kinase A-induced activation of a CRE-driven reporter construct. RT–PCR analysis of primate tissues for
CREM-θ2 transcripts showed abundant expression in the testis and very low levels or absence from all other tissues tested.
CREM-θ1 mRNA was exclusively expressed in the testis. Promoters P3 and P4, flanking exons θ1 and θ2, were cloned and
found to be non-responsive to protein kinase A in transfection assays. Furthermore, we show differential activation of P1, P3
and P4 during mouse postnatal testicular development, suggesting cell- and stage-specific regulatory mechanisms for these
CREM promoters.
Key words: alternative promoter/CREM/isoform/primate spermatogenesis/testis
Introduction
Spermiogenesis encompasses the post-meiotic cellular differentiation
of male germ cells from spherical immotile cells to highly motile
sperm (Russell et al., 1990). This includes complex reorganization
of the cytoskeleton and chromatin as well as the establishment of the
acrosome, a derivative of the Golgi apparatus, containing proteolytic
enzymes. Products of the CREM gene are considered to be key
factors for rodent spermiogenesis. Deletion of the CREM gene leads
to infertility in the male mouse (Blendy et al., 1996; Nantel et al.,
1996). Histological analysis of CREM-deficient mice has revealed a
highly specific arrest at early post-meiotic germ cell differentiation.
This observation matches with the onset of highest CREM activator
protein expression in the rodent testis (Delmas et al., 1993; Behr and
Weinbauer, 1999). Moreover, several CREM target genes with high
expression in spermatids have been identified (Behr and Weinbauer,
2001). When related to spermatid development, the CREM protein
*This work was presented in part at the 83nd Annual Meeting of the
Endocrine Society, June 2001, in Denver, CO, USA.
© European Society of Human Reproduction and Embryology
expression pattern is very similar between the rodent and the primate
testis (Behr and Weinbauer, 1999). CREM expression attains peak
levels in those stages associated with the formation of the acrosome
(Russell et al., 1990), and vanishes at the initiation of nuclear
elongation. CREM expression has also been investigated in patients
with spermatid maturation arrest by immunohistochemistry and insitu hybridization. The findings revealed reduced or absent CREM
expression in patients with blocked spermatid maturation (Weinbauer
et al., 1998; Steger et al., 1999), and suggest that CREM also
functions as a key regulator of spermiogenesis in the primate testis.
However, primate CREM gene regulation and function has been
much less intensively investigated than in the rodent. In order to gain
better insight into the expression and role of CREM in the primate
testis, we constructed a cynomolgus monkey testis cDNA library and
screened for novel CREM transcripts.
The CREM gene gives rise to a plethora of products due to
mechanisms of alternative promoter usage, alternative splicing and
alternative translation initiation (de Groot and Sassone-Corsi, 1993;
Lamas et al., 1996; Walker and Habener, 1996; Sanborn, 2000;
965
B.Gellersen et al.
Gellersen et al., 1997; Behr and Weinbauer, 2000). When transcription
is initiated at promoter 1 (P1), the translational start codon is located
in exon B which can be spliced to various combinations of downstream
exons including exon Ψ (resulting in an early stop codon), C (the
first Q-rich transactivation domain, τ1), E plus F (the kinase-inducible
domain, KID), G (the second transactivation domain, τ2), the small
γ-exon, H (the basic region, BR), and the entire exon I (Ia ⫹ Ib)
(resulting in translation of the first DNA-binding domain, DBD I,
followed by a stop codon), or the 3⬘-portion of exon I (Ib) (resulting
in translation of DBD II). A cAMP-inducible intronic downstream
promoter, P2, gives rise to the transcriptional repressor ICER
(inducible cAMP early repressor) lacking phosphorylation and transactivation domains (Masquilier et al., 1993; Molina et al., 1993;
Fujimoto et al., 1994; Bodor et al., 1996; Gellersen et al., 1997;
Müller et al., 1998). Recently, additional exons θ1 and θ2, transcribed
from novel promoters P3 and P4 with activity in the testis, have been
identified in the rat CREM gene (Daniel et al., 2000).
Here we report the isolation of CREM exons θ1 and θ2 from
the primate testis and demonstrate highly testis-specific activity of
promoters P3 and P4 in primates. Characterization of the CREM-θ1
and CREM-θ2 transcripts and their protein products suggests a
specific role during the stage-specific establishment of spermatogenesis.
Materials and methods
Screening of a monkey testis cDNA library
Construction and screening of a cynomolgus monkey (Macaca fascicularis)
testis cDNA library was performed as described earlier (Behr et al., 2000).
The oligo-dT primed cDNA synthesis kit (Stratagene, Heidelberg, Germany)
was used, employing the Uni-ZAP XR unidirectional phagemid vector.
Approximately 1⫻106 recombinant phage clones were screened for the
presence of CREM transcripts using a [32P]dCTP-labelled human CREM
cDNA fragment from the 3⬘-untranslated region (positions 1214–1522;
Genbank HUMCREM1A) (Fujimoto et al., 1994). Plating of recombinant
phages and generation of replica filters were performed according to the
manufacturer’s protocol. The filters were prehybridized at 60°C for 2–4 h.
For hybridization, labelled cDNA was added to a final concentration of
1⫻106 c.p.m./ml of hybridization solution. Hybridization was performed at
60°C for 16 h. Autoradiographic exposure of the filters was carried out at
–80°C for 2 days. Positive clones were purified by plaque isolation and a
subsequent secondary screening procedure. Inserts were excised according to
the manufacturer’s protocol. The resulting phagemid contained the cDNA
inserted at the EcoRI site of pBluescript SK(–). Sequencing of the cDNA was
carried out on both strands using the LICOR sequencer (MWG Biotech,
Ebersberg, Germany).
PCR primers and probes and RT–PCR analysis
Total RNA was isolated from human testis or a range of cynomolgus monkey
tissues by the Ultraspec method (Biotecx, Houston, TX, USA). Oligo(dT)primed first strand cDNA synthesis was performed with MMLV reverse
transcriptase (Promega, Madison, WI, USA) or SuperScript RNase H-reverse
transcriptase (Life Technologies, Karlsruhe, Germany), and subsequent PCR
was performed with Taq polymerase (Promega). Products were separated on
1.5% agarose gels, denatured in 0.4 mol/l NaOH, blotted onto nylon membranes
(Hybond-N; Amersham Pharmacia Biotech, Freiburg, Germany) and hybridized with internal DIG-labelled oligonucleotide probes. Visualization was
performed with the DIG detection kit (Roche Molecular Biochemicals,
Mannheim, Germany). Sequences of human CREM-specific oligonucleotides
used as primers or probes are given in Table I. Primers for amplification
of monkey GAPDH cDNA were: 5⬘-CCAGGGCTGCTTTTAACTCTG-3⬘
(sense); 5⬘-GCAGGGATGATGTTCTGGAGA-3⬘ (antisense), yielding a
product of 571 bp.
Transcripts from mouse testis were analysed by radioactive RT–PCR. Total
testicular RNA from different postnatal time points between days 3 and 70
was isolated using TriReagent LS (Molecular Research Center, Cincinnati,
966
OH, USA) according to the manufacturer’s instructions. RT–PCR analysis
was performed essentially as described (Wilson and Melton, 1994) using
random hexamer primers and SuperScript RNase H-reverse transcriptase.
