Download Proteins RCA Gene Cluster and Functional RCA Locus in Chicken

This information is current as
of June 16, 2017.
Regulator of Complement Activation (RCA)
Locus in Chicken: Identification of Chicken
RCA Gene Cluster and Functional RCA
Proteins
Hiroyuki Oshiumi, Kyoko Shida, Ryo Goitsuka, Yuko
Kimura, Jun Katoh, Shinya Ohba, Yuichiroh Tamaki,
Takashi Hattori, Nozomi Yamada, Norimitsu Inoue, Misako
Matsumoto, Shigeki Mizuno and Tsukasa Seya
References
Subscription
Permissions
Email Alerts
This article cites 41 articles, 22 of which you can access for free at:
http://www.jimmunol.org/content/175/3/1724.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2005 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
J Immunol 2005; 175:1724-1734; ;
doi: 10.4049/jimmunol.175.3.1724
http://www.jimmunol.org/content/175/3/1724
The Journal of Immunology
Regulator of Complement Activation (RCA) Locus in Chicken:
Identification of Chicken RCA Gene Cluster and Functional
RCA Proteins1
Hiroyuki Oshiumi,2,3* Kyoko Shida,2* Ryo Goitsuka,† Yuko Kimura,4*§ Jun Katoh,‡
Shinya Ohba,‡ Yuichiroh Tamaki,‡ Takashi Hattori,‡ Nozomi Yamada,‡ Norimitsu Inoue,*
Misako Matsumoto,* Shigeki Mizuno,5‡ and Tsukasa Seya6*§
T
he complement (C) system recognizes foreign cells and
targets them for clearance and immune cytolysis (1). Host
cells in contrast are protected from autologous C attack by
membrane-associated C regulatory proteins (2). It is generally accepted that the C susceptibility in host cells is regulated mainly at
C3 step. In humans, the C regulatory proteins consist of tandemly
*Department of Immunology, Osaka Medical Center for Cancer and Cardiovascular
Diseases, Osaka, Japan; †Research Institute for Biological Sciences, Tokyo University
of Science, Chiba, Japan; ‡Department of Agricultural and Biological Chemistry,
College of Bioresource Sciences, Nihon University, Fujisawa, Japan; and §Department of Microbiology and Immunology, Graduate School of Medicine, Hokkaido
University, Sapporo, Japan
Received for publication September 15, 2004. Accepted for publication May
16, 2005.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported in part by Core Research for Engineering, Science, and
Technology, Japan Science and Technology Agency, Grants-in-Aids from the Ministry of Education, Science, and Culture (Specified Project for Advanced Research),
the Ministry of Health and Welfare of Japan, and by Zoonosis Corporation Project
(Tsukuba, Japan). M.M. is supported by the Naito Memorial Foundation and the
Uehara Memorial Foundation, and T.S. is supported by the Mitsubishi Foundation.
2
H.O. and K.S. have equally contributed to this work.
3
Current address: Institute for Protein Research, Osaka University, Osaka, Japan.
4
Current address: Center for Experimental Therapeutics, University of Pennsylvania,
Philadelphia, PA 19104.
5
Deceased.
6
Address correspondence and reprint requests to Dr. Tsukasa Seya, Department of
Microbiology and Immunology, Graduate School of Medicine, Hokkaido University,
Kita-15, Nishi-7, Kita-ku, Sapporo 060-8638 Japan. E-mail address: [email protected]
Copyright © 2005 by The American Association of Immunologists, Inc.
arranged domains named short consensus repeats (SCRs)7 and
their genes cluster in a region designated as the regulator of C
activation (RCA) locus. Each SCR consists of 60 –70 aa, including
4 highly conserved cysteines (3, 4). The cysteines form disulfide
bonds, folding the SCRs into a rigid triple-loop structure (3, 4).
Although the proteins in the RCA family vary in size, they share
significantly similar in three-dimensional structures due to conserved amino acids at specific locations. Considering their similarities and configurations, RCA locus might have been expanding
by repeating gene duplications. The structural and functional properties of these proteins have been extensively studied in humans
and rodents, whereas the RCA proteins or even locus have not
been identified yet in nonmammalian vertebrate.
In humans, two soluble forms, factor H and C4b-binding protein
(C4bp), and four membrane forms, CR1 (CD35), CR2 (CD21),
decay-accelerating factor (DAF) (CD55), and membrane cofactor
protein (MCP) (CD46), have been identified as C regulatory proteins (4, 5). Genes for all these regulators, except for factor H,
were mapped to the RCA locus, 1q32 (4, 5). This locus is in close
proximity to the 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 (PFKFB2) gene in mammals (6). Factor H gene is also
mapped to the long arm of chromosome 1 but outside of the RCA
7
Abbreviations used in this paper: SCR, short consensus repeat; RCA, regulator of C
activation; C4bp, C4b-binding protein; DAF, decay-accelerating factor (CD55);
MCP, membrane cofactor protein (CD46); PFKFB2, 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2; CREM, (formerly Cremp) C regulatory membrane protein
of chicken; SBP1, sand bass protein 1; BAC, bacterial artificial chromosome; ORF,
open reading frame; BLAST, Basic Local Alignment Search Tool; CRES, C regulatory secretory protein of chicken; CREG, C regulatory GPI-anchored protein of chicken; FISH, fluorescence in situ hybridization; CHO, Chinese hamster ovary; mCRES,
membrane form of CRES; TM, transmembrane; GVB, gelatin veronal buffer; LHR,
long homologous repeat.
0022-1767/05/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
A 150-kb DNA fragment, which contains the gene of the chicken complement regulatory protein CREM (formerly named Cremp),
was isolated from a microchromosome by screening bacterial artificial chromosome library. Within 100 kb of the cloned region,
three complete genes encoding short consensus repeats (SCRs, motifs with tandemly arranged 60 aa) were identified by exon-trap
method and 3ⴕ- or 5ⴕ-RACE. A chicken orthologue of the human gene 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2,
which exists in close proximity to the regulator of complement activation genes in humans and mice, was located near this chicken
SCR gene cluster. Moreover, additional genes encoding SCR proteins appeared to be present in this region. Three distinct
transcripts were detected in RNA samples from a variety of chicken organs and cell lines. Two novel genes named complement
regulatory secretory protein of chicken (CRES) and complement regulatory GPI-anchored protein of chicken (CREG) besides
CREM were identified by cloning corresponding cDNA. Based on the predicted primary structures and properties of the expressed
molecules, CRES is a secretory protein, whereas CREG is a GPI-anchored membrane protein. CREG and CREM were protected
host cells from chicken complement-mediated cytolysis. Likewise, a membrane-bound form of CRES, which was artificially
generated, also protected host cells from chicken complement. Taken together, the chicken possesses an regulator of complement
activation locus similar to those of the mammals, and the gene products function as complement regulators. The Journal of
Immunology, 2005, 175: 1724 –1734.
The Journal of Immunology
Materials and Methods
Isolation of chicken bacterial artificial chromosome (BAC)
clones
Chicken BAC libraries were screened with the full-length CREM cDNA.
The properties of the established BAC libraries and the method for the
isolation of BAC clones by four-dimensional PCR with the cDNA-derived
primer set were described previously (15). We successfully obtained four
CREM-positive DNA clones with 90 –160 kb. Based on the information of
the human RCA locus, we presumed that the chicken RCA and PFKFB2
loci were localized near or overlapping the genes of Cremp (CREM), the
human CD46 (MCP) analogue (11). The largest clone was found to contain
a putative RCA locus because it covered many SCR-encoding exons judging from the results determined by the exon-trapping method described
below.
