Download Hydrogen peroxide modulates the dynamic microtubule

Plant, Cell and Environment (2011) 34, 1586–1598
doi: 10.1111/j.1365-3040.2011.02356.x
Hydrogen peroxide modulates the dynamic microtubule
cytoskeleton during the defence responses to Verticillium
dahliae toxins in Arabidopsis
pce_2356
1586..1598
LIN-LIN YAO†, QUN ZHOU†, BAO-LEI PEI & YING-ZHANG LI
State Key Laboratory of Plant Physiology and Biochemistry, College of Biological Sciences, China Agricultural University,
Beijing 100193, China
ABSTRACT
The molecular mechanisms of signal transduction of plants
in response to infection by Verticillium dahliae (VD) are
not well understood. We previously showed that NO may
act as an upstream signalling molecule to trigger the depolymerization of cortical microtubules in Arabidopsis. In the
present study, we used the wild-type, and atrbohD and
atrbohF mutants of Arabidopsis to explore the mechanisms of action of H2O2 signals and the dynamic microtubule cytoskeleton in defence responses. We demonstrated
that H2O2 may also act as an upstream signalling molecule
to regulate cortical microtubule depolymerization. The
depolymerization of the cortical microtubules played a
functional role in the signalling pathway to mediate the
expression of defence genes. The results indicate that H2O2
modulates the dynamic microtubule cytoskeleton to trigger
the expression of defence genes against V. dahliae toxins
(VD-toxins) in Arabidopsis.
Key-words: cortical microtubule depolymerization; defence
gene expression; H2O2.
INTRODUCTION
One of the earliest events in the plant defence response
against pathogen attack is the production of reactive
oxygen species (ROS), including hydrogen peroxide (H2O2)
(Lamb & Dixon 1997). The spatial and temporal fluctuations of ROS levels are interpreted as a signal required
for plants to respond to pathogens. ROS plays a critical
role in induced plant resistance by activating or inducing mitogen-activated protein kinases (MAPKs), ROSresponsive transcription factors, antioxidant enzymes and
pathogenesis-related (PR) proteins (Gechev et al. 2006).
The rapid generation of H2O2 has been documented in
many plant–pathogen interactions (Grant et al. 2000). H2O2
signals have been shown to induce large transcriptional
changes and cellular reprogramming that can either protect
the plant cell or induce programmed cell death (Gadjev
Correspondence: Y-Z. Li. E-mail: [email protected]
†
These authors contributed equally to this work.
1586
et al. 2006). H2O2 appears to act as an intercellular or intracellular secondary messenger, resulting in gene expression
in plant defence; however, the effect of H2O2 on defence
response appears to be diverse. H2O2 generation has been
correlated with programmed cell death (Levine et al. 1994),
and H2O2 acted as a secondary signal in the activation of
plant programmed cell death (Overmyer, Brosche & Kangajarvi 2003; Gechev & Hille 2005). In contrast, pathogeninduced NADPH oxidase-derived ROS were demonstrated
to play a role in suppressing the spread of cell death in
Arabidopsis (Torres, Jones & Dangl 2005). Additionally,
in Nicotiana benthamiana, silencing NADPH oxidase
NbrbohB reduced the hypersensitive reaction (HR) and
decreased resistance to Phytophthora infestans, but not to
Colletotrichum orbiculare (Yoshioka et al. 2003; Asai, Ohta
& Yoshioka 2008). These findings indicate that the effect of
H2O2 on the defence response varies depending on the
plant–pathogen interaction.
Plasma membrane NADPH oxidase, as well as cell wallassociated peroxidase, is the main ROS-producing enzyme
(Pogány et al. 2009; Miller et al. 2010). AtbohD and AtbohF
encode two major NADPH oxidases expressed in guard
and mesophyll cells in Arabidopsis. They have been shown
to be responsible for apoplastic ROS generation (Torres &
Dangl 2005).
The plant cytoskeleton is essential for various types of
antimicrobial defence (Schmidt & Panstruga 2007), with
microfilaments and microtubules necessary for plants to
block fungal penetration (Genre & Bonfante 2002; Kobayashi & Hakuno 2003). The interaction between plant cells
and pathogens triggers a range of highly dynamic plant
cellular responses including reorganization of the cytoskeleton. It has been shown that aggregation of subcellular
components at the infection site depends on the plant
cytoskeleton (Lipka & Panstruga 2005; Hardham, Takemoto & White 2008). Dynamic actin cytoskeleton rearrangements are regulated by various biotic and abiotic
responses (Staiger & Blanchoin 2006), and the actin cytoskeleton is intimately associated with the activation of
defence responses in plants (Day & Graham 2007;
Hardham, Jones & Takemoto 2007). However, reported
changes in cytoskeletal microtubules in response to infection are more varied than those observed for actin, and
© 2011 Blackwell Publishing Ltd
H2O2 modulates MT dynamics in the defence responses 1587
their role remains unclear (Takemoto & Hardham 2004). In
tobacco, cell death induced by cryptogein strictly coincides
with a rapid disintegration of the microtubules (Binet et al.
2001). Recently, it was demonstrated that the reduced
microtubule dynamics renders plants less susceptible to
tobacco mosaic virus (TMV) (Ouko et al. 2010). These
results indicate that microtubules may play an important
part in the mobilization of the plant defence response.
However, details of the contribution of microtubules are
not clear, especially in terms of the molecules that signal
and bring about the dramatic reorganizations that are often
observed.
Verticillium dahliae is a soil-borne pathogen that causes
Verticillium wilt in a variety of important plant species
worldwide (Bhat & Subbarao 1999). Although the physiology of plant defence against Verticillium infection is well
established, comprising the production of the PR proteins,
phytoalexins and phenolic compounds, and active expression of some disease response genes (McFadden et al. 2001;
Fradin & Thomma 2006), the regulatory signal and pathways
involved in plant defence responses to Verticillium remain
largely unknown. It has been reported that V. dahliae produces or releases toxic or elicitor-like substances (Fradin &
Thomma 2006), and this toxin complex is required for pathogenicity (Nachmias, Buchner & Burstein 1985; Jiang, Fan &
Wu 2005; Liu 2005), and it has been demonstrated that V.
dahliae toxins (VD-toxins) act as a virulence factor to induce
cytoskeleton alteration and defence gene expression in Arabidopsis (Yuan et al. 2006; Jia,Yuan & Li 2007; Hou, Shi & Li
2008). The Arabidopsis–VD-toxins interaction is an excellent model plant–pathogen system to study defence signalling (Shi & Li 2008). Recently, we used this system to
demonstrate that NO production and cortical microtubule
dynamics appeared to be parts of an important signalling
system, and regulated the defence mechanisms to VD-toxins
in Arabidopsis (Shi et al. 2009).