Radioactively labelled PCR products were separated on a 6% polyacrylamide
gel. The gel was transferred onto Whatman paper and dried. Signals were
detected using a PhosphorImager (Molecular Dynamics). PCR was performed
in a buffer containing 1.5 mmol/l MgCl2 and the conditions used were 1 cycle
at 94°C for 3 min, 22 cycles at 94°C for 45 s, 54°C for 45 s, and 72°C for
1 min, followed by 1 cycle at 72°C for 5 min. After 22 PCR cycles, the
reaction was proven to be in the exponential phase of product amplification
by serial dilution of cDNA from an adult testis. The exon B-specific forward
primer (#3350) and the antisense primer to exon H (#3336) used in this
experiment are listed in Table I; mouse-specific sense primers to exons θ1
and θ2 were: 5⬘-GTGGATGTGGTGGCATCAGCA-3⬘ and 5⬘-GACAGTTCCAGGACAGTGAC-3⬘.
Cloning of human testicular CREM transcripts
The 5⬘-ends of CREM transcripts from human testis were isolated using a 5⬘RACE kit (Roche Molecular Biochemicals, Mannheim, Germany). CREMspecific first strand cDNA synthesis was primed with #3047 in exon H, 5⬘RACE outer and inner primers were located in exon E (#3285 and #3060
respectively). Nested PCR was performed with the 5⬘-anchor primer (5⬘GACCACGCGTATCGATGTCGAC-3⬘) with either Taq or Pfu polymerase
(Promega); products were cloned into the pGEM-T (Promega) or pCR-Blunt
(Invitrogen) vectors respectively, and sequenced on both strands.
Full length cDNA with exon θ2 as the leader exon were amplified by RT–
PCR from human testis RNA using primers #3261 (in exon θ2) and #3264
(adding a FLAG epitope and a NotI site to the 3⬘-end of the DBD II) and
Taq polymerase. Products were cloned into pGEM-T Easy (Promega); and
sequenced. Inserts encompassing exons θ2, E, F, H and Ib and either
containing or lacking exon G were excised with EcoRI/NotI and subcloned
into pcDNA3.1(⫹) (Invitrogen, Karlsruhe, Germany) to yield eukaryotic
expression vectors pcDNA/CREM-θ2-τ2-β and pcDNA/CREM-θ2-β
respectively.
Full length cDNA with exon θ1 as the leader exon were amplified by
RT–PCR from human testis using primers #3311 (in exon θ1) and #3048
(in the 3⬘-UTR of exon Ib) and Taq polymerase, cloned into pGEM-T Easy
and sequenced. Inserts encompassing exons θ1, E, F, H and Ib and either
containing or lacking exon G were amplified by PCR using primers #3311
and #3264 (see above) and Pfu polymerase, cut at the 3⬘-NotI site added by
#3264, and inserted into the EcoRV/NotI sites of pcDNA3.1(⫹) to yield
pcDNA/CREM-θ1-τ2-β and pcDNA/CREM-θ1-β respectively.
Generation of promoter constructs
A 2.9 kb DNA fragment flanking exon θ1 was amplified from human genomic
DNA (Roche Molecular Biochemicals) using Pfu polymerase and primers
#3320 and #3321 (extending to position –173 relative to the start ATG in
exon θ1). The product was digested with SstI (position –2891 relative to the
start ATG in exon θ1) and cloned into the SstI/SmaI sites of the luciferase
reporter vector pGL3-Basic (Promega) to yield the P3 promoter construct
CREM-P3-2.9/luc3. This construct was digested with Ecl136II at the 5⬘-SstI
site and with Bpu1102I at –389 relative to the start ATG, the released fragment
discarded, the overhang filled in with Klenow enzyme, and the ends re-ligated
to yield the truncated promoter construct CREM-P3-0.4/luc3. Similarly, a
further truncation to yield CREM-P3-0.3/luc3 was generated by Ecl136II/
EcoRI collapse on CREM-P3-2.9/luc3 using the EcoRI site at position –290.
Sequence flanking exon θ2 was isolated with the Genome Walker Kit (BD
Clontech, Heidelberg, Germany). Oligonucleotides #3263 and #3278 (antisense
to exon θ2) were used as nested gene-specific primers GSP1 and GSP2
on the DNA libraries DL-EcoRV and DL-DraI with Expand polymerase
(Roche Molecular Biochemicals). Products were cloned into pCR-XL-TOPO
(Invitrogen) and sequenced at the ends. A 3.2 kb insert from one of the DLEcoRV clones, extending from the genomic EcoRV site at position –3255
relative to the ATG in exon θ2 to position –53, was excised with SmaI (in
the Genome Walker adapter sequence at the 5⬘-end) and EcoRV (in the 3⬘polylinker of pCR-XL-TOPO) and ligated into the SmaI site of pGL3-Basic
to yield P4 promoter construct CREM-P4-3.2/luc3. From one of the DL-DraI
clones, a 0.6 kb fragment extending from the genomic XbaI site (position
–614) to –53 was isolated by XbaI digestion, followed by polishing, and
CREM isoforms in primate testis
Table I. Sequences of primers and probes specific to human cyclic adenosine 3⬘,5⬘-monophosphate response element modulator (CREM)
Name
Locationa
Orientationb
Sequence (5⬘–3⬘)
#3350
#3044
#3320
#3321
#3311
#3337
#3261
#3260
#3278
#3263
#3051
#3060
#3285
#3317
#3052
#3046
#3336
#3047
#3327
#3264
exon B
exon B
intron 4 (flanking P3)
exon θ1
exon θ1
exon θ1
exon θ2
exon θ2
exon θ2
exon θ2
exon C
exon E
exon E
exon F
exon G
exon γ
exon H
exon H
exon Ia
exon Ib
(s)
(s)
(s)
(as)
(s)
(s)
(s)
(s)
(as)
(as)
(as)
(as)
(as)
(as)
(as)
(as)
(as)
(as)
(as)
(as)
#3048
exon Ib
(as)
ATGACCATGGAAACAGTTGAATC
ACTGGGCAAATTTCAATCCCTGC
ACTTTGGGAGCCTGAGTTGGGTGGATT
CTCTGACCCGTAGCTAGGTTCCCTCACG
CAACACTGTGAGGTTTTCCCAGTT
GGATGTGGTGGCATCAGCAT
ACCGAAGTATGGGCACCA
AGTGATAAGGAGCATGTGTTCC
AGGAACACATGCTCCTTATCGCTTTTGG
CATCGGTAGGTGGTTACTGTCCTG
ATGTATAGTTTGGCCCGAAGGTAAC
AATTACACCTTCTGATTCTGCAG
CTATAAGAGGGTCTTCGTGAAAGG
TGTATTGCCCCGTGCTAGTCTG
ACCATCAGATCCTGGGTTAGAAATC
GACTTGGGGCAAGTTCAGTTTCC
TGGTAAGTTGGCATGTCACC
CAAACTTCCGGGCGATGCAGCCATC
CACACGATTTTCAAGACATTTG
gaattgcggccgcttatttgtcgtcatcgtctttgtagtc
ATC(A/T)GTTTTGGGAGAACAAATGc
CAGTTCATAGTTAAATATTTCTAGTA
aPrimers are listed in 5⬘ to 3⬘ order
b(s) ⫽ sense; (as) ⫽ antisense.
along the human CREM gene.
cThis
primer eliminates the stop codon terminating the DBD II, and adds a 3⬘-FLAG epitope (italics) flanked by a NotI site (underlined); CREM-specific
sequence is given in upper case letters.
