Download Localization of a blood pressure QTL on rat chromosome 1 using

Localization of a blood pressure QTL on rat
chromosome 1 using Dahl rat congenic strains
YASSER SAAD, MICHAEL R. GARRETT, SOON JIN LEE,
HOWARD DENE, AND JOHN P. RAPP
Department of Physiology and Molecular Medicine,
Medical College of Ohio, Toledo, Ohio 43614-5804
Sa gene; genetic hypertension; salt-sensitive hypertension;
cardiac hypertrophy
GENETIC MARKERS on rat chromosome (chr) 1 have been
shown to be genetically linked to blood pressure in
genetic crosses involving spontaneously hypertensive
rats (SHR; 12, 14, 15, 17, 20, 22, 27), Dahl salt-sensitive
(S) rats (5, 7, 9), Sabra hypertensive (SBH) rats (30), or
fawn-hooded rats (FHR) (2). In all these studies the
alleles from the hypertensive strain were associated
with increased blood pressure, and the alleles from the
normotensive strain were associated with lower blood
pressure.
Linkage analysis for quantitative traits such as blood
pressure yields only a very approximate localization of
the locus controlling the trait (quantitative trait locus,
QTL). Further analysis usually takes the form of
construction of a congenic strain whereby a chromosomal segment from one strain (donor) is introgressed
into another strain (recipient) by a backcross breeding
scheme. If a variant allele for a blood pressure QTL is
present in the chromosomal segment moved, then the
resulting congenic strain will have a blood pressure
different from the recipient strain. The congenic strategy is critical to 1) confirm or refute initial linkage
analysis, and 2) provide better chromosomal localiza-
Received 19 April 1999; accepted in final form 5 August 1999.
Article published online before print. See web site for date of
publication (http://physiolgenomics.physiology.org).
tion of the QTL by construction of congenic substrains
with progressively smaller introgressed chromosomal
segments (25).
We had previously constructed a congenic strain
introgressing a large segment of chr 1 from Lewis
(LEW) rats into Dahl S rats (5). In agreement with the
linkage analysis using S and LEW (7) the introgressed
LEW segment lowered blood pressure in the congenic
strain compared with S rats. In the present work
congenic substrains were constructed and an improved
localization of a blood pressure QTL near the center of
chr 1 was obtained.
Our initial congenic strain included the Sa gene,
which has been proposed as a candidate for influencing
blood pressure in SHRs. The Sa gene was discovered by
Iwai and Inagami (13) in a screening procedure to
detect genes differentially expressed in the kidneys of
SHR and Wistar-Kyoto rats (WKY). SHR kidney expressed higher Sa mRNA levels compared with WKY. It
was subsequently found that the Sa gene is mainly
expressed in the renal proximal tubule (23, 31). The
term Sa is arbitrary, and the function of the gene
product is unknown. Polymorphisms in the Sa gene
were also shown to cosegregate with its differential
expression in a population derived from SHR and WKY
(27), with the higher expression being associated with
the SHR allele. The present work, however, excludes
the Sa gene as a candidate for effects on blood pressure
in the Dahl S vs. LEW strain comparison because the
Sa locus is outside of the newly defined QTL region but
was included in a congenic region that had no effect on
blood pressure.
MATERIALS AND METHODS
Strains. Inbred Dahl salt-sensitive (SS/Jr) and Dahl saltresistant (SR/Jr) strains, respectively designated S and R,
were from our colony. Lewis rats (LEW/NCrlBR) were obtained from Charles River Laboratories (Wilmington, MA)
and are referred to as LEW. Spontaneously hypertensive rats
(SHR/NHsd), referred to as SHR, Brown Norway (BN), and
WKY were obtained from Harlan-Sprague-Dawley (Indianapolis, IN). The Milan normotensive strain (MNS) originated
from the Veterinary Resources Branch at the National Institutes of Health (Bethesda, MD), and Albino Surgery (AS) rats
were from the National Institute for Medical Research (Mill
Hill, UK). The congenic substrains, Chr1 ⫻ 3, Chr1 ⫻ 7,
Chr1 ⫻ 8, Chr1 ⫻ 14 and Chr1 ⫻ 15 were derived from the
original congenic strain, S.LEW(chr 1), developed earlier by
introgressing a large segment of chr 1 from LEW rats into the
S rat (5). To obtain the congenic substrains, the S.LEW(chr 1)
congenic was crossed to the S strain to yield F1 rats that were
1094-8341/99 $5.00 Copyright r 1999 the American Physiological Society
119
Downloaded from http://physiolgenomics.physiology.org/ by 10.220.33.4 on June 14, 2017
Saad, Yasser, Michael R. Garrett, Soon Jin Lee,
Howard Dene, and John P. Rapp. Localization of a blood
pressure QTL on rat chromosome 1 using Dahl rat congenic
strains. Physiol. Genomics 1: 119–125, 1999.—We previously
reported that markers on rat chromosome 1 are genetically
linked to blood pressure in an F2 population derived from
Dahl salt hypertension-sensitive (S) and Lewis (LEW) rats.