In the present study, we used wild-type, and atrbohD and
atrbohF mutants of Arabidopsis to explore the mechanisms
of action of H2O2 signals and the dynamic microtubule
cytoskeleton in the defence responses.
MATERIALS AND METHODS
Plant material and tissue culture conditions
The seeds of wild-type Arabidopsis (Col-0), and atrbohD
and atrbohF mutants (background Col-0) were used in the
experiment. The atrbohD and atrbohF mutant seeds were
obtained from Dr M.A. Torres (University of North Carolina at Chapel Hill). The mutants are knock-out lines containing a T-DNA insertion in the AtrbohD and AtrbohF
gene, respectively (Torres, Dangl & Jones 2002). The seeds
were sterilized and incubated in Petri dishes containing MS
medium (Murashige & Skoog 1962), 3% sucrose (w/v) and
0.7% agar (w/v) at 4 °C in darkness for 4 d. Then, the plates
were placed at 21 ⫾ 2 °C under 14 h light (100 mmol m-2 s-1)
and 10 h darkness, and 70% relative humidity in a growth
cabinet for 7 d.
Preparation of crude VD-toxins from V. dahliae
A highly infectious and non-defoliating strain of V. dahliae
Kleb (V229) was used for extraction of VD-toxins. The
Verticillium culture filtrate was purified as described previously (Jia et al. 2007; Shi & Li 2008).
H2O2 assays
For the 2′,7′-dichlorofluorescin diacetate (H2DCF-DA)
staining assay, the 7-day-old seedlings were incubated in
10 mm MES–KCl buffer (pH 6.0) supplemented with
VD-toxins (150 mg mL-1) and 20 mm H2DCF-DA for 20 min
at room temperature. They were then washed three times
with 10 mm MES–KCl buffer (pH 6.0) to remove the excess
H2DCF-DA. The seedlings incubated in heat-inactivated
VD-toxins were used as controls. Fluorescence was
detected with a confocal laser scanning microscope
(CLSM) (Zeiss LSM 510, Oberkochen, Germany). The
CLSM working conditions were as follows: power 70%,
excitation at 488 nm and emission at 505–530 nm. This
experiment was independently repeated at least three
times.
For quantitative measurement of H2O2, the 7-day-old
seedlings were treated as described earlier. H2O2 content
was determined by the chromogenic peroxidase-coupled
assay (Veljovic-Jovanovic, Novtor & Foyer 2002). The
leaves (0.1 g) were ground to a fine powder in liquid nitrogen and the powder extracted in 2 mL 1 m HCIO4. Where
indicated, extraction was performed in the presence of
insoluble polyvinyl pyrrolidine (PVP) (5%). Homogenates
were centrifuged at 12 000 g for 10 min and the supernatant was neutralized with 5 m K2CO3 to pH 5.6 in the presence of 100 mL 0.3 m phosphate buffer (pH 5.6). The
homogenate was centrifuged at 12 000 g for 1 min to
remove KCIO4. Where indicated, the sample was incubated prior to assay for 10 min with 1 U ascorbate oxidase
(Sigma, St Louis, MO, USA) to oxidize ascorbate. The
reaction mixture consisted of 0.1 m phosphate buffer (pH
6.5), 3.3 mm 3-dimethylaminobenzoic acid (DMAB),
0.07 mm 3-methyl-2-benzothiazolinonehydrazone (MBTH)
and 0.1 U mL-1 peroxidase (Sigma). The reaction was initiated by the addition of an aliquot (200 mL) of the
sample. The absorbance change at 590 nm was monitored
at 25 °C. Three independent experiments were performed,
each with three replicates, and similar results were
obtained.
To determine the extent to which H2O2 production
induced by VD-toxins is NADPH oxidase dependent, the
seedlings were pretreated with 50 mm diphenylene iodonium (DPI, a potent inhibitor of NADPH oxidase; Sigma)
or 15 mm dimethylthiourea (DMTU, a H2O2 scavenger;
Sigma) for 2 h, respectively. The seedlings were then transferred into an Eppendorf tube containing VD-toxins plus
DPI, or VD-toxins plus DMTU to co-treat for 60 min. The
leaves were observed using CLSM. Experiments were
repeated at least three times, with at least 10 seedlings
observed in each experiment.
© 2011 Blackwell Publishing Ltd, Plant, Cell and Environment, 34, 1586–1598
1588 L-L. Yao et al.
Visualization of cortical microtubules
The cortical microtubules in leaf pavement cells in Arabidopsis seedlings expressing GFP–tubulin were observed
using the CLSM as described previously (Shi et al. 2009).
The 7-day-old seedlings were treated with VD-toxins
(150 mg mL-1) at room temperature. The organization and
dynamics of the cortical microtubules were observed at
various times after the treatment. Images of GFP fluorescence are projections of optical sections taken at 1.5 mm
intervals from the outer epidermal wall, through to immediately above the cortical cytoplasm adjacent to the inner
periclinal wall of the epidermal cell. Images were captured
using Zeiss LSM 510 software, converted to TIFF for
export and processed in Adobe Photoshop 5.0.
To investigate the interaction between the depolymerization of cortical microtubules and H2O2 production, the
leaves were treated with VD-toxins (150 mg mL-1) alone,
VD-toxins supplemented with 50 mm DPI, VD-toxins
supplemented with 15 mm DMTU, or 1, 5 or 10 mm exogenous H2O2, respectively. The leaves were observed using
CLSM.The observations reported arise from three separate
experiments and images presented are representative of
>30 similar images collected for each phenomenon being
illustrated.
Arabidopsis seedlings expressing GFP–tubulin were
crossed with atrbohD and atrbohF mutants, and the
homozygous lines produced were used for the observation
of the dynamic of cortical microtubules in atrbohD and
atrbohF mutants.