EcoRV digestion in the 3⬘-polylinker of pCR-XL-TOPO. The fragment was
inserted into the SmaI site of pGL3-Basic to yield CREM-P4-0.6/luc3.
Results
Cell culture and transient transfections
Screening of a cDNA library from cynomolgus monkey (Macaca
fascicularis) testis with a human CREM cDNA fragment located in
the 3⬘-untranslated region of exon Ib yielded five clones. All clones
contained exons E, F, G, H, and Ib, encoding the kinase-inducible
domain (KID), the second transactivation domain (τ2), the basic
region (BR) and the second of two alternative DNA binding domains
(DBD II) (see also Figure 1A for modular structure of CREM). The
5⬘-end of three of the clones consisted of an exon B sequence. These
clones therefore represented a transactivator isoform (CREM-τ2-β)
previously isolated from other species (de Groot and Sassone-Corsi,
1993; Laoide et al., 1993; Walker et al., 1994; Behr et al., 2000).
However, two of the clones displayed up to 98 bp of novel sequence
which was spliced to exon E. This prompted us to perform 5⬘-RACE
on human testicular cDNA in searching for the corresponding human
sequence. Of ten 5⬘-RACE clones isolated using antisense primers
anchored in exon E, two contained either exon A0 or B spliced to
exon E. Four clones comprised novel 5⬘ sequence corresponding
to that isolated from monkey testis (Figure 1A, exon θ2) and four
clones contained unrelated novel sequence (Figure 1A, exon θ1).
During the course of our work, isolation of exons θ1 and θ2 from
rat testis was reported (Daniel et al., 2000). An alignment of human
and rat exons θ1, and of human, monkey and rat exons θ2, is shown
in Figure 1B. Exon θ1 contributes an open reading frame (ORF) of
26 amino acids when spliced to exon E. While the protein coding
regions are highly homologous between human and rat, human exon
θ1 extends 艌150 bp further upstream than rat exon θ1. The 5⬘-end
of rat exon θ1 has been deduced from the longest mouse EST clone
(Daniel et al., 2000); alignment with the 5⬘-flanking rat genomic
DNA reveals high homology to the human exon θ1 5⬘-UTR. Human
and monkey exons θ2 are at least 79 and 64 bp longer than the
corresponding rat exon respectively; in all species the 3⬘-end of
exon θ2 provides a methionine codon which is in-frame with the
downstream exon E.
The human uterine sarcoma cell line SKUT-1B (HTB 115, American Type
Culture Collection, Rockville, MD, USA) was maintained in DMEM/Ham’s
F-12 (1 ⫹ 1) with 10% FCS, 50 IU/ml penicillin and 50 µg/ml streptomycin.
Transfections were performed by the calcium phosphate precipitation method
(Profection; Promega). Cells were plated in 24-well plates (0.7⫻105 cells/
well) and received 1 µg of reporter plasmid and 0.05 µg of each expression
vector including the β-galactosidase expression vector pCMV/LacZ (kindly
provided by Dr G.E.DiMattia, London Regional Cancer Centre, Ontario).
When promoter constructs of various lengths were compared, equimolar
amounts were applied, and the total amount of DNA was kept constant by
the addition of irrelevant plasmid DNA. The DNA precipitate was removed
from the cells 16 h later and replaced by fresh medium. Cell extracts were
harvested after an additional 24 h for chemiluminescent luciferase assay
(Promega) and β-galactosidase assay (Galacto-Light; Tropix, Bedford, MA,
USA). Transfections were performed in triplicates on several independent
cultures. Expression vectors for the catalytic subunit of PKA, pRSV-Cβ, and
an inactive mutant thereof, pRSV-Cβmut, were kindly provided by Dr Richard
Maurer (Oregon Health Sciences University, Portland, OR, USA) (Maurer,
1989). The cAMP-responsive reporter construct pCRE/-36rPRL/luc3 has been
described previously (Gellersen et al., 1997).
Protein analysis
CREM/FLAG constructs in pcDNA3.1 were subjected to in-vitro transcription/
translation using the TNT T7 coupled reticulocyte lysate system (Promega)
as described previously (Gellersen et al., 1997). Immunoprecipitation with
FLAG antiserum (D-8; Santa Cruz Biotechnology, Santa Cruz, CA, USA)
and sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS–
PAGE) analysis have been described (Gellersen et al., 1997). For Western
blot analysis of cellular proteins, COS-7 cells were transfected with CREM/
FLAG constructs in pcDNA3.1 and harvested 40 h later directly in SDS
sample loading buffer. Proteins were resolved by SDS–PAGE and transferred
to polyvinylidene fluoride membrane (Millipore, Eschborn, Germany).
Immunodetection was performed by enhanced chemiluminescence (SuperSignal; Pierce, Bonn, Germany) with antiserum against human CREM-1
(1:500; Santa Cruz) or monoclonal FLAG antibody M2 (1:1000; Sigma).
Isolation of novel CREM isoforms from primate testis
967
B.Gellersen et al.
Figure 1. Isolation of novel CREM transcripts from monkey and human testis. (A) The published exons of the human CREM gene are shown in the top
panel (non-coding sequence is shown as open boxes; start and stop codons are marked by a black arrowhead). Transcription initiation at promoter P1 yields
transcripts with the translational start codon located in exon B. Exon C encodes the first Q-rich transactivation domain (τ1), exons E and F, the kinaseinducible domain (KID), exon G, the second transactivation domain (τ2), exon H the basic region (BR), followed by either the entire exon I (Ia ⫹ Ib)
resulting in translation of the first DNA-binding domain (DBD I, followed by a stop codon), or by the 3⬘-portion of exon I (Ib) resulting in translation of
DBD II. Splice variants including exon Ψ have an early stop codon. 5⬘-RACE was performed on human testis cDNA using two nested primers anchored in
exon E (#3285 and #3060). The composition of 10 clones is shown in the bottom panel. Newly identified exons θ1 and θ2 contain potential in-frame start
methionines. (B) The top panel shows an alignment of human exon θ1 sequence with rat exon θ1 and 5⬘-flanking genomic sequence. Human exon θ1 extends
at least 150 bp further upstream than rat exon θ1. The 5⬘-end of rat exon θ1 has been deduced from the longest mouse EST and is marked by a bracket and a
vertical arrow (Daniel et al., 2000). Exon θ1 adds an open reading frame of 26 amino acids, highly homologous to the rat, when spliced to exon E. The
bottom panel shows an alignment of human and monkey exon θ2 sequence to the corresponding rat exon which is markedly shorter (Daniel et al., 2000). In
all species the 3⬘-end of exon θ2 encodes a methionine start codon which is in-frame with the downstream exon E. Conserved bases and amino acids are
shown as dots. The position of sense oligonucleotide primers used in subsequent experiments is indicated on top of the human cDNA sequence. Human exon
θ1 and θ2, and monkey exon θ2 sequences have been submitted to the GenBank database under accession numbers AF417234, AF417233 and AY055107.
