Download Slayt 1

Week III
Lecturer: Faruk Berat AKCESME (MSc)
HUM 101
Spring semester 2013-2014
 Origin
of species?
 Origin
of Human?
TIME LINE
for the last 3.6 billion years, simple cells (prokaryotes);
for the last 3.4 billion years, cyanobacteria performing photosynthesis;
for the last 2 billion years, complex cells (eukaryotes);
for the last 1 billion years, multicellular life;
for the last 600 million years, simple animals;
for the last 550 million years, bilaterians, animals with a front and a back;
for the last 500 million years, fish and proto-amphibians;
for the last 475 million years, land plants;
for the last 400 million years, insects and seeds;
for the last 360 million years, amphibians;
for the last 300 million years, reptiles;
for the last 200 million years, mammals;
for the last 150 million years, birds;
for the last 130 million years, flowers;
for the last 60 million years, the primates,
for the last 20 million years, the family Hominidae (great apes);
for the last 2.5 million years, the genus Homo (human predecessors);
for the last 200,000 years, anatomically modern humans.


ASSUMPTIONS!
All living things share a common
ancestor.

We can draw a Tree of Life to
show how every species is
related.

Evolution is the process by which
one species gives rise to another
and the Tree of Life grows
•
The theory of Evolution deals with how Evolution
happens. Our understanding of this process is always
changing.

Science?

Ideology?

Belief?

Source?

Fact?
 Part
1: How was evolution discovered?
Discussion: Should Creationism and Evolution
be given “equal time” in science lessons?
 Part
2: How does evolution work?
 Part
3: What is the evidence for evolution?
 Fixed
Species!
 Evolving
species!
• Around 1800, scientists began to
wonder whether species could
change or transmute.
• Lamarck thought that if an animal
acquired a characteristic during its
lifetime, it could pass it onto its
offspring.
• Hence giraffes got their long necks
through generations of straining to
reach high branches.
Jean Baptiste de Lamarck
William Smith, his geology map & some of his fossil specimens
At about the same time, geologists like William Smith were mapping the
rocks and fossils of Britain. He and others showed that different species
existed in the past compared with today.
• From 1831-1836, a
young naturalist called
Charles Darwin toured
the world in HMS
Beagle.
• He was dazzled by the
amazing diversity of
life and started to
wonder how it might
have originated
Voyage of the Beagle
Natural Selection
explains adaption
• In his Origin of Species,
published in 1859, Darwin
proposed how one species
might give rise to another.
• Where food was limited,
competition meant that only
the fittest would survive.
• This would lead to the natural selection
of the best adapted individuals and
eventually the evolution of a new species.
Darwin in 1860
Mendel and his peas
• From 1856-63, a monk called Gregor
Mendel cultivated 29,000 pea plants
to investigate how evolution worked
i.e., how characteristics were passed
down the generations.
• He figured out the basic principles of
genetics. He showed that offspring
received characteristics from both
parents, but only the dominant
characteristic trait was expressed.
Mendel’s work only came to light in
1900, long after his death
• The genetic make-up of
an organism is known as
its genotype.
• An organism’s genotype
and the environment in
which it lives determines
its total characteristic traits
i.e. its phenotype.
Genotype
Phenotype
• The double-helix
structure of DNA
was discovered
in 1953.
• This showed how
genetic information
is transferred from
Watson and Crick and their
model of DNA
DNA
replication
one cell to another
almost without error.
Types of mutation
• However, occasional
mutations or copying errors
can and do occur when
DNA is replicated.
• Mutations may be caused
by radiation, viruses, or
carcinogens.
Mutant fruitfly
• Mutations are rare and often have
damaging effects. Consequently organisms
have special enzymes whose job it is to
repair faulty DNA.
• Nevertheless, some
mutations will persist and
increase genetic variation
within a population.
• Variants of a particular
gene are known as alleles.
For example, the one of
the genes for hair colour
comprises brown/blonde
alleles.
?
Selection of dark gene
• Mutant alleles spread through a
population by sexual reproduction.
• If an allele exerts a harmful effect,
it will reduce the ability of the
individual to reproduce and the
allele will probably be removed
from the population.
• In contrast, mutants with favorable
effects are preferentially passed on
Any mutation with favorable effects ?
 Discussion
based on the current
information of molecular biology
 Lets
look what evolutionist present as a
evidance!
• Does basic similarity of all living things suggests
that they evolved from a single common ancestor?
• As we have already seen, all living things pass
on information from generation to generation
using the DNA molecule.
• All living things also use a molecule
called ATP to carry
energy around the
organism.
DNA for
Information
Transfer
ATP for
Energy
Transfer
HUMAN
CHIMPANZEE
GORILLA
CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA
CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCATGACTGTTGAACGA
CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA
Genetic code of chimps and gorillas is almost identical to humans
• If evolution is true then we might also expect that closely
related organisms will be more similar to one another than more
distantly related organisms.
• Comparison of the human genetic code with that of other
organisms show that chimpanzees are nearly genetically identical
(differ by less than 1.2%) whereas the mouse differs by ≈15%.
What about chickens ?
Genetically identical according to what method? What about
the method validity?
• Similar comparisons can be made
based on anatomical evidence.
• The skeleton of humans and
gorillas are very similar suggesting
they shared a recent common
ancestor, but very different from the
more distantly related
woodlouse…
yet all have a common
shared characteristic:
bilateral symmetry
Human and Gorilla
Woodlouse
The pentadactyl limb
is ancestral to all
vertebrates…
but modified for different uses
© World Health Org.
en.wikipedia.org/wiki/Image:Eopraptor_sketch5.png
© NASA
origins
bacteria
complex cells
dinosaurs
humans
Some scientist thinks “The fossil record shows a sequence from simple bacteria to
more complicated organisms through time “
They consider them as provides the most compelling evidence for evolution.
• Many fossils show a clear
transition from one species,
or group, to another.
• Archaeopteryx was found
in Germany in 1861. It
share many characteristics
with both dinosaurs and
birds.
• It provides good evidence
that birds arose from
dinosaur ancestors
Archaeopteryx
Marsupials
• Geographic spread of
organisms also tells of
their past evolution.
• Marsupials occur in
two populations today
in the Americas and
Australia.
• This shows the group
evolved before the
continents drifted apart
From geography to evolution??
or
From evolution to geography??