Extraction of total RNA and real-time PCR
Total RNA was extracted from the control and samples
using TRIzol reagent (Bio Basic Inc, Markham, ON,
Canada) following the manufacturer’s instructions. The
concentration of RNA was accurately quantified by spectrophotometric measurements, and 2 mL of total RNA was
separated on 0.8% agarose gel to check the concentration
and to monitor integrity. For real-time PCR analysis, firststrand cDNA was synthesized from 2 mL of total RNA
using M-MLV reverse transcriptase (Promega, Madison,
WI, USA). Quantitative PCR was performed using SYBR
Premix Ex Taq Kit (Takara, Dalian, China) on an ABI 7500
Sequence Detector (Applied Biosystems, Foster City,
CA, USA) according to the manufacturer’s protocol.
Gene-specific primer pairs were as follows: PR1 forward
(AGCTCTTGTAGGTGCTCTTGTTCTT) and reverse
(GTGCCTGGTTGTGAACCCTTA); PR2 forward (ATC
TCCCTTGCTCGTGAATC) and reverse (TCGAGATTT
GCGTCGAATAG); PR5 forward (CTCTTCCTCGTGT
TCATCACA) and reverse (TCAATTCAAATCCTCC
ATCG); and actin2 forward (TACAGTGTCTGGATCG
GTGGTT) and reverse (CGGCCTTGGAGATCCACAT).
Samples of 2 mL of cDNA were amplified in 25 mL reaction
volume containing SYBR premix Ex Taq, PCR forward
primer, PCR reverse primer and ROX reference dye,
according to the manufacturer’s instruction (Takara). The
PCR was carried out at 95 °C for 30 s, followed by 40 cycles
of 95 °C for 5 s (denaturation), and annealing at 60 °C for
34 s. Data analysis, such as the determination of the threshold cycle that represents the starting point of the exponential phase of PCR, and graphic presentation were carried
out using the Sequence Detection Software v.1.07 (Applied
Biosystems). Quantification of the transcript level of cDNA
fragments was normalized to the expression of the actin2
gene in Arabidopsis at 48 h with VD-toxins (150 mg mL-1)
treatment. Three independent experiments were performed, each with three replicates.
RESULTS
VD-toxins induce H2O2 production
in Arabidopsis
To determine whether H2O2 was involved in VD-toxininduced stress responses, the H2O2 in Arabidopsis leaves
was labelled using a fluorescent probe of H2DCF-DA. The
fluorescent intensity in wild-type Arabidopsis leaves significantly increased after treatment with VD-toxins, and the
H2O2 level displayed a time-dependent increase and
reached a steady level after 60 min (Fig. 1a,b). We also measured the H2O2 content in the leaves by the chromogenic
peroxidase-coupled assay and obtained similar results
(Fig. 1c).
We then investigated the source of H2O2 production after
treatment with VD-toxins. To determine whether H2O2 production induced by VD-toxins was dependent on NADPH
oxidases, we measured H2O2 changes in wild type and
NADPH oxidase mutants of atrbohD and atrbohF after
treatment with VD-toxins. VD-toxins induced a dramatic
increase in H2O2 level as early as 0.5 h and stabilized at 1 h,
and remained at this level for >5 h in wild type (Fig. 2),
whereas H2O2 accumulated to a much smaller extent in
atrbohD and atrbohF mutants, and was only about onethird of that in the wild type. This suggests that AtrbohD
and AtrbohF were necessary for the VD-toxin-induced
H2O2 production.
In addition, we also treated wild-type plants with DPI, a
potent inhibitor of NADPH oxidase, and DMTU, a H2O2
scavenger. VD-toxin-induced H2O2 production was sensitive to DPI and DMTU (Fig. 3); DPI almost completely
blocked VD-toxin-induced H2O2 production, and DMTU
had a similar effect. These results indicate that VD-toxininduced H2O2 production in Arabidopsis was NADPH
oxidase dependent.
H2O2 modulates VD-toxin induction of the
dynamic microtubule cytoskeleton
Previous experiments indicated that VD-toxins can induce
the depolymerization of cortical microtubules in Arabidopsis (Yuan et al. 2006; Shi et al. 2009). To determine
whether H2O2 was involved in VD-toxin induction of
the dynamic microtubule cytoskeleton in Arabidopsis
expressing GFP–tubulin, the wild type, and atrbohD and
© 2011 Blackwell Publishing Ltd, Plant, Cell and Environment, 34, 1586–1598
H2O2 modulates MT dynamics in the defence responses 1589
(a)
a
b
c
d
e
f
g
h
i
j
k
l
m
n
o
p
q
r
s
t
(b)
(c)
Figure 1. H2O2 production induced by Verticillium dahliae toxins (VD-toxins) in the leaves of wild-type (Col-0) Arabidopsis. (a) H2O2
was detected by fluorescence resulting from 2′,7′-dichlorofluorescin diacetate (H2DCF-DA), as described in Materials and methods. Image
a was taken 2 min after treatment by VD-toxins, and images a to t were taken at 4 min intervals. (b) H2DCF-DA fluorescence intensities
in the leaves of wild-type Arabidopsis. Confocal data are displayed as estimated mean pixel intensities and associated 95% confidence
intervals. (c) Quantitative measurement of H2O2 content in the leaves by the chromogenic peroxidase-coupled assay.
atrbohF mutants were used to visualize microtubules in
living leaf cells. The microtubules were observed by fluorescence of GFP–tubulin using CLSM. The fluorescence
of the microtubules was caused by the fluorescence of
GFP–tubulin that was polymerized into the microtubules,
and disorganized GFP–tubulin formed faintly fluorescent
small nodes or filaments (Ueda, Matsuyama & Hashimoto
1999). When seedlings were treated with VD-toxins, the
© 2011 Blackwell Publishing Ltd, Plant, Cell and Environment, 34, 1586–1598
1590 L-L. Yao et al.
(a)
(b)
Figure 2. H2O2 production induced by Verticillium dahliae toxins (VD-toxins) in the leaves of wild type (Col-0), and atrbohD and
atrbohF mutants of Arabidopsis. (a) H2O2 was detected by fluorescence resulting from 2′,7′-dichlorofluorescin diacetate (H2DCF-DA).