968
CREM isoforms in primate testis
Figure 2. Map of the human CREM gene including novel promoters P3 and P4. The complete map of the human CREM gene was deduced from published
cDNA sequences (GB_S68134, HUMHCREM1A, HUMHCREM2B, HSCREMPSI) (Masquilier et al., 1993; Fujimoto et al., 1994; Gellersen et al., 1997) and
human chromosome 10 working draft sequence (NT_0088583.6). Non-coding region is shown as open boxes, potential start methionines and stop codons are
marked by arrowheads; sizes of exons are given in bp, and sizes of introns are shown in italics. Transcription of the CREM gene is driven by promoter P1 or
the alternative cAMP-inducible intronic promoter P2 which gives rise to the transcriptional repressor ICER. The presence of exons θ1 and θ2 suggests
transcriptional initiation at novel promoters P3 and P4, as described in the rat (Daniel et al., 2000).
Figure 3. Expression of splice variants containing exons θ1 and θ2 in human testis. CREM cDNA from two individual human testis samples was amplified
by RT–PCR using an antisense primer to the 3⬘-untranslated region of exon Ib (#3048; see Figure 5A) and sense primers for exons θ1 (top panel) or θ2
(bottom panel) respectively (#3311 or #3260; see Figures 1B and 5A). Five parallel Southern blots were produced from each PCR reaction and hybridized
with exon-specific oligonucleotide probes specific to exons E (#3060), F (#3317), G (#3052), γ (#3046), H (#3047), C (#3051) or Ia (#3327). With the probes
to exons C and Ia, signals were only obtained after prolonged exposure. The left panel shows an ethidium bromide stain of the gels and indicates positions of
size markers in kb.
Structural organization of the human CREM gene and
analysis of CREM θ splice variants
Transcription of the CREM gene can be driven by promoter P1 or
the alternative cAMP-inducible intronic promoter P2 which gives rise
to the transcriptional repressor ICER. The presence of exons θ1 and
θ2 suggests transcriptional initiation at novel promoters P3 and P4.
A complete map of the human CREM gene was assembled from
database entries (Figure 2). The gene spans ~85 kb on chromosome
10. The 5⬘-UTR of transcripts initiated at P1 is encoded on three
exons (A0, A, and B). Exon θ1 is located 15 kb downstream of exon
Ψ and is separated by a 7.8 kb intron from exon θ2. The intron
between exon θ2 and exon C is very short both in the human and
the rat gene (161 and 145 bp respectively). The precise 5⬘ boundary
of exon C is ambiguous; the 14 bp at the 5⬘-end of exon C (Masquilier
et al., 1993) deviate from the working draft sequence of human
chromosome 10. In contrast to rodent CREM mRNA, the τ1 is
seldom found in human CREM transcripts; splicing of exon C appears
to be a rare event. This was confirmed by RT–PCR analysis of splice
variants in human testis as described below.
The cDNA from two individual human testes was subjected to
PCR to amplify transcripts spanning from either exon θ1 or θ2 to
the 3⬘-UTR in exon Ib (Figure 3). Multiple products were obtained
which were analysed by Southern hybridization using exon-specific
probes. Apparently all products contain exons E, F and H. The largest
of the more abundant PCR products amplified with primers anchored
in exons θ1 or θ2 (sense) and the 3⬘-UTR in exon Ib (antisense)
most likely include exons θ1 or θ2 respectively, E, F, G (⫾ γ), H
and Ib, and lack C and Ia. They are so abundant that they are visible
by ethidium bromide staining. The even larger products detected by
hybridization with a probe to exon C are likely to contain exons θ1
or θ2 respectively, C, E, F, G (⫾ γ), H and Ib. They are rare, only
become visible after extended exposure of the Southern blot and are
not detectable by ethidium bromide staining or upon the shorter
exposure times used for the Southern hybridizations with probes to
exons E, F, G, γ or H. The 1.2 kb product in the lower right hand
panel of Figure 3 represents a rare splice variant including exon Ia
which adds 400 bp and again is only seen after prolonged exposure.
The τ2 domain (exon G) is more frequently present in exon θ1 than
in exon θ2 transcripts.
Tissue-specific expression of CREM θ transcripts
We next investigated the tissue-specificity of CREM transcripts
initiated at promoters P3 and P4, using 17 tissues of the male
cynomolgus monkey plus uterus and ovary (Figure 4). PCR primers
anchored in exon θ1 or θ2 were paired with an antisense primer to
exon H. Exon θ1 was exclusively found in testis. Exon θ2 was
abundantly expressed in testis, and weakly in prostate, seminal vesicle,
and uterus. The transcript isoforms most likely corresponding to the
969
B.Gellersen et al.
Figure 4. CREM isoforms initiated at P3 or P4 are highly specific to the testis in primates. RT–PCR was performed on 17 tissues of the male cynomolgus
monkey plus uterus and ovary. An antisense primer to exon H (#3336; see Figure 5A) was paired with sense primers for exons θ1 (#3337), θ2 (#3261) or B
(#3350). Amplification of GAPDH cDNA was included as a control. Southern blots of PCR products were hybridized with internal oligonucleotide probes
(from top to bottom: specific to exon E, exon θ2, exon B or GAPDH respectively). Migration of size markers is given in bp. The modular composition of the
major PCR products is predicted based on their migration in the gel; inclusion of the γ exon would add 36 bp to all following sizes. Top panel: Testis
amplicons of 672 bp (exons θ1, C, E ⫹ F, G, H), 539 bp (exons θ1, E ⫹ F, G, H) and 483 bp (exons θ1, C, E ⫹ F, H). Middle panel: Amplicons from
uterus and prostate of 557 bp (exons θ2, E ⫹ F, G, H) and from seminal vesicle of 368 bp (exons θ2, E ⫹ F, H). The strong signal from testis may include
amplicons of 690 bp (exons θ2, C, E ⫹ F, G, H), 557 bp (exons θ2, E ⫹ F, G, H), 501 bp (exons θ2, C, E ⫹ F, H), 368 bp (exons θ2, E ⫹ F, H), 315 bp
(exons θ2, G, H) and 126 bp (exons θ2, H). Bottom panel: A smaller amplicon of 148 bp (exons B, H), and an intermediate amplicon of 390 bp (exons B,
E ⫹ F, H). Testis-specific products of 579 bp (exons B, E ⫹ F, G, H) and 712 bp (exons B, C, E ⫹ F, G, H).
different sizes of the PCR products are given in the legend to Figure
4. For comparison, transcripts including exon B, derived from
promoter P1, were amplified and found to be ubiquitously expressed.
Interestingly, only testis showed the presence of an activator isoform
(τ2), whereas the band migrating at ~390 bp in most tissues represents
a repressor composed of exons B, E ⫹ F, and H, and in the lowest
band, exon B is spliced directly to H. Promoters P3 and P4 therefore
underlie highly tissue-specific control, and promoter P1 gives rise to
an activator isoform only in the testis.
Analysis of protein products of CREM θ transcripts
In order to analyse in more detail the modular composition of
CREM-θ1 and CREM-θ2 mRNA and to generate expression vectors
for functional studies, full length cDNA were amplified from human
testis with sense primers anchored in the 5⬘-untranslated regions of
exons θ1 or θ2 respectively, paired with an antisense primer to the
970
3⬘-untranslated region incorporating a FLAG epitope (Figure 5A).
Four families of clones were obtained and sequenced. All contained
the KID, the basic region and DBD II and either lacked or included
the τ2. The cDNA were inserted into the eukaryotic expression
vector pcDNA3.1 and were designated CREM-θ1-τ2-β, CREM-θ1β, CREM-θ2-τ2-β and CREM-θ2-β (the suffix β indicating presence
of DBD II, while α indicates presence of DBD I).