Because there was evidence for more than one blood pressure
quantitative trait locus (QTL) on chromosome 1, an initial
congenic strain introgressing a large 118-centimorgan (cM)
segment of LEW chromosome 1 into the S background had
been constructed. This initial congenic strain had a reduced
blood pressure compared with S rats, proving the existence of
a blood pressure QTL, but not giving a good localization of the
QTL. In the present work a series of five overlapping congenic
substrains were produced from the original congenic strain in
order to localize a blood pressure QTL to a 25-cM region near
the center of chromosome 1. The congenic substrains also
ruled out the Sa locus as a blood pressure QTL in the S vs.
LEW comparison because the Sa locus was contained in a
congenic substrain that did not alter blood pressure.
120
RAT CHROMOSOME 1 BLOOD PRESSURE QTL
Northern analysis was done with 30 µg of total RNA using
standard techniques. Hybridization of filters was done at
42°C using a partial Sa cDNA fragment, bases 1204–1890 of
the published sequence (7, 13), labeled with 32P using the
RadPrime DNA labeling system (Life Technologies, Gaithersburg, MD). The filter was also hybridized to 32P-labeled
glyceraldehyde 3-phosphate dehydrogenase (G3PDH) to normalize for loading differences among the samples. The G3PDH
fragment used as a probe was obtained by PCR amplification
of rat genomic DNA using primers from Life Technologies
(sense CCATGGAGAAGGCTGGG and antisense CAAAGTTGTCATGGATGACC).
Quantitative analysis of Sa gene expression. Sa mRNA
levels were quantitated using a Hewlett-Packard Scan Jet 3C
scanner and NIH Image 1.61 software (Biomedical Magnetic
Resonance Laboratory, University of Illinois at UrbanaChampaign). Quantitation was done on the same filter at
different time exposures to ensure that the values obtained
were not obtained from an overexposed X-ray film. Both Sa
and G3PDH mRNA levels were quantitated, and the ratio of
Sa to G3PDH was taken for purposes of normalization. The
quantitative results obtained from S, Chr1 ⫻ 7, and SHR
(each with n ⫽ 5) were analyzed using SPSS programs
(Chicago, IL). A one-way analysis of variance (ANOVA) and a
Bonferroni post hoc test (28) were done on the Sa-to-G3PDH
ratios to determine significance of the Sa mRNA expression
among the three strains tested.
RESULTS
Genetic markers. To improve the rat chromosome 1
genetic map, nine new microsatellite markers were
identified from chromosome-sorted DNA and linked to rat
chromosome 1 (Table 1). In addition, 53 markers from the
rat genome project (http://www.genome.wi.mit.edu) that
are polymorphic between S and LEW were also placed on
our genetic map of chromosome 1. An improved map of rat
chromosome 1 based on the F2(S ⫻ LEW) cross is given in
Fig. 1.
Congenic substrains. Figure 1 shows the chromosomal segments derived from the LEW strain that were
introgressed into the genetic background of the S
strain. The original congenic, S.LEW(chr1), had a
118-centimorgan (cM) segment introgressed from LEW
rats spanning from the D1Mco2 to the D1Mco35 markers. Five congenic substrains with shorter introgressed
segments were constructed from the original congenic
strain in order to better localize the blood pressure
QTL. Congenic substrains that lacked the Sa gene
region included Chr1 ⫻ 3, which had a 57-cM introgressed LEW segment spanning from D1Mco2 to
D1Rat49, and Chr1 ⫻ 14, which had a 40-cM introgressed segment from D1Mco2 to D1Wox6. Congenic
substrains that contained the Sa gene region included
Chr1 ⫻ 7, Chr1 ⫻ 8, and Chr1 ⫻ 15, which carried
differential segments of 43 cM spanning from D1Rat45
to D1Mco41, 71 cM from D1M7Mit87 to D1Mco41,
and 43 cM from D1Rat42 to D1Wox10, respectively.