(b) The H2DCF-DA fluorescence intensities in the leaves of Arabidopsis. Confocal data are displayed as estimated mean pixel intensities
and associated 95% confidence intervals. Error bars indicate standard deviations. Values of each group with the same letters were not
significantly different (P < 0.05) [one-way analysis of variance (anova) and Student–Newman–Keuls (SNK) test].
organization of cortical microtubules remained normal
and all three plant types appeared similar after 15 min
(Fig. 4). However, at 45 min, there was a partial disappearance of the cortical microtubules in the wild type, but
only slight disassembly of microtubules in atrbohD and
atrbohF mutants. At 75 min, there was a more dramatic
depolymerization of cortical microtubules in the wild type,
and a weaker depolymerization in some pavement cells of
atrbohD and atrbohF mutants. Thus, it was clear that loss
of AtrbohD and AtrbohF led to a slow and decreased
depolymerization of cortical microtubules in response to
VD-toxins.
© 2011 Blackwell Publishing Ltd, Plant, Cell and Environment, 34, 1586–1598
H2O2 modulates MT dynamics in the defence responses 1591
(a)
a
(b)
b
c
d
(c)
Figure 3. Effect of the inhibitor of NADPH oxidase [diphenylene iodonium (DPI)] and H2O2 scavenger [dimethylthiourea (DMTU)] on
Verticillium dahliae toxin (VD-toxin)-induced H2O2 production in the leaves of wild-type Arabidopsis. (a) H2O2 was detected by
fluorescence resulting from 2′,7′-dichlorofluorescin diacetate (H2DCF-DA). a, Control, leaves were treated with inactivated VD-toxins. b,
H2O2 production was induced in the leaves that were treated with VD-toxins (150 mg mL-1). c, VD-toxin-induced H2O2 production was
significantly affected when co-treated with DPI. d, VD-toxin-induced H2O2 production was significantly affected when co-treated with
DMTU. Pictures were taken 60 min post-treatment. Bars = 20 mm. (b) The H2DCF-DA fluorescence intensities in the leaves of wild-type
Arabidopsis. Confocal data are displayed as estimated mean pixel intensities and associated 95% confidence intervals. (c) Quantitative
measurement of H2O2 content in the leaves by the chromogenic peroxidase-coupled assay. Error bars indicate standard deviations. Values
of each group with the same letters were not significantly different (P < 0.05) [one-way analysis of variance (anova) and
Student–Newman–Keuls (SNK) test].
To investigate the interaction between the depolymerization of cortical microtubules and H2O2 production, the wildtype seedlings were co-treated with VD-toxins plus DPI or
DMTU. The microtubule cytoskeleton disassembly induced
by VD-toxins was inhibited in the presence of DPI or
DMTU (Fig. 5). To further examine the role of H2O2 in
microtubule cytoskeleton destabilization, we used different
concentrations of exogenous H2O2 to treat the wild-type
seedlings. The depolymerization of cortical microtubules
increased with increasing concentrations of exogenous
H2O2 (Fig. 6), confirming that H2O2 was involved in the
regulation of microtubule depolymerization. Thus, our
results indicate that H2O2 was required for VD-toxininduced microtubule depolymerization.
H2O2 and cortical microtubule alterations
correlate with the activation of defence
response to VD-toxins
ROS were proposed to orchestrate the establishment of
plant defences following successful pathogen recognition
(Torres, Jones & Dangl 2006). To test whether the defence
gene expression induced by VD-toxins was dependent on
H2O2 production, we treated wild type, and atrbohD and
atrbohF mutants of Arabidopsis seedlings with VD-toxins.
At 48 h after treatment, the leaves were collected and subjected to real-time RT-PCR analysis. VD-toxins induced an
up-regulated expression of PR1, PR2 and PR5 genes in wild
type (Fig. 7). In contrast to the wild type, PR1 expression
was strongly reduced in atrbohD and atrbohF mutants,
whereas PR2 and PR5 were partially reduced. These results
indicate that VD-toxin-inducible expressions of PR1, PR2
and PR5 were regulated by H2O2-dependent signals, while
expressions of PR2 and PR5 were also regulated by H2O2independent signals.
Previous experiments indicated that depolymerization
of cortical microtubules in Arabidopsis induced expression of the PR1 gene (Shi et al. 2009). To investigate
additional defence gene expressions as results of the
dynamics of the microtubule cytoskeleton, we analysed
the expression of PR1, PR2 and PR5 genes induced by
VD-toxins in wild-type Arabidopsis in the presence of
microtubule-targeting drugs (Fig. 8). Co-treatment of
VD-toxins with microtubule-targeting drugs significantly
affected the expression of PR genes. Expression of PR1,
PR2 and PR5 genes was strongly inhibited by treatment
with taxol, a drug that inhibits the depolymerization of
microtubules, whereas their expression was increased by
© 2011 Blackwell Publishing Ltd, Plant, Cell and Environment, 34, 1586–1598
1592 L-L. Yao et al.
(a)
(b)
Figure 4. (a) Sequential images of cortical microtubule alterations induced by Verticillium dahliae toxins (VD-toxins) (150 mg mL-1) in
the leaf pavement cells of the wild type (Col-0), and atrbohD and atrbohF mutants expressing GFP–tubulin of Arabidopsis. Bars = 20 mm.
(b) GFP–tubulin fluorescence intensities in leaves treated with VD-toxins in wild type, and atrbohD and atrbohF mutants. Confocal data
are displayed as estimated mean pixel intensities and associated 95% confidence intervals. Error bars indicate standard deviations. Values
of each group with the same letters were not significantly different (P < 0.05) [one-way analysis of variance (anova) and
Student–Newman–Keuls (SNK) test].
© 2011 Blackwell Publishing Ltd, Plant, Cell and Environment, 34, 1586–1598
H2O2 modulates MT dynamics in the defence responses 1593
(a)
a
(b)
CFP-fluorescence intensity
25
a
b
c
a
20
15
10
b
5
0
VD-toxins
VD-toxins + DPI
VD-toxins +
DMTU
Figure 5. (a) Effect of the inhibitor of NADPH oxidase [diphenylene iodonium (DPI)] and H2O2 scavenger [dimethylthiourea
(DMTU)] on microtubule cytoskeleton disruption induced by Verticillium dahliae toxins (VD-toxins) in the leaf pavement cells of
wild-type Arabidopsis. a, Microtubule cytoskeleton disruption was induced with VD-toxins (150 mg mL-1). b, VD-toxin-induced
microtubule cytoskeleton disruption was significantly decreased when co-treated with DPI. c, VD-toxin-induced microtubule cytoskeleton
disruption was significantly decreased when co-treated with DMTU. Pictures were taken 75 min post-treatment. Bars = 20 mm.