Exon trapping
The exon-trapping methods were described in the manufacture’s exon trapping manual (Invitrogen Life Technologies). Briefly, the BAC clone containing the chicken CREM gene was cut with PstI, and the exon-trapping
library was made by inserting those PstI fragments into PstI site of pSPL3
(Invitrogen Life Technologies)-modified vector. The library was transferred into COS-7 cells using LipofectAMINE 2000 reagents (Invitrogen
Life Technologies). After 48 h of incubation, total RNA was extracted
using TRIzol (Invitrogen Life Technologies). Reverse transcription reactions were performed using vector-specific primer, SA2. The primary PCR
was conducted using the primers, SA2 and SD6. To remove the fragments
that contain no exon, the PCR products were cut with BstXI, which degraded exon-deficient fragments. Secondary PCR was performed with SD2
and SA4 primers, using ExTaq polymerase (Takara Shuzo). A total of 105
independent clones was isolated by this technique. The primer sequences
were listed in Table I. The amplified cDNA fragments were cloned into
pGEM-T easy vector using the TA cloning method. Basic Local Alignment
Search Tool (BLAST) search analysis revealed that seven clones were
similar to human CR1, three to CR2, two to DAF, six to MCP, three to
polymeric IgR, and two to PFKFB2. The other clones neither showed similarity to any known genes nor Escherichia coli genome vector sequences.
Cloning of C regulatory secretory protein of chicken (CRES)
and C regulatory GPI-anchored protein of chicken (CREG)
Using the chicken expressed sequence tag (accession no. BG713462) sequence, the sequence of clone no. 54 isolated by exon trapping showed
similarity to human CR1/CR2. We performed nested PCR on chicken thymus cDNA library using the vector-specific and CRES primers, PCR2 and
PCRR. The library was obtained as described earlier (16). We obtained
partial cDNA fragments that did not contain the 5⬘- or 3⬘-end of open
reading frame (ORF). To isolate these sequences, mRNA was prepared
from the total RNA of chicken DT40 cells using a mRNA Purification kit
(Amersham Biosciences). The cDNA was made from this mRNA using a
Marathon kit (BD Clontech). Using the primers, GSP2-CR2 and NGSP2CR2, 5⬘-RACE, and the primers, GSP1-CR2 and NGSP2-CR2, 3⬘-RACE
was performed. The primer sequences are shown in Table I. To confirm the
CRES sequence, we performed RT-PCR using mRNAs from DT40 or
chicken liver as a template. We found the cDNA containing full-length
ORF and several other cDNA fragments lacking the SCR4 region, which
are probably derived by alternative splicing (data not shown).
Based on the clone no. 100 sequence, which shows similarity to human
DAF, the 5⬘- and 3⬘-RACE were performed with the primers GSP1–100
and NGSP1–100 for 5⬘-RACE and GSP2–100 and NGSP2 for 3⬘-RACE,
using the cDNA from DT40 cells as the template. Three independent RTPCR amplicons using the cDNA of DT40 or chicken liver as a template
were sequenced and translated. The predicted protein consisted of seven
SCRs with the GPI anchor, which we designated as CREG.
Isolation of mRNA and RT-PCR
Total RNA was extracted from chicken tissues and cell lines with TRIzol
reagent (Invitrogen Life Technologies). Four micrograms of total RNA
were reverse transcribed by RNaseH(-) reverse transcriptase (Promega)
and then subjected to PCR cycle of cDNA amplification using ExTaq polymerase (Takara Shuzo). PCR was performed as follows: denaturation at
94°C for 2 min and 30 cycles of denaturation at 94°C 30 s, annealing at
55°C for 30 s, and extension at 72°C for 30 s. The products were separated
on 0.7% agarose gel and stained with ethidium bromide.
Construction of chicken RCA map
The BAC clone was cut with indicated restriction enzymes and separated
on 1% agarose gel in 1⫻ TAE buffer by pulse-field gel electrophoresis
apparatus using Genofield (Atto Bioscience); the voltage was DC 40 V and
AC 294 V, and the frequency modulation was from 0.30 Hz (start) to 0.60
Hz (end) in the linear setting, and the run time was 900 min. The DNA
fragments were transferred to the Hybond-N⫹ membrane (Amersham Biosciences) and southern hybridized with indicated probes.
Protein domain structure and homology analyses
The domain structures of chicken proteins were predicted using Simple
Modular Architecture Research Tool program (具http://smart.embl-heidelberg.de/典). Putative GPI anchor site was predicted using big PI predictor
(具http://mendel.imp.univie.ac.at/sat/gpi/gpi_server.html典) (17). Signal peptide was predicted by SignalP program (具http://www.cbs.dtu.dk/services/
SignalP/典) (18). Homologies between chicken and human proteins were
examined by BLAST search analysis. SCR domain homology was determined by comparing the SCR domains of chicken proteins with those of
human proteins using tblastn program in National Center for Biotechnology Information BLAST server and Genetyx-Mac version 11.2.1 (Genetyx) maximum matching program.
Chromosome preparation and in situ hybridization
Fluorescence in situ hybridization (FISH) method was used for chromosomal assignment of chicken RCA genes. Preparation of R-banded chromosomes and FISH were performed as described previously (19, 20). The
results were consistent with those of CREM (11), indicating that the genes
were mapped in close proximity to the CREM gene.
Ab, cells, human proteins, and serum
Fresh chicken and human sera were obtained from each species by standard
methods (11, 21). All samples were stored at ⫺80°C immediately after
collection until use. Chinese hamster ovary (CHO) cells were obtained
from American Type Culture Collection. RK13 cells (derived from the
rabbit kidney) were obtained from Riken Cell Bank (Wako Pure Chemical). CHO cell clones expressing human MCP (CHO/MCP) were established as described in a previous report (22). CHO and RK13 cells were
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
locus. All human counterparts of these proteins are identified in
mice. However, the mouse RCA locus is split into the two regions
presumably through gene translocation. However, the RCA locus
is conserved between humans and mice (7–9).
From an evolutionary point of view, we first identified chicken
Cremp (here designated regulatory membrane protein of chicken
(CREM)) as its C regulatory system (10). This is a nonmammalian
membrane-anchored C regulatory protein similar to MCP and
DAF (11). That was the first report on the SCR-containing C regulatory protein in oviparous animals. However, no other SCR protein with C regulatory function has thus far been identified in
chicken. In fish (Sand bass), an SCR-containing C regulator named
sand bass protein 1 (SBP1) was cloned. SBP1 binds to both rainbow trout C3b and human C4b (12) and serves as a cofactor for
factor I (12). However, SBP1 is unlikely to be a homologue of any
member of human RCA because neither gene cluster of SCR-containing proteins nor a human homologue of a fish gene PFKFB2
was identified near the SBP1 locus. SBP1 would be a putative
structural homologue of huFactor H (13). In contrast, a jawless
fish, Lampetra japonica (lamprey) (14), and puffer fish (H. Oshiumi and T. Seya, unpublished data) possess an additional SCRcontaining protein similar in size to huC4bp near the PFKFB2
gene. However, no gene clusters of SCR-containing proteins have
been identified in the relevant regions of the fish and lamprey
genomes to our database knowledge, suggesting that the RCA gene
cluster is expanded in terrestrial animals.
In the present study, we report the identification of a gene cluster
of SCR-containing chicken proteins. Three proteins identified in
this cluster exerted host cell-protective activity against chicken C.
Based on the structural and functional analyses of these SCR proteins, we concluded that the two loci of chicken and human RCA
evolved from a common prototype. This is the first report on analysis of the nonmammal RCA locus and proteins.