Subsequent genotyping with newly linked markers
showed that Chr1 ⫻ 14 carried a 2.5-cM residual
segment centered around D1Mco41, and that Chr1 ⫻ 8
was segregating in the region between D1Mco38 and
D1Mco36. The residual segment in Chr1 ⫻ 14 and the
segregating region in Chr1 ⫻ 8 went undetected due to
http://physiolgenomics.physiology.org
Downloaded from http://physiolgenomics.physiology.org/ by 10.220.33.4 on June 14, 2017
heterozygous for the original introgressed chromosomal segment. F1 rats were intercrossed to obtain F2 rats that were
genotyped for markers in the congenic segment to look for
recombinants. Rats with appropriate recombinant chromosomes were crossed to S again to duplicate the recombinant
chromosome. The offspring were genotyped to select rats
retaining the desired recombinant region. Two rats with the
same recombinant chromosomal segment were crossed and
the litters were genotyped to obtain rats that were homozygous throughout the recombinant region of interest. The
homozygous rats were crossed to fix the recombinant chromosomal segment in a new congenic substrain.
Genotyping. DNA was extracted from a tail biopsy using
the QIAamp tissue kit (Qiagen, Valencia, CA). PCR genotyping with microsatellite markers was done as described earlier
(7). Markers for the Sa gene were developed previously (8);
the Sa marker used is D1Mco13, previously called PSA1.
Blood pressure determination. We employed an experimental design in which the blood pressure of a congenic strain was
compared only to its own separate group of control S rats that
were bred, housed, and studied concomitantly. Rats were
weaned at 30 days of age to low salt (0.3% NaCl) Harlan
Teklad diet 7034 (Madison, WI). Twenty male congenic substrain rats were matched by age and weight with twenty male
S control rats and were caged in 10 cages; each cage contained
two congenics and two S rats. At 40–42 days of age, the rats
were fed a 2% NaCl Harlan Teklad diet (TD94217) for 24
days. Systolic blood pressure was measured using the tail-cuff
method on conscious restrained rats warmed to 28°C. The
operator did not know the identity of the rat during these
measurements. Blood pressure was measured on each rat
once a day for four consecutive days. The blood pressure value
of each day was the average of three to four consistent
readings. The final blood pressure value used was the averaged blood pressure value of the 4 days. Rats were killed with
CO2, and body and heart weights were measured. Statistical
analysis was done using programs from SPSS (Chicago, IL).
Heart weight. To corroborate the blood pressure data, heart
weight was evaluated in two ways: heart weight-to-body
weight ratio and heart weight adjusted for body weight.
Heart weight-to-body weight ratio has been criticized because
it is valid only if the regression of heart weight on body weight
passes through the origin (1). In the present experiments
such regression lines did pass through the origin in all but
one case (Chr1 ⫻ 14). We have therefore also calculated heart
weight adjusted for body weight using the regression equation relating heart and body weight (28) if the body weights
differed between S and a congenic strain.
Marker development. Microsatellite markers were identified using chromosome 1-sorted DNA as previously described
(7, 10), except that the reamplification of the chromosomesorted DNA was done using Cloned Pfu DNA polymerase from
Stratagene (La Jolla, CA) and the PCR products were directly
ligated using the zero blunt PCR cloning kit from Invitrogen
(San Diego, CA). Clones were screened for CA and CT
repeated elements and sequenced using the Thermo Sequenase radiolabeled terminator cycle sequencing kit from
Amersham (Arlington Heights, IL). Newly developed markers were placed on the chromosome 1 map by genotyping 92
rats from our previously used F2(S ⫻ LEW) population of 151
rats. The chromosome 1 map was constructed using the
MAPMAKER/EXP program (19) (http://www.genome.wi.
mit.edu/ftp/distribution/mapmaker3/).
RNA analysis. Kidneys were obtained from 42-day-old
male rats fed 0.3% NaCl Teklad rat chow. RNA was extracted
from whole kidney homogenate using the Ultraspec-II RNA
isolation system from Biotecx Laboratories (Houston, TX).
121
RAT CHROMOSOME 1 BLOOD PRESSURE QTL
Table 1. New rat microsatellite markers for rat chromosome 1
GenBank
No.