(b) GFP–tubulin fluorescence intensities in leaves treated with VD-toxins, VD-toxins plus DPI and VD-toxins plus DMTU in wild
type. Confocal data are displayed as estimated mean pixel intensities and associated 95% confidence intervals. Error bars indicate
standard deviations. Values of each group with the same letters were not significantly different (P < 0.05) [one-way analysis of variance
(anova) and Student–Newman–Keuls (SNK) test].
treatment with oryzalin, a drug that inhibits the polymerization of microtubules. These results indicate that the
dynamic microtubule cytoskeleton plays a functional role
in the signalling pathway to mediate the expression of
defence genes.
DISCUSSION
Previous studies have demonstrated that NO acts as
an upstream signalling molecule to trigger the depolymerization of cortical microtubules (Shi et al. 2009).
The present study provides evidence that H2O2 may
also act as an upstream signalling molecule to modulate the dynamic microtubule cytoskeleton during the
defence responses to VD-toxins in Arabidopsis. The
results suggest a relation linking the H2O2 signal with
dynamic microtubule cytoskeleton in plant defence
responses.
H2O2 plays an important role in regulating the
VD-toxin-induced defence gene expression
Rapid production of ROS has been implicated in diverse
physiological processes including resistance to biotic and
abiotic stress (Torres et al. 2006). ROS were proposed to
orchestrate the establishment of plant defences and HR
following successful pathogen recognition. However, the
requirement for ROS appears to be different for resistance
to different pathogens (Asai et al. 2008; Torres 2010). ROS
also play a critical role as signalling intermediates during
the defence responses to bacterial pathogens (Choi et al.
2007). In contrast, ROS produced by AtrbohD and AtrbohF
did not have dramatic effects on defence genes against
Alternaria brassicicola (Pogány et al. 2009), and the
AtrbohD-mediated H2O2 generation is not required for the
activation of defence responses against Botrytis cinerea
(Galletti et al. 2008). In the present study, H2O2 production
© 2011 Blackwell Publishing Ltd, Plant, Cell and Environment, 34, 1586–1598
1594 L-L. Yao et al.
(a)
a
b
c
d
(b)
Figure 6. Disruption of microtubule cytoskeleton induced with exogenous H2O2 in the leaf pavement cells of wild-type Arabidopsis. a,
Control, leaves were treated with inactivated Verticillium dahliae toxins (VD-toxins). b, Leaves were treated with 1 mm H2O2. c, Leaves
were treated with 5 mm H2O2. d, Leaves were treated with 10 mm H2O2. Pictures were taken 90 min post-treatment. Bars = 20 mm. (b)
GFP–tubulin fluorescence intensities in leaves treated with exogenous H2O2 in wild type. Confocal data are displayed as estimated mean
pixel intensities and associated 95% confidence intervals. Error bars indicate standard deviations. Values of each group with the same
letters were not significantly different (P < 0.05) [one-way analysis of variance (anova) and Student–Newman–Keuls (SNK) test].
was one early response to VD-toxins in Arabidopsis, and
H2O2 production was impaired by the inhibitor of NADPH
oxidase or H2O2 scavenger, or the atrbohD and atrbohF
mutations (Figs 1–3). These data suggest that NADPH oxidases appear to be important in H2O2 production induced
by VD-toxins in Arabidopsis.
Moreover, the expressions of PR were simultaneously
decreased in atrbohD and atrbohF mutants (Fig. 7). The
induction of the PR1 gene by VD-toxins was completely
blocked, and PR2 and PR5 genes were partially blocked by
atrbohD and atrbohF mutations. These results suggest that
the expressions of PR1, PR2 and PR5 were regulated by
H2O2-dependent signals, while the expressions of PR2 and
PR5 were also regulated by H2O2-independent signals. The
results of the present study provide convincing evidence
that H2O2 plays an important role in the regulation of
VD-toxin-induced defence gene expression in Arabidopsis.
It is possible that H2O2 is necessary, but not sufficient to
trigger the defence gene expression against VD-toxins in
Arabidopsis.
Microtubule depolymerization is mediated by
H2O2-dependent signalling
Plant interactions with pathogens are known to stimulate
cytoskeleton reorganization (Takemoto & Hardham
2004). The plant cytoskeleton readily remodels in response
to various intracellular and external stimuli. Cortical
microtubules are intimately associated with the plasma
membrane and are implicated as targets of signalling networks (Gilroy & Trewavas 2001;Wasteneys & Galway 2003).
It is therefore not surprising that certain signalling pathways
are interconnected and are used to regulate the dynamic
microtubule cytoskeleton simultaneously. However, specific
knowledge about upstream signalling pathways that regulate cortical microtubule dynamic is limited.
Microtubule destabilization occurs independently of the
production of ROS in tobacco cells in response to cryptogein (Binet et al. 2001). In contrast, it has been suggested
that the actin cytoskeleton is a central signalling component
that couples the accumulation of ROS to programmed cell
death in yeast (Farah & Amberg 2007; Leadsham &
Gourlay 2008). Recently, it was reported that NO acts as
an upstream signal and subsequently modulates cortical
microtubule dynamics in Arabidopsis (Shi et al. 2009) and
also the actin cytoskeleton dynamics in maize (Kasprowicz
et al. 2009). It has been demonstrated that NO cooperates
with ROS to activate HR in plants (Delledonne et al. 2001;
Polverari et al. 2003; Torres et al. 2006; Leitner et al. 2009;
Yoshioka et al. 2009). However, to date, very little is known
about the relationship between ROS and cytoskeleton
dynamics in plants. To the authors’ knowledge, there are no
reports linking H2O2 signalling with the dynamic microtubule cytoskeleton in plant defence responses.