1725
1726
RCA LOCUS IN THE CHICKEN
Table 1. Primers used in this study
Primer Name
CACCTGAGGAGTGAATTGGTCG
GTGAACTGCACTGTGACAAGC
ATCTCAGTGGTATTTGTGAGC
TCTGAGTCACCTGGACAACC
CACTCCATCTTCGGAGGTGC
ACTCCATTCCAGGTTCACTC
AGACGCCGTTCACATTGTCGATGG
CCTGATGTCAGCGTGGCAGTGGTAGG
GACCCTGGCTATGTTTTCAAGGATCG
GCAGCACCAGAGTGCATTCCAGAACC
ATCGCAGGTAACCGTCTGAGCTCCG
CCATAGGTGTACTCAGTGGCAAAGC
GCTTTGCCACTGAGTACACCTATGG
GAGCTTTGAGTGTGCTCCTGGGCACGC
AGCATAGCTGTGACATCTGC
CCAGGAGAGCCCGATGAATGG
CCGTTGTGCTCTCCGTTTGC
GCAAACGGAGAGCACAACGG
CCACCTGACGTGCAGAATGC
GGGCGGTGGAACTTCAGTCC
CTGGGACAGAAAAGACAC
TGACATCATCATCACGATCC
AAGCCTGCCGTTGACCACGG
GTGGAATATAGTTGTGCTGC
AAGCCCGTGGTTGAGAATGG
TCGTGCACCAACGAGCAAGG
AGCCAAAGGACTCCGATTCC
GTCACACAGTATGAGTTAGC
GGGTCTGCAGCTGGAAATGG
CCGAGGTTCTCTTTTG
GAGCTTGTTCCTATCTCCCGTGTACC
ATCACTGCCGCTCAGGATGC
CTCAATGGGATATGGAGTGG
GACGCTCAGTAGTGTGCACG
GAGGTTATCATCCATTGTGC
GCCACACGATGGCAGAGATGG
CCTGGACTTCAGGCTCTGC
TGCTCCCACAATACCGAACG
CCGTTGTGGTTTATTCCTGC
CGTTGCTAGGCACTGAATGG
ATTGCAGGGTTGGTTTCTCC
Exon trapping
Exon trapping
Exon trapping
Exon trapping
5⬘-RACE (CRES)
5⬘-RACE (CRES) Exon/Intron (CRES)
5⬘ RACE (CRES) Exon/Intron (CRES)
5⬘-RACE (CRES)
3⬘-RACE (CRES)
3⬘-RACE (CRES)
5⬘-RACE (CREG)
5⬘-RACE (CREG)
3⬘-RACE (CREG)
3⬘-RACE (CREG) Exon/Intron (CREG)
Exon/Intron (CRES)
Exon/Intron (CRES)
Exon/Intron (CRES)
Exon/Intron (CRES)
Exon/Intron (CRES)
Exon/Intron (CRES)
Exon/Intron (CRES)
Exon/Intron (CRES)
Exon/Intron (CRES)
Exon/Intron (CRES)
Exon/Intron (CRES)
Exon/Intron (CRES)
Exon/Intron (CRES)
Exon/Intron (CRES)
Exon/Intron (CRES)
Exon/Intron (CREG)
Exon/Intron (CREG)
Exon/Intron (CREG)
Exon/Intron (CREG)
Exon/Intron (CREG)
Exon/Intron (CREG)
Exon/Intron (CREG)
Exon/Intron (CREG)
Exon/Intron (CREG)
Exon/Intron (CREG)
Exon/Intron (CREG)
Exon/Intron (CREG)
a
“Exon trapping,” “5⬘- or 3⬘-RACE,” or “Exon/Intron” represents the primers used for exon-trapping screening, RACE reactions to isolate chicken proteins, or determination
of the exon-intron boundaries, respectively.
maintained in Ham’s F-12/10% FCS and DMEM/10% FCS, respectively.
These cells were transfected with cDNAs in expression vectors by the
usual method. For RNA and protein blot analysis, total RNAs and proteins
were obtained from various tissues and stored at ⫺80°C until use.
Tissue RNA blotting analysis
Total RNAs (20 ␮g) were extracted from various chicken tissues using
TRIzol Reagent (Invitrogen Life Technologies) and separated by electrophoresis in a 1.0% (w/v) agarose gel. RNAs were transferred onto a Hybond N⫹ membrane (Amersham Biosciences). The blot was prehybridized
for 30 min at 68°C and hybridized for 1 h at 68°C in ExpressHybridization
buffer (BD Biosciences/Clontech) with 32P-labeled full-length ORF of
chicken RCA cDNAs as a probe. The membrane was washed and exposed
to x-ray film at ⫺80°C.
Rabbit anti-CRES and anti-CREG Abs and flow cytometry
(FACS)
Rabbit anti-CRES and anti-CREG polyclonal Abs were produced by the
method established in our laboratory (11). Briefly, RK13 cells (1 ⫻ 107)
were transiently transfected for 48 h with a pFlag CMV-(CRES or CREG)HisX6 construct using LipofectAMINE Plus reagent (Invitrogen Life
Technologies). Transfected RK13 cells were collected in 10 mM EDTAPBS and suspended in 0.5 ml of PBS after washing three times with PBS.
The RK13 cell suspensions were then mixed and emulsified with 0.6 ml of
Freund’s complete adjuvant (Difco) and used for immunization of rabbits.
Immunization was performed four times at 7-day intervals, and the rabbits
were boosted before drawing the blood. IgG was precipitated with 33%
ammonium sulfate, dialyzed against PBS (11), and stored at ⫺80°C until
use. These monospecific Abs recognized only the relevant proteins.
FACS analysis was performed as described previously (22). Cells were
treated with the above Abs, washed three times, and tagged with FITClabeled second Abs. FACSCalibur (BD Biosciences) was used for analysis.
Protein blot analysis
Various chicken tissues were solubilized in lysis buffer (0.02 M Tris-HCl
(pH 7.4) containing 1% (v/v) Nonidet P-40, 0.14 M NaCl, 0.01 M EDTA,
1 mg/ml iodoacetamide, and 1 mM PMSF) using a potter type homogenizer. After incubation at 4°C for 30 min, each lysate was centrifuged at
15,000 rpm at 4°C for 30 min. The supernatant was collected, and protein
concentration was measured using a protein assay kit (Bio-Rad). Fifty micrograms of total cellular proteins (extracted from 50 mg of tissue) were
resolved by SDS-PAGE (7.5% gel) and transferred to polyvinylidene difluoride membranes. CRES, CREG, and CREM were visualized using an
ECL detection system (Amersham Biosciences) with rabbit Abs (2 ␮g/ml)
and a HRP-linked goat anti-rabbit secondary Ab (1 ␮g/ml) (BioSource
International).
Generation of stable CHO transfectants expressing CREG,
CREM, or artificial membrane form of CRES (mCRES)
The cloned CRES cDNA was ligated with the DNA sequence of the transmembrane (TM) and cytoplasmic portion of MCP (CD46) and placed in
the XhoI/NotI site of pEFBOS, the method as described previously (14).
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
SA4
SD2
SA2
SD6
PCR2
PCRR
GSP2-CR2
NGSP2-CR2
GSP1-CR2
NGSP1-CR2
GSP1–100
NGSP1–100
GSP2–100
NGSP2–100
2PRF1
CRL1 SCR2F
PCRR4
2PRF2
CRL1SCR5F
CRL1SCR5R
PCRF
CRL1SCR6R
CRL1SCR7F
CRL1SCR8F
CRL1SCR9F
CRL1SCR10F
2PRR2
2PRR1
pr-N1-R1
PCRYF
2GSP1–100
PCRYR
100F1
chCRL2-F3
chCRL2-R3
100R1
chCRL2-F5
chCRL2-F6
chCRL2-F7
chCRL2-R7
chCRL2-R3UTR
Usea
Primer Sequence (5⬘-3⬘)
The Journal of Immunology
1727
FIGURE 1. Pulse-field gel analysis of chicken BAC DNA containing
CREM. The figure shows the
ethidium bromide (EtBr) staining of a
gel and the subsequent hybridization
of the Southern blots (lower panels)
with corresponding 32P-labeled
cDNA probes. Restriction enzymes
abbreviations are as follows: Nr,
NruI; P, PvuI; No, NotI; C, CpoI; M,
MluI; and S, SfiI. Molecular markers
are indicated on the EtBr panel.