D1Mco33
AF093272
AGGAAGCTCCAGTGGTTGG
CTTAAGGCAATGGGGAGTCA
196
D1Mco34
AF093273
ATAAAATAAGAGTTTCTAAA
CTAAGCTGGATTACAGG
193
D1Mco35
AF093274
TGCCTAATATTCAGGGAGGTAGAG
GATCCGCTCAGCAGAAGGAGA
186
D1Mco36
AF093287
AGTGTCATTGGCCTACTGTCAGGT
GGAAGATGATGATTGCAGTTGTGA
467
D1Mco37
AF093275
TGCAGAGTATTCTTGTATGAAA
TTTAACCAGAGCTTTGACAATA
376
D1Mco38
AF093278
AATTCTTCGACTTGGATGATA
CTTGCAGGTGGTAACTAACA
185
D1Mco39
AF093279
ACCACTAGATACAACTCAGGAAT
CGGTAGTAGTATGTAGTATGTTGG
148
D1Mco40
AF093280
ATGCAGAATATGTTTGAGAGTGT
TAGGGAGTAAGATAGGCAGGTGT
231
D1Mco41
AF093289
AGAAGAAAGGAAGGCCCAGATG
CCTCTGCCGTGTGCATTCTC
290
Primer 1
Primer 2
Product
Size, bp*
Strain Polymorphisms
R ⫽ AS ⬎ S ⫽ BN ⬎ MNS ⫽ SHR ⫽
WKY ⬎ LEW
WKY ⫽ SHR ⬎ S ⫽
R ⫽ AS ⫽ MNS ⫽ BN ⬎ LEW
S ⫽ R ⫽ MNS ⬎ LEW ⫽ AS ⫽
SHR ⬎ WKY
LEW ⫽ BN ⬎ S ⫽ R ⫽ WKY ⫽ AS ⫽
SHR ⫽ MNS
WKY ⫽ SHR ⬎
S ⬎ R ⬎ LEW ⫽ MNS ⫽ BN ⬎ AS
SHR ⬎ WKY ⬎ BN ⬎
LEW ⫽ AS ⬎ S ⬎ R ⫽ MNS
BN ⬎ LEW ⫽ AS ⫽ MNS ⬎
SHR ⬎ S ⫽ WKY ⫽ R
LEW ⫽ BN ⬎ S ⫽
R ⫽ WKY ⫽ AS ⫽ SHR ⫽ MNS
SHR ⬎ S ⫽ WKY ⫽ R ⫽
MNS ⬎ LEW ⫽ AS
Strain polymorphism column shows relative sizes of PCR products among 8 strains tested. Rat strains: S, Dahl salt-sensitive; R, Dahl
salt-resistant; AS, albino surgery; BN, brown Norway; MNS, Milan normotensive strain; SHR, spontaneously hypertensive rats; WKY,
Wistar-Kyoto; LEW, Lewis. * Sizes of PCR products given are for sequencing data obtained from cloned chromosome-sorted DNA originating
from a random-bred Wistar rat (10).
the lack of markers in those regions at the time of
congenic substrain construction. The rats used for
blood pressure determination were tested retrospectively using newly developed markers in the segregating region of Chr1 ⫻ 8. Of 20 rats from Chr1 ⫻ 8 used in
blood pressure determination, 14 were homozygous for
the LEW alleles from D1Mco38 to D1Mco36 and 6 were
heterozygous between S and LEW in this region. Excluding the segregating rats from the statistical analysis
did not have a meaningful effect on the blood pressure
results or on the other variables tested using this
congenic substrain, so all 20 rats from Chr1 ⫻ 8 were
used in the analysis.
The effect of the introgressed segments on blood
pressure, body weight, and heart weight. Figure 1 and
Table 2 show the effects of the congenic strains on blood
pressure and heart weight. Other variables measured
included body weight, heart weight, and the heart
weight-to-body weight ratio (Table 2). A significant
blood pressure-lowering effect ranging from 23 ⫾ 5.0 to
38 ⫾ 3.5 mmHg was observed among some of the
congenic substrains compared with S rats. The same
congenic substrains also showed a lowering effect on
heart weight ranging from 49 ⫾ 19.8 to 133 ⫾ 18.6 mg.