Exons θ1 and θ2 provide an in-frame methionine codon when
spliced to exons E ⫹ F encoding the KID. We wished to determine
whether these putative start methionines were utilized in CREM-θ1
and CREM-θ2 transcripts. In addition, we have previously reported
that three ATG codons in exons F, G and H can give rise to alternative
translation initiation, resulting in N-terminally truncated repressor
isoforms (S-CREM and SS-CREM) (Gellersen et al., 1997). Potential
translation products of CREM-θ1 and CREM-θ2 mRNA and their
estimated sizes are shown in Figure 5A. Expression vectors for the
CREM isoforms in primate testis
Figure 5. Generation of expression vectors for novel CREM transcripts and analysis of encoded proteins. (A) Full length cDNA of CREM-θ1 and CREM-θ2
transcripts were amplified from human testis RNA with sense primers #3311 or #3261, paired with an antisense primer to the 3⬘-untranslated region (#3264)
incorporating a FLAG epitope. The resultant cDNA CREM-θ1-τ2-β, CREM-θ1-β, CREM-θ2-τ2-β, and CREM-θ2-β were inserted into pcDNA3.1. Potential
start methionines are indicated in exons θ1, θ2, F, G and H. Composition and molecular masses of putative protein isoforms resulting from alternative
translation initiation on CREM-θ1 and CREM-θ2 mRNA are depicted. (B) In-vitro transcription/translation was performed on CREM-θ2 (left panel) and
CREM-θ1 (right panel) cDNA in pcDNA3.1 in the presence of [35S]methionine, followed by immunoprecipitation with FLAG antiserum, SDS–PAGE and
autoradiography. For comparison, previously described CREM-τ2-α and CREM-α cDNA in pRc/CMV were included as templates (Gellersen et al., 1997).
Molecular masses of protein isoforms are indicated in kDa. (C) COS-7 cells were transfected with the indicated CREM cDNA in pcDNA3.1, or with empty
expression vector (pcDNA). Cell lysates were subjected to Western blot analysis with anti-CREM-1 antibody.
indicated cDNA were subjected to in-vitro-transcription/translation
in the presence of [35S]methionine, followed by immunoprecipitation
with FLAG antiserum, SDS–PAGE and autoradiography. CREM-τ2α and CREM-α cDNA were included for comparison. They have
been characterized by us previously and are composed of the leader
exon B, exons E ⫹ F, H and Ia (encoding the DBD I) (Gellersen
et al., 1997). CREM-τ2-α is a transcriptional activator containing the
τ2 (exon G) while the repressor CREM-α lacks such a domain. The
autoradiograph in Figure 5B demonstrates that full length proteins
(32, 24.5, 29, 22 kDa) were translated from all four test cDNA,
indicating that the ATG codons in exons θ1 and θ2 can be utilized
by the translational machinery. In addition, translation is initiated at
the ATG in exon F generating S-CREM-τ2-β (20 kDa) and S-CREMβ (13 kDa). These are in fact the predominant products of the
CREM-θ2 cDNA, suggesting that the ATG in exon θ2 provides a
less favourable initiation context than the ATG in exon θ1. The
CREM-τ2-α and CREM-α control cDNA produced predominantly
full length proteins (32.5 and 25 kDa respectively) and additional
truncated forms S-CREM-τ2-α (20 kDa), S-CREM-α (13 kDa) and
SS-CREM-τ2-α (16 kDa) initiated in exons F and G, as reported
971
B.Gellersen et al.
Figure 6. Transcriptional activity of CREM isoforms. SKUT-1B cells were co-transfected with pCRE/-36rPRL/luc3, the catalytic subunit of PKA (PKA-Cβ)
or an inactive mutant thereof (PKA-Cβmut), and expression vectors for the indicated CREM cDNA. Controls received the empty expression vector pcDNA3.1,
and pCMV/LacZ was included in all wells. Luciferase activity was normalized to β-galactosidase activity for each single replicate. Results of a representative
experiment are shown in relative light units (RLU) (means ⫾ SD).
previously (Gellersen et al., 1997). The shortest form, SS-CREM-α/β,
was not observed. In addition, we analysed translation products of
these CREM transcripts in transfected cells. COS-7 cells were chosen
because they can be transfected with high efficiency. Cell extracts
were subjected to Western blot analysis with CREM antibody (Figure
5C). In cells transfected with the empty expression vector pcDNA3.1,
a faint signal was obtained with an endogenous CREM protein
migrating at ~25 kDa. Translation of the CREM-θ2 cDNA yielded
only the truncated S-CREM products initiated in exon F, confirming
poor utilization of the ATG start codon in leader exon θ2 seen by invitro translation (compare Figure 5B, left panel). As already observed
in vitro (Figure 5B, right panel), the start codon in leader exon θ1 is
much more efficiently used for translation initiation in vivo, giving
rise to roughly equal amounts of full length and truncated product.
Notably, both repressor transcripts CREM-θ1-β and CREM-θ2-β are
much more highly expressed than their corresponding activator
counterparts CREM-θ1-τ2-β and CREM-θ2-τ2-β. The CREM-τ2-α
and CREM-α control transcripts, products of promoter P1, yielded
predominantly full length proteins in COS-7 cells as well as in vitro.
Essentially the same results were obtained by immunodecoration of
the Western blot with an antibody against the FLAG epitope (data
not shown).
Transcriptional effects of the novel CREM isoforms were then
tested by transfection analysis in the SKUT-1B cell line (Figure 6).
A luciferase reporter construct driven by a CRE (pCRE/-36rPRL/
luc3) was activated by co-transfection of an expression vector for the
catalytic subunit of protein kinase A, PKA-Cβ. Controls received the
inactive mutant PKA-Cβmut. Co-transfection of CREM-θ1 or CREMθ2 vectors did not significantly affect basal activity of pCRE/-36rPRL/
luc3, but PKA-mediated activation was repressed in the presence of
pcDNA/CREM-θ2-β. The lack of stimulatory activity of the supposed
activator transcripts CREM-θ1-τ2-β and CREM-θ2-τ2-β is likely due
to co-translation of the truncated 20 kDa isoform S-CREM-τ2-β (see
Figure 5B and C) which lacks the PKA phosphorylation site, or to
low overall levels of expression (see Figure 5C). The positive control
construct pcDNA/CREM-τ2-α enhanced PKA-stimulated promoter
activity in accordance with the predominant translation of full length
activator protein (see Figure 5C). Interestingy, the supposed repressor
transcripts CREM-θ1-β and CREM-α did not inhibit PKA-mediated
transcriptional activation; this coincided with a high level of expression
of their respective 24.5 and 25 kDa full length protein products.
These lack the τ2 but still comprise the KID; the question arises as
972
to whether such molecules, possibly dimerized with an activator, do
not counteract PKA-mediated activation.