Calcein release cytotoxicity assay
The method for the cytotoxicity assay using a fluorescent tracer was described previously (11). Briefly, the intact or transfected CHO cells (2 ⫻
104 cells/well) were seeded in 96-well plates. After they attained 90%
confluence, the cells were loaded with a fluorescent dye, calcein-AM (Molecular Probes), by incubation with 10 ␮M calcein-AM in serum-free
Ham’s F-12 medium for 30 min at 37°C. The cells were then incubated
with 50 ␮l of 400 ␮g/ml rabbit anti-CHO cell Ab (22) in PBS for 30 min
at 4°C. The Ab-sensitized CHO cells, which are known to be susceptible to
lysis by the human alternative pathway (4, 22), were suspended in Ca2⫹/
Mg2⫹-containing medium (gelatin veronal buffer, GVB⫹⫹). These cells
were subsequently incubated with 50 ␮l of various concentrations (typically 10%) of human or chicken serum diluted in GVB⫹⫹ for 60 min at
37°C with gentle shaking. In some cases, chicken serum (1 ml) was mixed
with intact CHO cells (1 ⫻ 107) at 4°C for 15 min (11, 22) and used as
natural Ab-absorbed serum. The plates were centrifuged at 1500 rpm for 5
min, and the fluorescence intensities of 100-␮l aliquots of the supernatants
were measured using a fluorescence plate reader with excitation at 488 nm
and emission at 514 nm. Percent cytotoxicity was calculated as described
previously (22). The experiments were performed three times in triplicate.
Four genomic clones containing the CREM gene were isolated
from the chicken BAC library by PCR with the CREM cDNAderived primer set. Several exons encoding SCRs were obtained
from the BAC clones by the exon trap method and mapped within
the 100 kb. We identified CREM and two other novel genes, CRES
and CREG, in the 100-kb chicken SCR-rich locus (Fig. 1). Restriction analysis shows that these were single copies in the putative RCA locus. FISH analysis indicated that their genes are
mapped near the CREM gene (data not shown). Their exons were
arranged based on the RFLP and Southern blot analyses and comparable to those of human RCA proteins, C4bp, DAF, CR2, CR1,
and MCP (Fig. 2). In regard to their configurations, CRES, CREG,
and CREM seemingly correspond to C4bp, CRY/DAF, and MCP,
respectively. Three cDNA fragments coding the putative SCR proteins were obtained by RT-PCR, confirming the expression of these
genes. Clustering of SCR protein genes, the order of the gene organization, and the identification of PFKFB2 gene at close proximity to
Results
Identification and mapping of the RCA locus/genes in the
chicken
Several lines of evidence suggested that CREM is the chicken
homologue of MCP (CD46) (11). The CREM gene was mapped to
chicken microchromosome 26 (11, 23). We surmised that the
chicken possesses the RCA locus that involves the CREM gene.
FIGURE 2. Structures of chicken BAC clones of SCR-rich protein
genes. The code for the restriction enzymes is given in the legend to Fig.
1. Human RCA locus is aligned with the putative RCA locus of chicken.
Notice that the PFKFB2 gene is linked on the CRES-containing fragment.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
CHO cells were transfected with the expression plasmid using LipofectAMINE (Invitrogen Life Technologies). CHO clones expressing a
mCRES were established through limiting dilution by G418 selection (0.7
mg/ml) (14) and screened by flow cytometry using anti-CRES Ab. CHO
cell clones expressing CREM were established as described previously
(11). CHO cell clones expressing CREG were obtained by transfection of
CHO cells with the CREG cDNA in mammalian expression vector
pCXN-2 (11). Stable transfectants were selected by 0.6 mg/ml G418 (Invitrogen Life Technologies). Selected CHO cells were assessed for CREG
expression by immunoblotting and flow cytometry using anti-CREG Ab.
1728
RCA LOCUS IN THE CHICKEN
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
FIGURE 3. Sequences of the exon-intron junctions of CRES, CREG, and CREM. Exons are boxed. Closed boxes indicate translated regions. The ag-gt
consensus sequences for splicing are conserved. The sizes of introns are indicated. A, CRES; B, CREG; and C, CREM.
The Journal of Immunology
1729
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
FIGURE 4. Complete amino acid sequences of CRES and CREG. Deduced amino acid sequences of CRES (A) and CREG (B) are shown under the
nucleotide sequences. Asterisks indicate the stop codons. The signal sequences are underlined. The nucleotide sequence of CRES contained both the
polyadenylation signal (double underlined) and poly(A) sequence. The circled Gly in CREG C-terminal region is the predicted GPI anchor modification
site (see Materials and Methods). The nucleotide sequences have been registered in the European Molecular Biology Laboratory Data Library/GenBank/
DNA Data Bank of Japan databases with the accession nos. AB074567 (CRES) and AB109024 (CREG). C, The outlines of the CRES and CREG primary
structures are shown. Incomplete SCR are not numbered. Circle, SCR motif; square, TM domain; and hexagon, cytoplasmic tail. Model of CREM was
delineated according to the published primary structure (11). D, Each SCR sequence of CRES and CREG was compared with that of human SCR proteins
using an National Center for Biotechnology Information BLAST search. Regions with high homology scores are shown as red and orange.
this locus suggested this BAC fragment to be the RCA locus of
chicken.
Genomic and primary structures of the chicken RCA proteins
Genomic structures, including the exon-intron boundaries, were
determined with these three chicken RCA genes (Fig. 3). SCR2 of
CRES, SCR2 and SCR6 of CREG, and SCR2 of CREM were encoded by split exons similar to the functionally essential exons of
the human C regulatory proteins (Fig. 3, A–C). Furthermore, the
amino acid similarities of the split exon-encoded SCRs to those of
corresponding functional SCRs of human proteins were relatively
high at ⬎43% (Fig. 4, A and B). The divisions in their coding
1730
RCA LOCUS IN THE CHICKEN
regions occur at similar positions. Thus, it is likely that the split
exons in the chicken SCR proteins serve as functionally active
domains.
To identify cDNA clones covering full-length ORF for the
chicken SCR proteins, we designed PCR primers based on the
derived sequences (Table I). The primary structures of the three
RCA proteins predicted from the RT-PCR products offered that
CRES, CREG, and CREM consisted of 10 SCRs, 7 SCRs, and 5
SCRs with one SCR-like domain, respectively (Fig. 4C). The first
exons of all three genes contained signal sequences (Fig. 4; Ref.
11). CREG possessed a domain containing a GPI anchor-predicted
site and CREM had a TM and a cytoplasmic tail in their C termini,
respectively (Fig. 4; Ref. 11). Presence of the GPI anchor in CREG
was confirmed by octylglucoside solubilization and phosphatidylinositol phospholipase C treatment (data not shown). No specific
site for membrane attachment was identified in CRES, suggesting
its secretory features.
Domain-to-domain comparison was performed with CRES and
CREG vs human CR1, CR2, C4bp ␣-chain, DAF, and MCP (Fig.