Two congenic substrains, Chr1 ⫻ 7 and Chr1 ⫻ 15, did
not show a significant blood pressure effect compared
with the control S rats. The heart weight effect observed was not significant for Chr1 ⫻ 7, whereas
Chr1 ⫻ 15 showed a significant increase in heart
weight. The body weight effects observed among the
congenic substrains were not significant except for
Chr1 ⫻ 14 and Chr1 ⫻ 15, which showed a significant
increase in body weight of 13 ⫾ 3.5 and 10 ⫾ 4.2 g,
respectively, compared with the control S rats.
Sa gene expression. Figure 2 and Table 3 show
differences in the level of Sa gene expression among the
strains SHR, S, and the congenic substrain Chr1 ⫻ 7
(containing the LEW strain Sa allele on the S background). Sa gene expression was ⬃10-fold higher in S
than in Chr1 ⫻ 7. For comparative purposes, we also
looked at the expression levels in the S vs. SHR. Sa
gene expression was approximately 2.5- to 3.0-fold
higher in SHR than in S (Fig. 2 and Table 3).
DISCUSSION
Linkage analysis at best identifies only a broad
chromosomal region harboring a QTL influencing blood
pressure. Proof that a QTL is real involves construction
of an initial congenic strain to prove or disprove the
actual existence of the QTL. The initial congenic strain
should encompass a large chromosomal segment to
ensure trapping a contrasting QTL allele if it is present
in the donor strain. Such a large congenic region may
contain one or more QTL. Further localization of the
blood pressure QTL involves fine genetic mapping of
the region of interest using congenic substrains containing introgressed segments of varying sizes. The gene of
interest is very well localized when it is trapped in a
congenic strain showing an effect on blood pressure
that contains a relatively short (1–2 cM) introgressed
segment. The present work is only the first iteration of
this process and allows us to evaluate the effect that an
introgressed chr 1 segment obtained from a normotensive rat (LEW) has on the blood pressure of the
hypertensive S rat.
The original congenic strain was constructed to try to
include possible multiple QTLs because linkage analysis had suggested more than one blood pressure QTL on
chromosome 1 (5, 7, 30). The blood pressure-lowering
effect of 34 mmHg (Fig. 1 and Table 2) observed using
the S.LEW(chr 1) congenic strain confirmed that at
least one QTL was trapped within this chromosomal
region. Similar data on S.LEW(chr1) were reported
previously (5), but the data in Table 2 represent an
http://physiolgenomics.physiology.org
Downloaded from http://physiolgenomics.physiology.org/ by 10.220.33.4 on June 14, 2017
Marker
Downloaded from http://physiolgenomics.physiology.org/ by 10.220.33.4 on June 14, 2017
http://physiolgenomics.physiology.org
123
RAT CHROMOSOME 1 BLOOD PRESSURE QTL
Table 2. Effects of congenic strains on blood pressure, body weight, heart weight,
and heart weight-to-body weight ratio
Blood Pressure, mmHg
Heart Weight/Body Weight, mg/g
Congenic
Strain
Dahl S
Congenic
Effect*
t-test
Dahl S
Congenic
Effect*
t-test
S.LEW(chr1)
Chr1 ⫻ 14
Chr1 ⫻ 15
Chr1 ⫻ 8
Chr1 ⫻ 7
Chr1 ⫻ 3
212 [3.76]
227 [4.26]
202 [1.72]
211 [2.68]
224 [4.94]
231 [3.30]
177 [1.35]
203 [2.58]
207 [2.87]
184 [1.95]
225 [3.71]
192 [1.47]
⫺34 (4.08)
⫺23 (4.98)
⫹5 (3.35)
⫺26 (3.31)
⫹1 (6.18)
⫺38 (3.49)
0.0001
0.0001
0.106
0.0001
0.863
0.0001
3.987 [0.031]
4.272 [0.060]
3.834 [0.037]
4.017 [0.022]
4.088 [0.058]
4.334 [0.042]
3.564 [0.028]
3.974 [0.030]
3.881 [0.034]
3.766 [0.037]
4.089 [0.038]
3.867 [0.022]
⫺0.422 (0.041)
⫺0.297 (0.067)
⫹0.047 (0.051)
⫺0.251 (0.043)
⫹0.001 (0.069)
⫺0.466 (0.048)
0.0001
0.0001
0.361
0.0001
0.991
0.0001
Body Weight, g
Heart Weight, mg
Dahl S
Congenic
Effect*
t-test
Dahl S
Congenic
S.LEW(chr1)
Chr1 ⫻ 14
Chr1 ⫻ 15
Chr1 ⫻ 8
Chr1 ⫻ 7
Chr1 ⫻ 3
305 [2.57]
293 [2.11]
318 [3.57]