© 2011 Blackwell Publishing Ltd, Plant, Cell and Environment, 34, 1586–1598
H2O2 modulates MT dynamics in the defence responses 1595
Figure 8. Relative expression levels of defence genes after
Figure 7. Relative expression levels of defence genes after
treatment with Verticillium dahliae toxins (VD-toxins) in wild
type, and atrbohD and atrbohF mutants. Total RNA was
extracted at 48 h with VD-toxin treatment for real-time PCR
analysis. Actin2 was used as internal control. Error bars indicate
standard deviations. Values of each group with the same letters
were not significantly different (P < 0.05) [one-way analysis of
variance (anova) and Student–Newman–Keuls (SNK) test].
treatment with Verticillium dahliae toxins (VD-toxins) and
oryzalin or taxol in wild-type Arabidopsis. Total RNA was
extracted at 48 h with VD-toxin treatment for real-time PCR
analysis. Actin2 was used as internal control. Error bars indicate
standard deviations. Values of each group with the same letters
were not significantly different (P < 0.05) [one-way analysis of
variance (anova) and Student–Newman–Keuls (SNK) test].
© 2011 Blackwell Publishing Ltd, Plant, Cell and Environment, 34, 1586–1598
1596 L-L. Yao et al.
The present study suggests that a stronger H2O2 production was induced by VD-toxins in wild-type compared to
the atrbohD and atrbohF mutants, especially at the later
stages (Fig. 2). Most importantly, at this phase, a dramatic
depolymerization of cortical microtubules was observed in
the wild type compared with the atrbohD and atrbohF
mutants (Fig. 4). Furthermore, scavenging of H2O2 accumulation by DMTU or inhibition of the VD-toxin-induced
H2O2 synthesis by DPI reduced the depolymerization of
cortical microtubules (Figs 3 & 5). In addition, the depolymerization of cortical microtubules increased with increasing concentrations of exogenous H2O2 (Fig. 6). Taken
together, these results reveal that the presence of H2O2
affected the dynamic microtubule cytoskeleton. H2O2 may
act as an upstream signalling molecule to regulate the
depolymerization of cortical microtubules. Microtubuleassociated proteins (MAPs) have been shown to be targets
for H2O2 (Zhang et al. 2003; Landino et al. 2004). MAPs
serve a wide variety of functions and control microtubule
organization and dynamics (Sedbrook 2004); therefore, we
speculate that the depolymerization of cortical microtubules may be the consequence of the inactivation of MAPs
regulated by H2O2.
Microtubule depolymerization plays a
functional role in VD-toxin-induced
defence responses
Depolymerization of microtubules has been reported in
parsley–Phytophthora and soybean–Phytophthora interactions, and in elicitor-treated tobacco cells (Gross et al. 1993;
Binet et al. 2001; Cahill et al. 2002). Thus, biotic interactions
involve specific alterations to the microtubule cytoskeleton.
However, a direct connection between microtubule depolymerization and triggering of defence responses remains to
be elucidated.
The present study showed that the disruption of cortical
microtubules affected the expression of PR1, PR2 and PR5
genes during the response against VD-toxins (Fig. 8). Stabilization of cortical microtubules using taxol reduced these
VD-toxin-induced expressions of genes, whereas depolymerization of cortical microtubules using oryzalin strongly
increased the expression of these genes. This indicates that
the cortical microtubule dynamics plays an important role
in mediating the plant defence response. Cortical microtubules may be an earlier and specific sign to induce the
defence gene expression against VD-toxins in Arabidopsis.
Similar results were reported in that the actin cytoskeleton
is a key player in defence responses during early stages of
infection by fungal pathogens (Kobayashi & Hakuno 2003).
The actin cytoskeleton is required for basal defence against
powdery mildew and bacterial pathogens (Miklis et al. 2007;
Tian et al. 2009). The depolymerization of the actin cytoskeleton induced the expression of PR1 and PR2 genes in
tobacco (Kobayashi & Kobayashi 2007).
Based on these data, we propose a working model for the
signalling pathways for the defence mechanisms in response
to VD-toxins. Upon VD-toxin treatment, the H2O2 level
rose quickly. It is possible that H2O2 may act as an upstream
signalling molecule to trigger the depolymerization of
cortical microtubules, which in turn trigger the elevated
expressions of PR1, PR2 and PR5. Based on this model,
H2O2 modulates the dynamic microtubule cytoskeleton to
trigger the expression of defence genes against VD-toxins
in Arabidopsis. Whether other signalling pathways are also
activated requires further investigation.
ACKNOWLEDGMENTS
We thank Dr M.A. Torres (University of North Carolina at
Chapel Hill) for providing atrbohD and atrbohF mutant
seeds, and Prof Yuan M. (China Agricultural University,
Beijing, China) for providing the seeds of Arabidopsis that
expressed GFP–tubulin. This work was supported by the
National Natural Science Foundation of China (grant no.
30870203 to Y.-Z.L.).
REFERENCES
Asai S., Ohta K. & Yoshioka H. (2008) MAPK signaling regulates
nitric oxide and NADPH oxidase-dependent oxidative burst in
Nicotiana benthamiana. The Plant Cell 20, 1390–1406.
Bhat R.G. & Subbarao K.V. (1999) Host range specificity in Verticillium dahliae. Phytopathology 89, 1218–1225.
Binet M.N., Humbert C., Lecourieux D., Vantard M. & Pugin A.
(2001) Disruption of microtubular cytoskeleton induced by cryptogein, an elicitor of hypersensitive response in tobacco cells.
Plant Physiology 125, 564–572.
Cahill D., Rookes J., Michalczyk A., McDonald K. & Drake A.
(2002) Microtubule dynamics in compatible and incompatible
interactions of soybean hypocotyl cells with Phytophthora sojae.
Plant Pathology 51, 629–640.
Choi H.W., Kim Y.J., Lee S.C., Hong J.K. & Hwang B.K. (2007)
Hydrogen peroxide generation by the pepper extracellular peroxidase CaPO2 activates local and systemic cell death and
defense response to bacterial pathogens. Plant Physiology 145,
890–904.
Day B. & Graham T. (2007) The plant host–pathogen interface:
cell wall and membrane dynamics of pathogen-induced
responses. Annals of the New York Academy of Sciences 1113,
123–134.
Delledonne M., Zeier J., Marocco A. & Lamb C. (2001) Signal
interactions between nitric oxide and reactive oxygen intermediates in the plant hypersensitive response. Proceedings of the
National Academy of Sciences of the United States of America 98,
13454–13459.