4D). The sequential SCR2– 4 structure of CRES was most similar
to that of C4bp ␣-chain, which is the functional core (24, 25). The
SCR2– 4 of CRES was secondly similar to that of MCP, which is
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
FIGURE 5. Tissue distribution of CRES and CREG mRNA and protein. A, RNA expression of CRES, CREG, and CREM in various chicken tissues.
Total RNA (20 ␮g) from various tissues was separated by electrophoresis in a 1.0% (w/v) agarose gel, transferred to nylon membrane, hybridized with
corresponding 32P-labeled cDNA probe, and exposed to x-ray film. mRNA of CRES was detected as a 3.8-kb band predominantly in the liver and to lesser
extents in lung, kidney, and the bursa. Bottom panel, mRNA of CREM was detected as a doublet of 2.2 and 2.4 kb. Under the same conditions, mRNA
of CREG could not be detected. B, The presence of the CREG mRNA was confirmed by RT-PCR. CREG message was almost ubiquitously expressed
similar to CREM mRNA. CRES message was identified in a macrophage-like cell line HD11 but not in others. CREG message was identified in all cell
lines tested. C, Immunoblotting analysis of various chicken tissues using Abs against CRES (␣-CRES), CREG (␣-CREG), and CREM (␣-CREM). Proteins
(40 ␮g) solubilized from various tissues were separated by SDS-PAGE (7.5% gel) under nonreducing conditions and electroblotted. The blots were probed
with Abs against CRES, CREG, or CREM. The position of molecular mass markers is shown on the left side of the panel. The presence of these proteins
in chicken serum was also tested (right panel). The 170-kDa band (asterisks) is nonspecific because all lanes contained it (asterisks) and also lighted up
with nonimmune serum (data not shown). Chicken serum (right panel) exhibited high level of CRES. CREG and CREM are below the detection limit. The
position of the markers is shown to the right. D, FACS analysis of chicken blood cells using Abs against CRES, CREG, and CREM. The surface expressions
of CREG and CREM on mononuclear cells were confirmed. Erythrocytes also expressed CREG and CREM. CRES may directly bind some of these cells.
The Journal of Immunology
again the functional core (26, 27). Other SCR sets of CRES had no
marked similarity to SCR sets of human RCA proteins. Because
CRES is a secretory protein consisting of 10 SCRs, it would be an
orthologue of huC4bp. The sequential SCR1– 4 structure of CREG
periodically appeared in the structure of CR1 with significant similarity to SCR1– 4, SCR8 –11, SCR15–18, and SCR22–25, suggesting that CREG corresponds to one long homologous repeat
(LHR) of huCR1 (3, 28).
Tissue distribution of chicken SCR proteins
Protein expression of chicken RCA members
To determine the tissue distribution and relative levels of CRES/
CREG proteins, we produced polyclonal Abs against these proteins and performed immunoblotting analysis (Fig. 5C). In this
analysis, the lanes contained 50 ␮g of proteins released from tissues. CRES was detected only in the serum and organs rich in
plasma as a 50- to 70-kDa doublet band. Our findings suggest that
CRES was synthesized mainly in the liver and then secreted into
the systemic circulation. A two-band signal of CREG was detected
in various tissues by treatment of cells with octylglucoside. Predominance of the upper band species of CREG in ovary and the
two-band profile with faster mobility in the brain were significantly observed. Solubilized CREG protein had a molecular mass
of 52-to 62-kDa with quantitative variations in different tissues.
This indicates that the CREG was differentially spliced and/or glycosylated and expressed on the cell surface as a GPI-anchored
protein (Fig. 5C). CREM consisted of a 45-kDa major band and a
50-kDa minor band (Fig. 4C). The molecular masses of CREM
were small as in CREG in the brain compared with other organs.
CREM and CREG were distributed ubiquitously, except for the
serum.
FACS analysis indicated that erythrocytes and large/small leukocytes were all CREG- and CREM positive (Fig. 5D). Erythrocytes altered morphologically if the cells were treated with antiCREM Ab (Fig. 5D).
Complement protection assay using CREM/CREG/mCRESexpressing CHO cells
It is currently accepted that the chicken has the brusa of Fabricius
where B lymphocytes are generated through gene conversion. IgY
and IgN are effectors for C activation. Chicken possesses a structural and probably functional orthologue of human C3 (29). In our
primary test, no chicken C-mediated cytolysis was virtually observed on intact CHO cells using chicken Ig-containing chicken
serum, whereas chicken C was activated on rabbit IgG-sensitized
CHO cells even by chicken serum preabsorbed with intact CHO
cells (Fig. 6A). Therefore, we decided to use CHO cells or its
transfectants sensitized with rabbit Ab for C protection assay. To
determine whether the chicken RCA proteins have the ability to
protect host cells from attack by homologous C, we established
CHO cell clones stably expressing CREG or CREM. Because
CRES is a soluble protein, we generated a mCRES by attaching
TM and cytoplasmic portions of MCP to the C terminus of CRES.
We cloned a CHO subline expressing mCRES for this purpose
(Fig. 6B).
Chicken sera (5–20%) were used as C sources and rabbit antiCHO Ab-mediated CHO damage was tested using these CHO
clones expressing mCRES (Fig. 6B), CREG, or CREM (Fig. 6C).
Intact CHO cells served as control. Cytotoxicity assay was performed with calcein-labeled sensitized CHO cells. The assay was
performed at 39°C when using chicken serum (otherwise at 37°C).
Rabbit IgG sensitization of CHO cells conferred susceptibility to
chicken serum if the cells did not express chicken RCA protein(s).
The results demonstrated that chicken serum (10%) damaged IgGsensitized CHO cells, and the expression of CREG, CREM, or
mCRES on CHO cells blocked chicken-serum-mediated cytotoxicity (Fig. 6, B and C), which is similar to the case of human
serum-mediated cytotoxic studies using CHO cells expressing
MCP or DAF (4, 22, 27). IgG-sensitized CHO cells also showed
human C-mediated lysis and under the same conditions CHO/MCP
blocked human C-mediated attack by 20% while cells expressing
CHO/CREM or CHO/CREG barely blocked human C-mediated
lysis (Fig. 6D). These results indicate that chicken RCA proteins
exerted species specificity to block the attack by homologous C.
However, by which mode the C pathways of the chicken is most
efficiently blocked by each C regulator has not yet been identified
in this study because Ab sensitization allows the cells to activate
the classical (22), alternative (22), and possibly also lectin pathway
(30). We currently hold that CREG, CREM, and CRES all serve as
C regulators in the chicken body with different properties.
Discussion
We described here that CRES, CREG, and CREM compose
chicken RCA locus, which we suggest evolved from a putative
ancestral RCA locus common to the avian and mammalian. This is
the first identification of the RCA locus and proteins in nonmammals. Chicken harbors a single RCA locus encoding multiple C
regulatory proteins that correspond to the human. Human RCA is
a single locus while the mouse RCA consists of two splits (7–9).
Chicken RCA genes, CREM, CREG, and CRES, are located in a
single locus. Clone no. 54 encoded an SCR, which is similar to
SCR2 of huCR1. This, together with chicken genome draft search,
suggests that clone no. 54 is a part of a putative CR1-like protein
(T. Seya, unpublished data). The order of the genes, CREM (no.
54, CR1-like), CREG, and CRES, was principally overlapped with
those of human genes, MCP, CR1, DAF, and C4bp. Their structural features were made up of the hybrid or mixed SCR combinations compared with the human counterparts. In mice, two contiguous genes, Mcry and Mcr2, are mapped to the 40 cM telomeric
to C4bp on mouse chromosome 1 (9). Thus, they define a breakpoint in the large conserved linkage group between distal mouse
chromosome 1 and human chromosome 1q32. This suggested that
a translocation or inversion occurred within the mouse RCA gene
family during the oviparous-to-mammalian evolution. The
PFKFB2, which is not a member of the RCA group, was mapped
on the centromeric to Mcry and Mcr2 (9), supporting this hypothesis.