291 [3.90]
296 [3.01]
294 [4.02]
310 [2.43]
307 [2.75]
329 [2.27]
295 [2.91]
303 [2.92]
294 [2.63]
⫹5 (3.54)
⫹13 (3.47)
⫹10 (4.23)
⫹4 (4.86)
⫹7 (4.20)
0 (4.81)
0.169
0.0001
0.023
0.361
0.101
0.909
1217 [11.12]
1261 [15.86]†
1206 [23.10]†
1169 [16.58]
1210 [19.35]
1273 [14.53]
1106 [10.69]
1212 [11.87]†
1292 [17.53]†
1114 [17.29]
1239 [16.60]
1139 [11.85]
Effect*
⫺111 (15.43)
⫺49 (19.81)
⫹86 (29.00)
⫺55 (23.95)
⫹29 (25.50)
⫺133 (18.60)
t-test
0.0001
0.018
0.006
0.026
0.254
0.0001
Dahl S and congenic values are means; nos. in square brackets are SEs. * Effect values ⫽ congenic value ⫺ Dahl S value; nos. in parentheses
are SEs of mean differences. Experimental design: 20 male Dahl S rats and 20 male rats of a given congenic strain were age matched and
housed and raised together. Blood pressures were determined in a blinded fashion (see MATERIALS AND METHODS). Comparison was only made
between matched sets of Dahl S and congenic rats. Congenic strains are defined in Fig. 1. † Because body weight was different between the
congenic strains Chr1 ⫻ 14 or Chr1 ⫻ 15 and Dahl S, heart weight values were corrected for body weight using regression between heart
weight and body weight (28).
additional test on this strain. The present analysis (Fig.
1) using congenic substrains derived from S.LEW(chr1)
allowed for the localization of a blood pressure QTL to
the 25-cM region flanked by D1M7Mit87 and D1N64.
The QTL was conservatively localized to this region as
the difference between congenic substrains Chr1 ⫻ 8
and Chr1 ⫻ 15. One could argue that the QTL is likely
to be in the D1M7Mit87 to D1Wox6 (15 cM) region,
because this region is common to the two substrains
Chr1 ⫻ 8 and Chr1 ⫻ 14, both of which showed a
significant blood pressure effect. This argument is not
technically complete based only on the data in Fig. 1
because theoretically there could be another QTL in
Chr1 ⫻ 14 between D1Mco2 and D1M7Mit87 that
accounts for the blood pressure effect of Chr1 ⫻ 14.
Preliminary unpublished data (Saad and Rapp) on
other congenic strains indicate, however, that the second blood pressure QTL on chr 1 suggested by linkage
analysis (5, 7) is located more proximally between
D1Uia8 and D1Rat95.
It is obvious in Table 2 that there is significant
variation in the blood pressure of S rats among experi-
ments. Because S rats have been inbred for more than
75 generations of brother-sister mating, they should be
highly genetically homogeneous. Variation among S rat
groups studied at different times is attributed to unknown environmental influences. On the assumption
that such environmental influences affect the S and
congenic strains similarly, the only valid comparison in
determining if a congenic strain has a different blood
pressure compared with the S strain is between the S
and congenic strains raised and studied concomitantly.
We also measured body and heart weights of our
congenic substrains. There was no significant strain
difference in body weight with the exception of substrains Chr1 ⫻ 14 and Chr1 ⫻ 15. These showed a
significant increase in body weight of 13 and 10 g,
respectively, compared with S. These effects were not
great enough to warrant further study. In most of the
congenic substrains a decrease in blood pressure correlated well with a decrease in heart weight compared
with S rats as measured by either heart weight-to-body
weight ratio or by heart weight adjusted (if necessary)
by regression for differences in body weight (Fig. 1 and
Fig. 1. Linkage map of rat chromosome 1 with schematic showing introgressed chromosomal segments for various
congenic substrains. Numbers at left of genetic map represent map distances in centimorgans (cM) with Kosambi’s
correction. Map was constructed from an F2(S ⫻ LEW) population with a minimum of 92 rats typed at each locus.