Regulation of promoters P3 and P4
We next wished to investigate transcriptional activity of the novel
promoters P3 and P4. P3 promoter constructs were generated by PCR
on human genomic DNA. The resultant 2.9 kb fragment was cloned
into the luciferase reporter vector pGL3-Basic. 5⬘-truncated constructs
with 0.4 and 0.3 kb of 5⬘-flanking sequence were also produced. A
3.2 kb fragment flanking P4 was obtained by Genome Walker PCR,
and a 0.6 kb deletion construct was generated by enzymatic digest
(Figure 7A). A computerized search for transcription factor binding
sites revealed two CRE-like elements both in the P3 and the P4 5⬘flanking regions (at positions –791 and –208 relative to the start ATG
in exon θ1, and at –1860 and –1129 relative to the start ATG in exon
θ2). The P3 and P4 promoter/reporter constructs were transfected
into SKUT-1B cells to test responsiveness to PKA activation (Figure
7B). CREM-P3 constructs had a slightly higher basal activity compared with CREM-P4 constructs. However, while the positive control
construct pCRE/-36rPRL/luc3 was induced 17-fold by PKA-Cβ, none
of the CREM-P3 or CREM-P4 promoter constructs responded to
this stimulus.
Finally, in the absence of primate testicular tissue from different
postnatal stages, developmental activation of promoters P1, P3 and
P4 was assessed in testes of mice between 3 and 70 days of age
(Figure 8). RT–PCR with primers specific for exons B, θ1 or θ2,
paired with an antisense primer to exon H, showed low abundance
of numerous splice variants up to day 14 for transcripts derived from
P1 and P4 (initiated at exons B and θ2). The level of transcripts
encoding presumed activator isoforms sharply increased at day 16
(appearance of pachytene spermatocytes), continued to increase until
day 20 (appearance of haploid spermatids) and remained high
thereafter until at least day 70 (full spermatogenesis). In contrast,
activator transcript abundance from P3 (initiated at exon θ1) was low
until day 18 and strongly elevated from day 20 onwards. While two
types of activator transcripts were present among the CREM-B and
CREM-θ1 isoforms, containing either one or two transactivation
domains, only one type of activator splice form including both
transactivation domains was present among the CREM-θ2 transcripts.
Discussion
We identified novel CREM exons in the primate testis by screening
a cynomolgus monkey testis cDNA library and performing
CREM isoforms in primate testis
Figure 7. Cloning and transfection analysis of P3 and P4 promoter/reporter gene constructs. (A) A 2.9 kb fragment flanking the P3 promoter was generated
by PCR on human genomic DNA, using primers #3320 and #3321, and inserted into pGL3-Basic. Downstream restriction at the Bpu1102I or EcoRI sites was
used to produce shorter constructs with 0.4 and 0.3 kb of 5⬘-flanking sequence. A 3.2 kb fragment flanking P4 was obtained by Genome Walker PCR on a
human DNA library using two nested gene-specific 3⬘-primers (GSP1, GSP2). A 0.6 kb deletion was generated by enzymatic digest at the XbaI site.
Rhomboids indicate putative CRE predicted by MatInspector V2.2 based on the Transfac 4.0 database. (B) The indicated P3 and P4 promoter/reporter
constructs, and the positive control construct pCRE/-36rPRL/luc3, were transfected into SKUT-1B cells together with PKA-Cβ or the inactive PKA-Cβmut.
Controls received the promoterless reporter vector pGL3-Basic, and pCMV/LacZ was included in all wells. Luciferase activity was normalized to βgalactosidase activity for each single replicate. Results of a representative experiment are shown in relative light units (RLU) (means ⫾ SD).
5⬘-RACE on cDNA from human testis, and partially characterized
the corresponding novel human promoters P3 and P4. Promoters P3
and P4 give rise to CREM-θ1 and CREM-θ2 transcripts, carrying
novel leader exons θ1 and θ2. These promoters, P3 and P4, of the
CREM gene and the novel exons, θ1 and θ2, have recently also been
described in the rat testis (Daniel et al., 2000). However, human
exons θ1 and θ2 were found to be significantly longer than their rat
counterparts. The sizes of rat exons θ1 and θ2 have been predicted
from the longest mouse EST clones (Daniel et al., 2000). We found
human exon θ1 to extend at least 150 bp further upstream than rat
exon θ1. The remarkably high homology between the 5⬘-UTR of
human exon θ1 and the corresponding rat genomic DNA suggests
that the transcribed region of the rat gene may also extend further
upstream. Human and monkey exons θ2 are at least 79 and 64 bp
longer than the corresponding rat exon. A search of the human EST
database with exon θ1 returned five clones, all from human
testis. Three of those extend to position –265, and two extend to
position –235 relative to the 3⬘-end of exon θ1, and were thus
somewhat shorter than our longest 5⬘-RACE clone extending to
–289. In all EST clones, exon θ1 was followed by exons E ⫹ F and
G. A search with exon θ2 retrieved three EST clones, again all from
human testis. They extend to positions –108 and –113 and therefore
suggest transcription start sites similar to our 5⬘-RACE clones. In
two of the EST clones, exon θ2 was spliced to exons E ⫹ F and G;
in one clone, exon θ2 was followed by exon G which disrupts the ORF.
As in rodents, the primate exon θ1 also adds a start codon and an
ORF of 26 amino acids, while exon θ2 provides only an in-frame
start codon to the downstream sequences. There appear to be speciesspecific splicing differences; whereas rat and mouse exons θ2 are
preferentially spliced to exon C (encoding τ1) and give rise to the
CREM-τ isoforms including both transactivation domains, human
exon θ2 is predominantly spliced to exon E to produce the τ2 activator
isoform or repressors. The presence of exon C in human CREM-θ1
or CREM-θ2 transcripts is rarely detectable as shown by Southern
blot analysis of RT–PCR products. The first 14 bp of exon C reported
with the cloning of the human CREM cDNA (Masquilier et al., 1993)
deviate from the human genome working draft sequence (accession
no. NT_0088583.4); this region has been suggested to be polymorphic
and result from the insertion of a partial Alu element (Daniel
et al., 2000).
The DBD II is the predominant DNA binding region included in
human testis CREM transcripts; a similar preferential splicing of
exon Ib over exon Ia has also been observed in the rat testis (Daniel
et al., 2000). In contrast, we have previously cloned CREM isoforms
from human endometrial stromal cells and found a prevalence of
DBD I (Gellersen et al., 1997). The significance of differential
inclusion of the alternative DBD is not known.
The fact that searches of mouse and human EST databases for
exons θ1 and θ2 retrieved exclusively testicular transcripts (Daniel
et al., 2000; and this report) suggested a high tissue-specificity of P3
and P4 promoter activity. This was confirmed by us using a panel of
19 different monkey tissues. CREM-θ1 expression was entirely
restricted to the testis; CREM-θ2 was abundantly expressed in the
testis and very faintly in prostate and seminal vesicle. Interestingly,
973
B.Gellersen et al.
Figure 8. Activation of promoters P1, P3 and P4 during postnatal mouse testicular development. Radioactive PCR was performed on cDNA transcribed from
equal amounts of total RNA isolated from mouse testes of different postnatal developmental stages, as indicated below each lane. The antisense primer was
complementary to exon H; the sense primers were anchored in exons B (top panel), θ1 (middle panel) or θ2 (bottom panel). PCR products labelled A
represent putative activator splice variants containing one or both transactivation domains, those labelled R represent repressor isoforms lacking a
transactivation domain or the kinase-inducible domain. The highly expressed activators in the top panel are represented by PCR products of 744 bp (exons B,
C, E ⫹ F, G, γ, H) and 597 bp (exons B, E ⫹ F, G, γ, H). The PCR products representing activators in the middle panel are 712 bp (exons θ1, C, E ⫹ F, G,
γ, H) and 565 bp (exons θ1, E ⫹ F, G, γ, H) in size respectively. The activator in the bottom panel is 662 bp (exons θ2, C, E ⫹ F, G, γ, H).
in addition to these male reproductive tissues, monkey uterus displayed
weak expression of CREM-θ2 mRNA. When we examined tissues
of the human utero-placental unit, however, we could not detect the
presence of exons θ1 or θ2 in CREM transcripts (data not shown).