Farah M.E. & Amberg D.C. (2007) Conserved actin cysteine residues are oxidative stress sensors that can regulate cell death in
yeast. Molecular Biology of the Cell 18, 1359–1365.
Fradin E.F. & Thomma B.P.H.J. (2006) Physiology and molecular
aspects of Verticillium wilt diseases caused by V. dahliae and V.
albo-atrum. Molecular Plant Pathology 7, 71–86.
Gadjev I., Vanderauwera S., Gechev T.S., Laloi C., Minkov I.N.,
Shulaev V., Apel K., Inze D., Mittler R. & Van Breusegem F.
(2006) Transcriptomic footprints disclose specificity of reactive
oxygen species signaling in Arabidopsis. Plant Physiology 141,
436–445.
Galletti R., Denoux C., Gambetta S., Dewdney J., Ausubel F.M., De
Lorenzo G. & Ferrari S. (2008) The AtrbohD-mediated oxidative burst elicited by oligogalacturonides in Arabidopsis is dispensable for the activation of defense responses effective against
Botrytis cinerea. Plant Physiology 148, 1695–1706.
© 2011 Blackwell Publishing Ltd, Plant, Cell and Environment, 34, 1586–1598
H2O2 modulates MT dynamics in the defence responses 1597
Gechev T.S. & Hille J. (2005) Hydrogen peroxide as a signal controlling plant programmed cell death. Journal of Cell Biology
168, 17–20.
Gechev T.S., Van Breusegem F., Stone J.M., Denev I., & Laloi C.
(2006) Reactive oxygen species as signals that modulate plant
stress responses and programmed cell death. BioEssays 28,
1091–1101.
Genre A. & Bonfante P. (2002) Epidermal cells of a symbiosisdefective mutant of Lotus japonicus show altered cytoskeleton
organization in the presence of a mycorrhizal fungus. Protoplasma 219, 43–50.
Gilroy S. & Trewavas A. (2001) Signal processing and transduction
in plant cells: the end of the beginning? Nature Reviews Molecular Cell Biology 2, 307–314.
Grant M., Brown I., Adams S., Knight M., Ainslie A. & Mansfield
J. (2000) The RPM1 plant disease resistance gene facilitates a
rapid and sustained increase in cytosolic calcium that is necessary for oxidative burst and hypersensitive cell death. The Plant
Journal 23, 441–450.
Gross P., Julius C., Schmeltzer E. & Hahlbrock K. (1993) Translocation of cytoplasm and nucleus to fungal penetration sites is
associated with depolymerisation of microtubules and defense
gene activation in infected, cultured parsley cells. EMBO Journal
12, 1735–1744.
Hardham A.R., Jones D.A. & Takemoto D. (2007) Cytoskeleton
and cell wall function in penetration resistance. Current Opinion
in Plant Biology 10, 342–348.
Hardham A.R., Takemoto D. & White R.G. (2008) Rapid and
dynamic subcellular reorganization following mechanical stimulation of Arabidopsis epidermal cells mimics responses to fungal
and oomycete attack. BMC Plant Biology 8, 63.
Hou Y.Y., Shi F.M. & Li Y.Z. (2008) Verticillium dahliae toxins
induce changes of a putative histone H2B and a pumilio/Puf
RNA-binding protein gene expression in Arabidopsis thaliana.
Journal of Plant Pathology 90, 117–120.
Jia Z.Q.. Yuan H.Y. & Li Y.Z. (2007) NO and H2O2 induced by
Verticillium dahliae toxins and its influence on the expression of
GST gene in cotton suspension cells. Chinese Science Bulletin 52,
1347–1354.
Jiang J., Fan L.W. & Wu W.H. (2005) Evidences for involvement of
endogenous cAMP in Arabidopsis defense responses to Verticillium toxins. Cell Research 15, 585–592.
Kasprowicz A., Szuba A., Volkmann D., Baluška F. & Wojtaszek P.
(2009) Nitric oxide modulates dynamic actin cytoskeleton and
vesicle trafficking in a cell type-specific manner in root apices.
Journal of Experimental Botany 60, 1605–1617.
Kobayashi I. & Hakuno H. (2003) Actin-related defense mechanism to reject penetration attempt by a non-pathogen is maintained in tobacco BY-2 cells. Planta 217, 340–345.
Kobayashi Y. & Kobayashi I. (2007) Depolymerization of the actin
cytoskeleton induces defense responses in tobacco plants.
Journal of General Plant Pathology 73, 360–364.
Lamb C. & Dixon R.A. (1997) The oxidative burst in plant disease
resistance. Annual Review of Plant Physiology and Plant Biology
48, 251–275.
Landino L.M., Robinson S.H., Skreslet T.E. & Cabral D.M. (2004)
Redox modulation of tau and microtubule-associated protein-2
by the glutathione/glutaredoxin reductase system. Biochemical and Biophysical Research Communications 323, 112–
117.
Leadsham J.E. & Gourlay C.W. (2008) Cytoskeletal induced
apoptosis in yeast. Biochimica et Biophysica Acta 1783, 1406–
1412.
Leitner M., Vandelle E., Gaupels F., Bellin D. & Delledonne M.
(2009) NO signals in the haze: nitric oxide signalling in plant
defence. Current Opinion in Plant Biology 12, 451–458.
Levine A., Tenhaken R., Dixon R. & Lamb C. (1994) H2O2 from
the oxidative burst orchestrates the plant hypersensitive disease
resistance response. Cell 79, 583–593.
Lipka V. & Panstruga R. (2005) Dynamic cellular responses in
plant–microbe interactions. Current Opinion in Plant Biology 8,
625–631.
Liu S.Z. (2005) Identification and purification of the effective elicitor
from Verticillium dahliae by using Arabidopsis as a model. PhD
thesis, China Agricultural University, Beijing, China.
McFadden H.G., Chapple R., de Feyter R. & Dennis E. (2001)
Expression of pathogenesis-related genes in cotton stems in
response to infection by Verticillium dahliae. Physiological and
Molecular Plant Pathology 58, 119–132.
Miklis M., Consonni C., Bhat R.A., Lipka V., Schulze-Lefert P. &
Panstruga R. (2007) Barley MLO modulates actin-dependent
and actin-independent antifungal defense pathways at the cell
periphery. Plant Physiology 144, 1132–1143.