In addition, the soluble C regulator, Cres (or C4bp), is the most distal
member of the conserved linkage group thus far identified. Hence, the
gene clustering profile of the chicken but not mouse RCA appears to
reflect a prototype of the human RCA locus.
In humans, the factor H gene is located at ⬎7 Mbp from the
cluster of RCA gene family (1, 2). The fish and lamprey have
factor H orthologues (12, 31–33), which are functional as C regulators. That is, sand bass has factor H-like protein SBP1 (12, 13),
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
Tissue distribution of mRNAs of CRES, CREG, and CREM were
examined by Northern blot and RT-PCR analyses (Fig. 5, A and
B). RNA blotting followed by hybridization with the full-length
ORF of CRES or CREM as a probe revealed a single 3.8-kb band
predominantly in the liver and widely distributed 3.0/2.2-kb bands
among the other tissues examined (Fig. 5A). The trace messages of
CREG were detected in various organs after long exposure of the
film (data not shown). RT-PCR analysis also exhibited wide distribution of CREG in almost all tissues (Fig. 5B). Relative message
levels of CREG were generally low compared with those of
CREM. Clone no. 54 was also found to be a message with SCRcoding sequence (data not shown), but full-length cDNA could not
be obtained with primers used (Table I).
1731
1732
RCA LOCUS IN THE CHICKEN
which serves structural and functional orthologues of huFactor H.
Although sand bass has a putative additional SCR-containing protein, named sand bass cofactor related protein 1, it shares structural
similarity with SBP1 (31), and their relationship is similar to that
between factor H and its related proteins, factor H-related proteins
(31). In the fish, no other RCA orthologues have been identified.
However, in our database analysis, fish possesses soluble C4bplike SCR proteins (H. Oshiumi and T. Seya, unpublished data), and
the gene of this SCR protein is syntenic with fish PFKFB2. Nonetheless, this SCR protein did not grow into a multiple gene cluster
in the fish (T. Seya, unpublished data), suggesting that the origin
of the RCA locus consisted of a single gene encoding a soluble C
regulatory protein with 6 –10 SCRs and have evolved into multiple
genes with differential functional profiling, i.e., intrinsic and extrinsic regulation and prevention of C consumption in blood
plasma. Our findings favor the interpretation that SCR exon duplication and shuffling among RCA genes yielded the gene cluster
of SCR proteins. Only the SCR of split exons were conserved as
functional domains of these genes.
In humans, the RCA locus includes the six genes and two incomplete pseudogenes located within the 0.9-Mbp region. This
contains the RCA genes C4bp␣, C4bp␤, MCP, MCP-like, DAF,
CR1, CR2, and CR1-like (2, 4, 5). In contrast, the chicken RCA
locus was mapped within 0.1-Mbp in a microchromosome, which
is 9-fold narrower than that of humans. Yet, putative corresponding genes were mapped within this region, suggesting that the noncoding regions, including the introns and intergenic regions, are
small in chicken RCA compared with human RCA. Indeed, almost
all introns of CRES, CREG, and CREM were shorter than 1 kbp
(Fig 3). These are contrast to human introns, which are usually
more than several kilobase pairs long. Chicken MHC is also 10fold smaller compared with that of human (34). Thus, total immune-related locus would be compact in chicken. Our molecular
analysis of the gene described in this investigation unequivocally
predicts that the C-associated immune system and its responses in
mammals were preserved in the avian through evolution. Further
functional analyses of each SCR protein will give us more information about the relationship between the SCR proteins (35) and
their roles in the C regulatory system of chicken.
After completion of our study, chicken genome draft sequence
(36) was opened (具www.ensemble.org/典). Generally speaking,
draft sequence contains ambiguous regions and incorrect sequences, which are repeatedly updated. Using the last update version, we conducted a BLAST search with cDNA sequences of
chicken PFKFB2, CRES, CREG, and CREM and examined the
positions of the genes on chicken genome (Fig. 7). Our conclusion
is that the draft sequence supports our experimental data, and conversely, our data supports the draft sequence. However, we noticed
that there are serious inconsistencies between our data and the
chicken draft sequence (Fig. 7). A marked difference is that the genome region encoding CRES ORF is completely involved in the
predicted gene region encoding chicken PFKFB2 cDNA. More
precisely, draft sequence indicated that the PFKFB2 cDNA isolated by exon trapping is interrupted by two introns and thus consists of three exons. Pulse-field gel electrophoresis data (Fig. 2) did
not support the results from the draft sequence. Considering that
RCA locus contains many similar exons encoding SCR domains,
the discrepancy seems to be explained by incorrect assembly
caused by sequence similarity of this region. Prediction of exon/
intron boundaries is usually very difficult without any experimental
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
FIGURE 6. Protection of host cells by chicken C regulatory proteins. A, Rabbit Ab sensitization is essential to induce chicken C-mediated CHO cell
lysis. Intact CHO cells, either unsensitized or sensitized with rabbit anti-CHO Ab, were incubated with chicken serum diluted as indicated. Chicken serum
removed natural Ab reacting with CHO cells was prepared as described previously (11). The absorbed serum was used as a chicken C source to test the
effect of the natural Ab on chicken C-mediated CHO lysis. One of the three experiments is shown. B, A mCRES protects host CHO cells from chicken
C-mediated lysis. CHO cells expressing mCRES (CHO/mCRES) were prepared as described in Materials and Methods. A CHO/mCRES clone with mean
fluorescence intensity 22.4 was chosen for cell protection assay. CHO/mCRES or intact CHO cells (CHO/cont.) were sensitized with rabbit Ab and
incubated with 5–20% chicken serum. Chicken C-mediated cytolysis was determined using calcein release cytotoxicity assay. Percent cytotoxicity was
calculated as described in Materials and Methods. Intact CHO cells with rabbit Ab were susceptible to chicken C-mediated lysis. Under the same conditions,
CHO/mCRES cells were resistant to cytolysis. One of the three experiments is shown. C and D, CREG and CREM protect host-sensitized cells from
homologous C. CREG or CREM was stably expressed on CHO cells. Ab-sensitized CHO cells were used as a positive control. A native CHO cell was
used as a negative control (䉬). CHO cell clones expressing human MCP (u), CREG (E), or CREM (Œ) were sensitized and used in this study. CHO clones
with ⬃20 mean fluorescence intensity were chosen for this experiment. Calcein release cytotoxicity assay was performed with native CHO, CHO/CREG,
CHO/CREM, and CHO/MCP. Cells were incubated with 5–20% of chicken (C) or human serum (D) in GVB⫹⫹. Percent cytotoxicity was calculated as
described previously (11). Experiments were performed three times in triplicate, and representative data are given. The values represent means ⫾ SD (ⴱ,
two-tailed p value calculated was ⬍0.02).
The Journal of Immunology
data, and each prediction program often shows different results.
These points, taken together with the unidentified structures predicted by the draft sequence (Fig. 7) located near the PFKFB2 but
distinct from CRES, CREM, and CREM, reinforce the importance
of our experimental data to convince the existence of chicken
RCA. Correct assembling of the scaffolds in the draft sequence and
annotation of the genes will be required to complete the RCA
region of the chicken genome.
CRES was a secretory protein consisting of 10 SCRs; its SCRs
1– 4 had a framework similar to that of the ␣-chain of C4bp. The
functional SCR set of huC4bp ␣ is SCR2–3, which contained a
SCR encoded by a split exon similar to CRES (2, 31). Our preliminary data suggested that this protein served as a protease (presumably factor I-like)-cofactor for the cleavage of chicken C3blike protein (T. Seya, unpublished data) that resembled one
reported previously (29). Earlier studies by Kaidoh et al. (37, 38)
suggested the presence of factor I-cofactor activity toward human
C3b in birds, including the chicken. However, no divalent cation
was required to cleave human C3b-like C3 by the serum protease.