Promoter P1 of the CREM gene is believed to be constitutively
active, and our screen of a panel of monkey tissues confirmed
ubiquitous expression of P1 products. However, we found a highly
testis-specific splicing pattern generating an activator isoform exclusively in this tissue. The P2 promoter giving rise to the repressor
ICER is highly responsive to cAMP signalling (Molina et al., 1993;
Walker and Habener, 1996). Daniel et al. also demonstrated very
strong PKA inducibility of rat P3 reporter constructs transfected into
human JEG-3 choriocarcinoma cells, while P4 was much more weakly
induced by PKA (Daniel et al., 2000). We constructed reporter
constructs of the human P3 and P4 promoters extending ~3 kb
upstream of the presumed transcriptional start sites. When transfected
into JEG-3 cells, primary cultures of human myometrial cells (data
not shown) or the myometrial cell line SKUT-1B (Figure 7), P3 and
P4 displayed very low basal activities. This lack of activity in a
heterologous cell system may reflect the stringent tissue-specific
control of P3 and P4, possibly achieved by the requirement for testisspecific transcription factors and/or co-factors. In contrast to the rat
promoters, human P3 and P4 were not induced by co-transfected
974
PKA catalytic subunit in spite of two putative CRE in each promoter.
This lack of response is particularly significant because SKUT-1B cells
very efficiently activated a CRE-driven control construct. Whether the
difference in PKA responsiveness between the rat and human promoters is due to different cellular backgrounds in the transfection
systems employed or represents a relevant species-specific difference
in promoter control remains open at present.
In the monkey and human testis we previously localized CREM
mRNA in late pachytene spermatocytes and early round spermatids
(Steger et al., 1999; Behr et al., 2000). However, the probe used for
in-situ hybridization did not allow differentiation between transcripts
generated from the alternative promoters P1, P3 and P4. It is
conceivable that the different CREM promoters are necessary for the
promotion of different stages of spermatogenesis. The distribution of
CREM clones obtained by 5⬘-RACE PCR and the RT–PCR analysis of
mouse postnatal development suggest that all three CREM promoters
exhibit substantial activity in the testis. We have ruled, using RT–
PCR, that exon B is spliced to exons θ1 or θ2 or that exon θ1 is
spliced to exon θ2 (data not shown). Daniel et al. have used semiquantitative RT–PCR to analyse stage-specific CREM transcript
abundance in the rat testis (Daniel et al., 2000). These authors found
distinct expression profiles for the exons B, θ1 and θ2. Although the
data showed slight differences in the abundance of exons B and θ2,
CREM isoforms in primate testis
the transcripts containing these exons seem to be consistently present
throughout the entire spermatogenic cycle in the rat. In contrast,
transcripts generated from P3 including exon θ1 were barely detectable
during stages IX–XII.
In order to follow the developmental activation of promoters P1,
P3 and P4, we analysed 18 different time points of postnatal testicular
development in the mouse by semi-quantitative RT–PCR. Transcripts
generated from all three promoters were already detectable in the
early postnatal testis. Whereas from P4 almost exclusively activator
transcripts were generated, activator as well as repressor transcripts
were produced from P1 and P3. The transcript abundance from all
promoters increased between postnatal days 16 and 20. However, our
data suggest that activation of promoters P1 and P4 during testicular
development precedes that of P3 by several days. Previously a
developmental switch from repressor to activator CREM transcript
expression from promoter P1 around day 14 of postnatal mouse
testicular development has been reported (Foulkes et al., 1992).
However, our data shown in Figure 8 do not completely confirm this
switch model. In the mouse testes from day 3 to 14, we detected
several repressor as well as activator isoforms transcribed from P1.
The signal intensity of the bands representing the different transcripts
was rather uniform, indicating similar levels of transcript abundance.
From day 16 onwards we observed an increase in the abundance of
the activator transcripts. However, at least one repressor was still
detectable in the adult mouse testis. Furthermore, activator transcripts
were generated from P3 and P4 already in the prepubertal testis. In
summary, our data suggest a gradual change of CREM expression
rather than an abrupt switch as reported elsewhere (Foulkes et al.,
1992).
The biological relevance of the alternative promoters and their
specific transcripts for mammalian spermatogenesis is an unresolved
issue as yet, since the inactivation of the CREM gene in mice ablated
the transcripts from all alternatively used promoters P1, P3 and P4
(Blendy et al., 1996; Nantel et al., 1996). The most conclusive
approach would be the selective inactivation of each single promoter
in the mouse to answer the question whether the concerted action of
all three promoters is necessary for normal spermatogenesis or
whether there is a redundancy of CREM promoter function. A related
question arising in the context of alternative promoter utilization is
that of putative functional relevance of the specific N-terminal regions
provided to the CREM protein isoforms by each individual promoter.
So far, no specific function has been assigned to the sequence encoded
by exon B which adds 40 amino acids N-terminal to the τ1 or the
KID. In this report, we demonstrated that the in-frame methionine
codons in exons θ1 and θ2 allow initiation of translation, with the
ATG in exon θ1 being more effectively used than that in θ2. Exon
θ1 adds 26 N-terminal residues while exon θ2 only provides an inframe start codon to the downstream exons. It may be speculated that
B- or θ1-specific N-termini provide additional epitopes for protein–
protein interactions. It is well established that activation of CREM
results from phosphorylation at Ser117 in the KID and interaction
with the co-activator CREB binding protein (CBP). Interestingly,
activation of CREM in germ cells can occur without phosphorylation,
and the testicular factor ACT (activator of CREM in testis) has been
shown to activate CREM by interaction with the KID in the absence
of phosphorylation at Ser117 (Fimia et al., 1999).
Our data indicate, however, that the presence of exons B, θ1 or
θ2 in CREM transcripts does not necessarily imply presence of the
corresponding amino acid sequences in the translated products. We
demonstrated here and in a previous report that alternative downstream
translation initiation gives rise to truncated repressor S-CREM isoforms (Gellersen et al., 1997). These are preferentially initiated at an
in-frame ATG in exon F of the KID, while a minority of translation
products, SS-CREM, is generated from a start codon in exon G (τ2).
As a consequence, presumed activator transcripts encoding the KID
and one or two Q-rich regions can give rise to a substantial proportion
of repressor peptides irrespective of the promoter-specific N-terminal
region. When we expressed CREM-θ1-τ2-β and CREM-θ2-τ2-β
transcripts in the SKUT-1B cell line, they failed to enhance PKAmediated activation of a CRE-driven promoter, in contrast with the
CREM-τ2-α transcript. This is most likely due to co-translation of
truncated CREM isoforms in the transfected cells as also observed
in in-vitro-translation experiments and confirmed by Western blot
analysis. An important issue to resolve is a putative tissue-specific
regulation of translational initiation, which may potentially lead to
predominant generation of full length activator isoforms in the testis.
However, only the generation of exon-specific antibodies, particularly
to B, θ1 and E, would allow unambiguous assignment of testicular
CREM proteins detected by Western blotting or immunohistochemistry and permit conclusions as to the biological role of individual
isoforms.