Miller G., Suzuki N., Ciftci-Yilmaz S. & Mittler R. (2010) Reactive
oxygen species homeostasis and signalling during drought and
salinity stresses. Plant, Cell & Environment 33, 453–467.
Murashige T. & Skoog F. (1962) A revised medium for rapid
growth and bioassays with tobacco cultures. Physiologia Plantarum 15, 473–479.
Nachmias A., Buchner V. & Burstein Y. (1985) Biological and
immunochemical characterization of a low molecular weight
phytotoxin isolated from a protein–lipopolysaccharide complex
produced by a potato isolate of Verticillium dahliae Kleb. Physiological Plant Pathology 26, 43–55.
Ouko M.O., Sambade A., Brandner K., Niehl A., Peña E., Ahad A.,
Heinlein M. & Nick P. (2010) Tobacco mutants with reduced
microtubule dynamics are less susceptible to TMV. The Plant
Journal 62, 829–839.
Overmyer K., Brosche M. & Kangajarvi J. (2003) Reactive oxygen
species and hormonal control of cell death. Trends in Plant
Science 8, 335–342.
Pogány M., von Rad U., Grün S., Dongó A., Pintye A., Simoneau P.,
Bahnweg G., Kiss L., Barna B. & Durner J. (2009) Dual roles of
reactive oxygen species and NADPH oxidase RBOHD in an
Arabidopsis–Alternaria pathosystem. Plant Physiology 151,
1459–1475.
Polverari A., Molesini B., Pezzotti M., Buonaurio R., Marte M. &
Delledonne M. (2003) Nitric oxide-mediated transcriptional
changes in Arabidopsis thaliana. Molecular Plant–Microbe Interactions 16, 1094–1105.
Schmidt S.M. & Panstruga R. (2007) Cytoskeleton functions in
plant–microbe interactions. Physiological and Molecular Plant
Pathology 71, 135–148.
Sedbrook J.C. (2004) MAPs in plant cells: delineating microtubule
growth dynamics and organization. Current Opinion in Plant
Biology 7, 632–640.
Shi F.M. & Li Y.Z. (2008) Verticillium dahliae toxin-induced nitric
oxide production in Arabidopsis is major dependent on nitrate
reductase. Biochemistry and Molecular Biology Reports 41,
79–85.
Shi F.M., Yao L.L., Pei B.L., Zhou Q., Li X.L., Li Y. & Li Y.Z. (2009)
Cortical microtubule as a sensor and target of nitric oxide signal
during the defense responses to Verticillium dahliae toxins in
Arabidopsis. Plant, Cell & Environment 32, 428–438.
Staiger C.J. & Blanchoin L. (2006) Actin dynamics: old friends
with new stories. Current Opinion in Plant Biology 9, 554–
562.
Takemoto D. & Hardham A. (2004) The cytoskeleton as a regulator and target of biotic interactions in plants. Plant Physiology
136, 3864–3876.
Tian M., Chaudhry F., Ruzicka D.R., Meagher R.B., Staiger
C.J. & Day B. (2009) Arabidopsis actin-depolymerizing factor
© 2011 Blackwell Publishing Ltd, Plant, Cell and Environment, 34, 1586–1598
1598 L-L. Yao et al.
AtADF4 mediates defense signal transduction triggered by the
Pseudomonas syringae effector AvrPphB. Plant Physiology 150,
815–824.
Torres M.A. (2010) ROS in biotic interactions. Physiologia Plantarum 138, 414–429.
Torres M.A. & Dangl J.L. (2005) Functions of the respiratory burst
oxidase in biotic interactions, abiotic stress and development.
Current Opinion in Plant Biology 8, 397–403.
Torres M.A., Dangl J.L. & Jones J.D.G. (2002) Arabidopsis
gp91phon homologues AtrbohD and AtrbohF are required for
accumulation of reactive oxygen intermediates in the plant
defense response. Proceedings of the National Academy of Sciences of the United States of America 99, 517–522.
Torres M.A., Jones J.D.G. & Dangl J.L. (2005) Pathogen-induced,
NADPH oxidase-derived reactive oxygen intermediates suppress spread of cell death in Arabidopsis thaliana. Nature
Genetics 37, 1130–1134.
Torres M.A., Jones J.D.G. & Dangl J.L. (2006) Reactive oxygen
species signaling in response to pathogens. Plant Physiology 141,
373–378.
Ueda K., Matsuyama T. & Hashimoto T. (1999) Visuatization of
microtubules in living cells of transgenic Arabidopsis thaliana.
Protoplasma 206, 201–206.
Veljovic-Jovanovic S., Novtor G. & Foyer C.H. (2002) Are leaf
hydrogen peroxide concentrations commonly overestimated?
The potential influence of artefactual interference by tissue phenolics and ascorbate. Plant Physiology and Biochemistry 40, 501–
507.
Wasteneys G.O. & Galway M.E. (2003) Remodeling the cytoskeleton for growth and form: an overview with some new views.
Annual Review of Plant Biology 54, 691–722.
Yoshioka H., Numata N., Nakajima K., Katou S., Kawakita K.,
Rowland O., Jones J.D.G. & Doke N. (2003) Nicotiana benthamiana gp91PHOX homologs NbrbohA and NbrbohB participate in
H2O2 accumulation and resistance to Phytophthora infestans.
The Plant Cell 15, 706–718.
Yoshioka H., Asai S., Yoshioka M. & Kobayashi M. (2009) Molecular mechanisms of generation for nitric oxide and reactive
oxygen species, and role of the radical burst in plant immunity.
Molecules and Cells 28, 321–329.
Yuan H.Y., Jia Z.Q., Li Y. & Li Y.Z. (2006) Verticillium dahliae
toxin induced alterations of cytoskeletons and nucleoli in Arabidopsis suspension cells. Protoplasma 299, 75–82.
Zhang W., Wang C., Qin C., Wood T., Olafsdottir G., Welti R. &
Wang X. (2003) The oleate-stimulated phospholipase D, PLDd,
and phosphatidic acid decrease H2O2-induced cell death in
Arabidopsis. The Plant Cell 15, 2285–2295.
Received 13 February 2011; received in revised form 16 April 2011;
accepted for publication 22 April 2011
© 2011 Blackwell Publishing Ltd, Plant, Cell and Environment, 34, 1586–1598