This SCR protein was similar to the human C regulatory system
but dissimilar to the lamprey system (14). CRES may represent a
soluble SCR-containing C regulatory protein that evolved to
huC4bp.
CREG, a GPI-anchored membrane protein, consisted of seven
SCRs with relatively high similarity to MCRY and a LHR of CR1
(7, 28). Therefore, the gene encoding “7 SCR” unit, designated
LHR that compose CR1 and MCRY, seems to exist in the common
ancestral animal genome. Likewise, GPI appears to have developed in SCR-containing proteins with host protection properties
from C. So far, no CR1-like protein with seven SCRs has been
reported, except CREG and MCRY. CREG has the ability to protect host cells from chicken C, and the species specificity between
C and its regulators exists in the chicken C system. CREG may
serve as the molecular predecessor for the previously reported
functional entities of the self-protective C regulatory proteins in
mammals. It may represent the earlier form of MCRY (7). Therefore, it is very likely that another yet to be further defined protein
has opsonin activity through its ability to bind C3b deposited on
foreign material in chicken. Possibly clone no. 54 may be a part of
a bigger SCR protein, presumably chCR1.
C2, C3, factor B, MBL, and MASP have been identified as
chicken C-related proteins (29, 39 – 41). Chicken has a system of
gene conversion conferring B cell clonal variation on huge variation of Ig in the bursa of Fabricius (42). This means that chicken
possesses multifarious C pathways similar to human. The RCA
family could be expanded in coordination with the divergence of
the C cascades. The tantalizing question is why multiple SCR proteins with differential structures and presumably functions diverged during the evolution from fish to birds. Shift of the lifestyle
from the sea to the land might have been a crucial event for providing the sophisticated C regulatory system. Yet, what had happened at that stage needs additional investigation.
The pattern recognition systems of TLRs (43), phagocytosis receptors, and C-type lectins aiming at microbial and interspecies
recognition to eliminate foreign materials are becoming clear with
recent advance in studies on innate immunity. Acquired immune
system appears to have emerged based on the necessity to precisely discriminate between self- and nonself-Ags, leading to immunological consolidation of individual identity. Coupling this to
the change of innate-acquired interface, the C system evolved to
adapt the two differential modes of immune system for foreign cell
recognition and consequent elimination. Our hypothesis is that
many RCA proteins were developed from a single C regulator with
the primitive function, concomitantly evolving in higher vertebrates. Perhaps, the differential functional assignment to each RCA
protein started before birds and mammals diverged from the fish.
Additional phylogenic studies using amphibians and reptiles and
functional studies of each RCA protein in these lower vertebrates
will test this hypothesis.
Acknowledgments
We are grateful to Drs. A. Fukui, K. Funami, M. Shingai, M. Tanabe
(Osaka Medical Center for Cancer, Osaka, Japan), M. Okabe, and N. Inoue
(Osaka University, Osaka, Japan) for technical supports. We also thank
Drs. M. Nonaka (University of Tokyo, Tokyo, Japan), T. Fujita (Fukushima Medical University, Fukushima, Japan), M. Matsushita (Tokai University, Sagami, Japan), and T. Kinoshita (Osaka University) for helpful
discussions.
Disclosures
The authors have no financial conflict of interest.
References
1. Law, S. K. A., and K. B. M. Reid. 1993. Complement. IRL Press, Oxford, U.K.
2. Morgan, B. P., and C. L. Harris. 1998. Complement Regulatory Proteins, Vol. 41.
Academic Press, San Diego, pp. 1– 48.
3. Ahearn, J. M., and D. T. Fearon. 1989. Structure and function of the C receptors,
CR1 (CD35) and CR2 (CD21). Adv. Immunol. 46: 183–219.
4. Liszewski, M. K., T. W. Post, and J. P. Atkinson. 1991. Membrane cofactor
protein (MCP or CD46): newest member of the regulators of complement activation gene cluster. Annu. Rev. Immunol. 9: 431– 455.
5. Carroll, M. C., E. M. Alicot, P. J. Katzman, L. B. Klickstein, J. A. Smith, and
D. T. Fearon. 1988. Organization of the genes encoding complement receptors
type 1 and 2, decay-accelerating factor, and C4-binding protein in the RCA locus
on human chromosome 1. J. Exp. Med. 167: 1271–1280.
6. Heine-Suner, D., M. A. Diaz-Guillen, F. P. de Villena, M. Robledo, J. Benitez,
and S. Rodriguez de Cordoba. 1997. A high-resolution map of the regulator of the
complement activation gene cluster on 1q32 that integrates new genes and markers. Immunogenetics 45: 422– 427.
7. Holers, V. M., T. Kinoshita, and H. Molina. 1992. The evolution of mouse and
human complement C3-binding proteins: divergence of form but conservation of
function. Immunol. Today 13: 231–236.
8. Rey-Campos, J., P. Rubinstein, and S. Rodriguez de Cordoba. 1988. A physical
map of the human genes coding for complement activation gene cluster linking
the complement genes CR1, CR2, DAF, and C4bp. J. Exp. Med. 167: 664 – 669.
9. Kingsmore, S. F., D. P. Vik, C. B. Kurtz, P. Leroy, B. F. Tack, J. H. Weis, and
M. F. Seldin. 1989. Genetic organization of complement receptor-related genes in
the mouse. J. Exp. Med. 169: 1479 –1484.
10. Gewurz, H., J. Finsted, L. H. Mushel, and R. A. Good. 1990. Phylogenetic inquiry into the origins of complement system. In Phylogeny of Immunity.
R. T. Smith, P. A. Miescher. and R. A. Good, eds. University of Florida Press,
Gainesville, FL, pp. 105–117.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
FIGURE 7. BLAST searches for the putative RCA region in chicken
draft sequence. For BLAST search analyses, we used partial cDNA sequence of chicken PFKFB2 and complete ORF sequences of CRES,
CREG, and CREM. Except for a “predicted gene,” black rectangles show
genome regions that hit on BLAST search analyses. A black rectangle of
a predicted gene indicates predicted exons by Ensemble projects. Arrows
indicate gene directions. Gene configuration is similar to that determined
by pulse-field gel electrophoresis analysis. Ensemble projects predict various types of structures of genes near PFKFB2. One typical gene structure
is depicted.
1733
1734
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
the complement system to ligand binding and cofactor activity. J. Immunol. 147:
3005–3011.
Iwata, K., T. Seya, Y. Yanagi, J. M. Pesando, P. M. Johnson, M. Okabe, S. Ueda,
H. Ariga, and S. Nagasawa. 1995. Diversity of the sites for measles virus infection and for inactivation of complement C3b and C4b on membrane cofactor
protein (MCP, CD46). J. Biol. Chem. 270: 15148 –15152.
Klickstein, L. B., W. W. Wong, J. A. Smith, J. H. Weis, J. G. Wilson, and
D. T. Fearon. 1987. Human C3b/C4b receptor (CR1). Demonstration of long
homologous repeating domains that are composed of the short consensus repeats
characteristics of C3/C4 binding proteins. J. Exp. Med. 165: 1095–1112.
Mavroidis, M., J. O. Sunyer, and J. D. Lambris. 1995. Isolation, primary structure, and evolution of the third component of chicken complement and evidence
for a new member of the ␣2-macroglobulin family. J. Immunol. 154: 2164 –2174.