Acknowledgements
We thank Beate Hartung and Tanja Schneider-Merck for excellent technical
assistance, and Prof. Dr F.Leidenberger and Prof. Dr E.Nieschlag for continuous
support. We are grateful to Drs R.Maurer and G.E.DiMattia for expression
vectors. This work was supported by the Deutsche Forschungsgemeinschaft
(grant Ni-130/15-2).
References
Behr, R. and Weinbauer, G.F. (1999) Germ cell-specific cyclic adenosine
3⬘,5⬘-monophosphate response element modulator expression in rodent and
primate testis is maintained despite gonadotropin deficiency. Endocrinology,
140, 2746–2754.
Behr, R. and Weinbauer, G.F. (2000) CREM activator and repressor isoforms
in human testis: sequence variations and inaccurate splicing during impaired
spermatogenesis. Mol. Hum. Reprod., 6, 967–972.
Behr, R. and Weinbauer, G.F. (2001) cAMP response element modulator
(CREM): an essential factor for spermatogenesis in primates? Int. J. Androl.,
24, 126–135.
Behr, R., Hunt, N., Ivell, R., Wessels, J. and Weinbauer, G.F. (2000)
Cloning and expression analysis of testis-specific cyclic 3⬘, 5⬘-adenosine
monophosphate-responsive element modulator activators in the nonhuman
primate (Macaca fascicularis): comparison with other primate and rodent
species. Biol. Reprod., 62, 1344–1351.
Blendy, J.A., Kaestner, K.H., Weinbauer, G.F., Nieschlag, E. and Schütz, G.
(1996) Severe impairment of spermatogenesis in mice lacking the CREM
gene. Nature, 380, 162–165.
Bodor, J., Spetz, A.L., Strominger, J.L. and Habener, J.F. (1996) cAMP
inducibility of transcriptional repressor ICER in developing and mature
human T lymphocytes. Proc. Natl. Acad. Sci. USA, 93, 3536–3541.
Daniel, P.B., Rohrbach, L. and Habener, J.F. (2000) Novel cyclic adenosine
3⬘,5⬘-monophosphate (cAMP) response element modulator θ isoforms
expressed by two newly identified cAMP-responsive promoters active in
the testis. Endocrinology, 141, 3923–3930.
de Groot, R.P. and Sassone-Corsi, P. (1993) Hormonal control of gene
expression: multiplicity and versatility of cyclic adenosine 3⬘,5⬘monophosphate-responsive nuclear regulators. Mol. Endocrinol., 7, 145–
153.
Delmas, V., van der Hoorn, F., Mellstrom, B., Jegou, B. and Sassone-Corsi,
P. (1993) Induction of CREM activator proteins in spermatids: downstream targets and implications for haploid germ cell differentiation. Mol.
Endocrinol., 7, 1502–1514.
Fimia, G.M., De Cesare, D. and Sassone-Corsi, P. (1999) CBP-independent
activation of CREM and CREB by the LIM-only protein ACT. Nature,
398, 165–169.
Foulkes, N.S., Mellström, B., Benusiglio, E. and Sassone-Corsi, P. (1992)
Developmental switch of CREM function during spermatogenesis: from
antagonist to activator. Nature, 355, 80–84.
Fujimoto, T., Fujisawa, J. and Yoshida, M. (1994) Novel isoforms of human
cyclic AMP-responsive element modulator (hCREM) mRNA. J. Biochem.,
115, 298–303.
975
B.Gellersen et al.
Gellersen, B., Kempf, R. and Telgmann, R. (1997) Human endometrial stromal
cells express novel isoforms of the transcriptional modulator CREM and
up-regulate ICER in the course of decidualization. Mol. Endocrinol., 11,
97–113.
Lamas, M., Monaco, L., Zazopoulos, E., Lalli, E., Tamai, K., Penna, L.,
Mazzucchelli, C., Nantel, F., Foulkes, N.S. and Sassone-Corsi, P. (1996)
CREM: a master-switch in the transcriptional response to cAMP. Phil.
Trans. R. Soc. Lond. B, 351, 561–567.
Laoide, B.M., Foulkes, N.S., Schlotter, F. and Sassone-Corsi, P. (1993) The
functional versatility of CREM is determined by its modular structure.
EMBO J., 12, 1179–1191.
Masquilier, D., Foulkes, N.S., Mattei, M.-G. and Sassone-Corsi, P. (1993)
Human CREM gene: evolutionary conservation, chromosomal localization,
and inducibility of the transcript. Cell Growth Differ., 4, 931–937.
Maurer, R.A. (1989) Both isoforms of the cAMP-dependent protein kinase
catalytic subunit can activate transcription of the prolactin gene. J. Biol.
Chem., 264, 6870–6873.
Molina, C.A., Foulkes, N.S., Lalli, E. and Sassone-Corsi, P. (1993) Inducibility
and negative autoregulation of CREM: an alternative promoter directs the
expression of ICER, an early response repressor. Cell, 75, 875–886.
Müller, F.U., Boknı́k, P., Knapp, J., Neumann, J., Vahlensieck, U., Oetjen, E.,
Scheld, H.H. and Schmitz, W. (1998) Identification and expression of a
novel isoform of cAMP response element modulator in the human heart.
FASEB J., 12, 1191–1199.
Nantel, F., Monaco, L., Foulkes, N.S., Masquilier, D., LeMeur, M., Henriksén,
K., Dierich, A., Parvinen, M. and Sassone-Corsi, P. (1996) Spermiogenesis
deficiency and germ-cell apoptosis in CREM-mutant mice. Nature, 380,
159–162.
976
Russell, L.D., Ettlin, R.A., Sinha-Hikim, A.P. and Clegg, E.D. (1990)
Histological and Histopathological Evaluation of the Testis. Cache River
Press, Clearwater, CRP, Vienna, IL, USA.
Sanborn, B.M. (2000) Increasing the options | new 3⬘,5⬘ cyclic adenosine
monophosphate (cAMP)-responsive promoters and new exons in the cAMP
response element modulator gene. Endocrinology, 141, 3921–3922.
Steger, K., Klonisch, T., Gavenis, K., Behr, R., Schaller, V., Drabent, B.,
Doenecke, D., Nieschlag, E., Bergmann, M. and Weinbauer, G.F. (1999)
Round spermatids show normal testis-specific H1t but reduced cAMPresponsive element modulator and transition protein 1 expression in men
with round-spermatid maturation arrest. J. Androl., 20, 747–754.
Walker, W.H. and Habener, J.F. (1996) Role of transcription factors CREB
and CREM in cAMP-regulated transcription during spermatogenesis. Trends
Endocrinol. Metab., 7, 133–138.
Walker, W.H., Sanborn, B.M. and Habener, J.F. (1994) An isoform of
transcription factor CREM expressed during spermatogenesis lacks the
phosphorylation domain and represses cAMP-induced transcription. Proc.
Natl. Acad. Sci. USA, 91, 12423–12427.
Weinbauer, G.F., Behr, R., Bergmann, M. and Nieschlag, E. (1998) Testicular
cAMP responsive element modulator (CREM) protein is expressed in round
spermatids but is absent or reduced in men with round spermatid maturation
arrest. Mol. Hum. Reprod., 4, 9–15.
Wilson, P.A. and Melton, D.A. (1994) Mesodermal patterning by an inducer
gradient depends on secondary cell–cell communication. Curr. Biol., 4,
676–686.
Submitted May 10, 2002; accepted August 12, 2002