PRO-THEORY OF EVOLUTION / ANTI-CREATIONISM

> [2] Falk, Dean. Braindance, NY: Henry Holt and Co., 1992.

[5] Growlett, John. Ascent to Civilization, NY: Alfred A. Knopf, 1984.

[8] Howell, F. Clark. Early Man, NY: Time Life Books, 1973.

[9] Johanson, David, and Maitland, Edy. Lucy, NY: Simon and Schuster, 1981.

[10] Johanson, David, and Shreeve, James. Lucy's Child, NY: William Morrow and Co., 1989.

[12] Leakey, Richard, and Lewin, Roger. Origins, NY: E.P. Dutten, 1977.

> [13] Leakey, Richard, and Lewin, Roger. Origins Reconsidered, NY: Doubleday, 1992.

> [14] Lewin, Roger. Bones of Contention, NY: Simon and Schuster, 1987.

> [15] Lewin, Roger. In the Age of Mankind, Washington, D.C.: Smithsonian Books, 1988.

[20] Pfieffer, John. The Emergence of Man, NY: Harper and Row, 1969.

[23] Wendt, Herbert. From Ape to Man, NY: The Bubbs Merril Co., 1972.

ANTI-THEORY OF EVOLUTION / PRO-CREATIONISM

[1] Bliss, Richard. Origins: Creation or Evolution? El Cajon, CA: Master Books, 1988.

[3] Gish, Duane T. The Amazing Story of Creation from Science and the Bible El Cajon, CA: Institute for Creation Research, 1990.

[4] Graham, Keith, et al. Biology Pensacola, FL: A Beka Book Publications, 1986.

[7] Ham, ken, et. al. The Answers book, El Cajon, CA: Master Books, 1992.

> [11] Johnson, Phillip. Darwin on Trial, Washington, D.C.: Regnery Gateway, 1991.

> [16] McDowell, Josh and Stewart, Don. Reasons Skeptics Should Consider Christianity, San Bernardino, CA: Here's Life, 1981.

[17] Moreland, J.P. Scaling the Secular City, Grand Rapids: Baker Book House, 1987.

> [18] Morris, Henry M. Evolution and the Modern Christian, Phillipsburg, NJ: Presbyterian and Reformed Publishing Co., 1988.

[19] Morris, Henry M. The Twilight of Evolution, Grand Rapids: Baker Book House, 1967.

> [22] Ranganathan, B.G. Origins?, Carlisle, PA: The Banner of Truth Trust, 1988.

[24] Whitcomb, John. The Early Earth, Grand Rapids: Baker Book House, 1986.

NEUTRAL REFERENCE WORKS

[6] Grzimek, Bernhard, ed. Grzimek's Animal Life Encyclopedia, Vol. 10, NY: Van Nostrand Reinhold Co., 1984.

[21] Pinchot, Roy, ed. The Human Body, "The Skeleton", NY: Torster Books, 1985.

The number in the [ ]'s after each quote in the paper corresponds to the number in the [ ]'s above from which the quote was taken. Quotes with no [ ]'s are lost
references but should be considered reliable.

">" indicates most recommended for further study. Pro-evolution books are recommended for how well they reveal the actual state of their evidence.