Fujita, T. 2002. Evolution of the lectin-complement pathway and its role in innate
immunity. Nat. Rev. Immunol. 2: 346 –353.
Kemper, C., I. Gigli, and P. F. Zipfel. 2000. Conservation of plasma regulatory
proteins of the complement system in evolution: humans and fish. Exp. Clin.
Immunogenet. 17: 55– 62.
Krushkal, J., C. Kemper, and I. Gigli. 1998. Ancient origin of human complement
factor H. J. Mol. Evol. 47: 625– 630.
Fujita, T. 2004. Factor H-like protein in lamprey. Jpn. Complement Soc. 41:
21–22.
Kaufman, J., S. Milne, T. W. Gobel, B. A. Walker, J. P. Jacob, C. Auffray,
R. Zoorob, and S. Beck. 1999. The chicken B locus is a minimal essential major
histocompatibility complex. Nature 401: 923–925.
Krushkal, J., O. Bat, and I. Gigli. 2000. Evolutionary relationships among proteins encoded by the regulator of complement activation gene cluster. Mol. Biol.
Evol. 17: 1718 –1730.
Hillier, L. W., W. Miller, E. Birney, W. Warren, R. C. Hardison, C. P. Ponting,
P. Bork, D. W. Burt, M. A. Groenen, M. E. Delany, et al. 2004. Sequence and
comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution. [Published erratum appears in 2005 Nature 433: 777.] Nature
432: 695–716.
Kaidoh, T., and I. Gigli. 1987. Phylogeny of C4b-C3b cleaving activity: similar
fragmentation patterns of human C4b and C3b produced by lower animals. J. Immunol. 139: 194 –201.
Kaidoh, T., and I. Gigli. 1989. Phylogeny of regulatory proteins of the complement system. Isolation and characterization of a C4b/C3b inhibitor and a cofactor
from sand bass plasma. J. Immunol. 142: 1605–1613.
Kjalke, M., K. G. Welinder, and C. Koch. 1993. Structural analysis of chicken
factor B-like protease and comparison with mammalian complement proteins
factor B and C2. J. Immunol. 151: 4147– 4152.
Koch, C. 1986. The alternative complement pathway in chickens: purification of
factor B and production of a monospecific antibody against it. Acta Pathol. Microbiol. Immunol. Scand. [C] 94: 253–259.
Laursen, S. B., and O. L. Nielsen. 2000. Mannan-binding lectin (MBL) in chickens: molecular and functional aspects. Dev. Comp. Immunol. 24: 85–101.
McCormack, W. T., L. W. Tjoelker, and C. B. Thompson. 1991. Avian B cell
development: generation of an immunoglobulin repertoire by gene conversion.
Annu. Rev. Immunol. 9: 219 –241.
Oshiumi, H., T. Tsujita, K. Shida, M. Matsumoto, K. Ikeo, and T. Seya. 2003.
Prediction of the prototype of the human Toll-like receptor gene family from the
Pufferfish Fugu. rubripes genome. Immunogenetics 54: 791– 800.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
11. Inoue, N., A. Fukui, M. Nomura, M. Matsumoto, Y. Nishizawa, K. Toyoshima,
and T. Seya. 2001. A novel chicken membrane-associated complement regulatory
protein: molecular cloning and functional characterization. [Published erratum
appears in 2001 J. Immunol. 167: 3530.] J. Immunol. 166: 424 – 431.
12. Dahmen, A., T. Kaidoh, P. F. Zipfel, and I. Gigli. 1994. Cloning and characterization of a cDNA representing a putative complement-regulatory plasma protein
from barred sand bass (Parablax neblifer). Biochem. J. 301(Pt. 2): 391–397.
13. Kemper, C., P. F. Zipfel, and I. Gigli. 1998. The complement cofactor protein
(SBP1) from the barred sand bass (Paralabrax nebulifer) mediates overlapping
regulatory activities of both human C4b binding protein and factor H. J. Biol.
Chem. 273: 19398 –193404.
14. Kimura, Y., N. Inoue, A. Fukui, H. Oshiumi, M. Matsumoto, M. Nonaka,
S. Kuratani, T. Fujita, M. Nonaka, and T. Seya. 2004. A short consensus repeatcontaining complement regulatory protein of Lamprey, which participates in
cleavage of lamprey C3. J. Immunol. 173: 1118 –1128.
15. Kato, J., T. Hattori, S. Ohba, Y. Tamaki, N. Yamada, T. Taguchi, J. Ogihara,
K. Ohya, Y. Itoh, T. Hori, et al. 2002. Efficient selection of genomic clones from
a female chicken bacterial artificial chromosome library by four-dimensional
polymerase chain reactions. Poult. Sci. 81: 1501–1508.
16. Goitsuka, R., Y. Fujimura, H. Mamada, A. Umeda, T. Morimura, K. Uetsuka,
K. Doi, S. Tsuji, and D. Kitamura. 1998. BASH, a novel signaling molecule
preferentially expressed in B cells of the bursa of Fabricius. J. Immunol. 161:
5804 –5808.
17. Eisenhaber, B., P. Bork, and F. Eisenhaber. 1998. Sequence properties of GPIanchored proteins near the omega-site: constraints for the polypeptide binding
site of the putative transamidase. Protein Eng. 11: 1155–1161.
18. Nielsen, H., J. Engelbrecht, S. Brunak, and G. von Heijne. 1997. Identification of
prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites.
Protein Eng. 10: 1– 6.
19. Matsuda, Y., and V. M. Chapman. 1995. Application of fluorescence in situ
hybridization in genome analysis of the mouse. Electrophoresis 16: 261–272.
20. Suzuki, T., T. Kurosaki, K. Shimada, N. Kansaku, U. Kuhnlein, D. Zadworny,
K. Agata, A. Hashimoto, M. Koide, M. Koike, et al. 1999. Cytogenetic mapping
of 31 functional genes on chicken chromosomes by direct R-banding FISH. Cytogenet. Cell Genet. 87: 32– 40.
21. Seya, T., K. Nakamura, T. Masaki, C. Ichihara-Itoh, M. Matsumoto, and
S. Nagasawa. 1995. Human factor H and C4b-binding protein serve as factor
I-cofactors both encompassing inactivation of C3b and C4b. Mol. Immunol. 32:
355–360.
22. Kojima, A., K. Iwata, T. Seya, M. Matsumoto, H. Ariga, J. P. Atkinson, and
S. Nagasawa. 1993. Membrane cofactor protein (CD46) protects cells predominantly from alternative complement pathway-mediated C3-fragment deposition
and cytolysis. J. Immunol. 151: 1519 –1527.
23. Schmid, M., I. Nanda, M. Guttenbach, C. Steinlein, M. Hoehn, M. Schartl,
T. Haaf, S. Weigend, R. Fries, J. M. Buerstedde, et al. 2000. First report on
chicken genes and chromosomes 2000. Cytogenet. Cell Genet. 90: 169 –218.
24. Blom, A. M., B. O. Villoutreix, and B. Dahlback. 2003. Mutations in ␣-chain of
C4BP that selectively affect its factor I cofactor function. J. Biol. Chem. 278:
43437– 43442.
25. Fukui, A., T. Yuasa, Y. Murakami, K. Funami, N. Kishi, T. Matsuda, T. Fujita,
T. Seya, and S. Nagasawa. 2002. Mapping the sites responsible for factor I-cofactor for cleavage of C3b and C4b on human C4b-binding protein by deletion
mutagenesis. J. Biochem. 132: 719 –728.
26. Adams, E. M., M. C. Brown, M. Nunge, M. Krych, and J. P. Atkinson. 1991.
Contribution of the repeating domains of membrane cofactor protein (CD46) of
RCA LOCUS IN THE CHICKEN