Intervals marked with an asterisk (*) have been drawn shorter, in relative terms, than they actually should be. Solid
bars, LEW congenic segment introgressed onto background of S rat. Open bars at ends of these congenic segments,
regions of crossover between LEW and S. Horizontal dashed lines connect congenic bars to exact markers used in
determining their ends. Crosshatched region of congenic substrain Chr1 ⫻ 8 is region that was segregating at time
blood pressure was taken. Top: blood pressure and heart weight effects are shown as changes of congenic strain from
control S value (congenic strains are identified at bottom). Bottom: for comparison, 4 congenic strains around the Sa
locus constructed by other research groups [St. Lezin et al. (26), Frantz et al. (4), and Iwai et al. (16)] are placed to
right of congenic strains from current study. Position of the Sa locus: in bottom part of map at marker D1Mco13 (at
Sa) and also at right of all congenic strains (at horizontal arrow). See MATERIALS AND METHODS for description of rat
strains.
http://physiolgenomics.physiology.org
Downloaded from http://physiolgenomics.physiology.org/ by 10.220.33.4 on June 14, 2017
Congenic
Strain
124
RAT CHROMOSOME 1 BLOOD PRESSURE QTL
Table 2). Changes in heart weight are presumably
largely a consequence of changes in blood pressure
(afterload). Congenic substrain Chr1 ⫻ 15 had no
significant effect on blood pressure, but heart weight
(adjusted for differences in body weight) was increased
compared with the S. This was not reflected in the
heart weight-to-body weight ratio, and so the increased
heart weight in Chr1 ⫻ 15 is problematic. Clearly,
heart weight in Chr1 ⫻ 15 is not decreased as would be
expected if the strain included the blood pressure QTL.
It could be that the Chr1 ⫻ 15 congenic region contains
a heart weight QTL that is independent of blood
pressure, but the present data would need to be independently corroborated before such a heart weight QTL
can be accepted. Heart weight QTLs independent of
blood pressure have been claimed to exist on rat chr 14
(3), chr 17 (24), and chr X (29).
As illustrated in Fig. 1, our QTL localization partially
overlaps with the differential segments found in congenic strains constructed by other groups around the
Sa gene (4, 16, 26). Our QTL region, however, does not
include the Sa gene. Substrains Chr1 ⫻ 7 and Chr1 ⫻
15, carrying the Sa gene region, had no effect on blood
pressure, suggesting that the Sa gene does not play a
role in the S vs. LEW comparison of blood pressure (Fig.
Table 3. Quantitation of Sa mRNA levels in
kidneys from 42-day-old male rats
Strain
*Sa-to-G3PDH
Ratio (n ⫽ 5)
P vs. SHR
P vs. Dahl S
SHR
Dahl S
Chr1 ⫻ 7
1.07 (0.0094)
0.40 (0.034)
0.043 (0.0126)
⬍0.0001
⬍0.0001
⬍0.0001
Sa-to-glyceraldehyde 3-phosphate dehydrogenase (G3PDH) ratio
values are means of 5 samples obtained from 5 different rats for each
of the strains tested; SEs are in parentheses. Differences among
strains were significant (P ⬍ 0.0001) by a 1-way ANOVA; a Bonferroni
post hoc test (28) required P ⬍ 0.017 for significance of the pairwise
comparisons. SHR, spontaneously hypertensive rats; S, Dahl saltsensitive rats; Chr1 ⫻ 7, congenic substrain with donor segment of
chromosome 1 containing the Sa allele from LEW rats on the S
background (see Fig. 1).
This work was supported by grants from the National Institutes of
Health and by the Helen and Harold McMaster Endowed Chair in
Biochemistry and Molecular Biology to J. P. Rapp.
Address for reprint requests and other correspondence: J. P. Rapp,
Dept. of Physiology and Molecular Medicine, Medical College of Ohio,
3035 Arlington Ave., Toledo, OH 43614-5804 (E-mail: [email protected]).
http://physiolgenomics.physiology.org
Downloaded from http://physiolgenomics.physiology.org/ by 10.220.33.4 on June 14, 2017
Fig. 2. Northern filter analysis of total RNA obtained from kidneys of
42-day-old male rats probed for Sa and glyceraldehyde 3-phosphate
dehydrogenase (G3PDH) mRNA. S, Dahl salt-sensitive rats; SHR,
spontaneously hypertensive rats; Chr1 ⫻ 7, congenic substrain with
donor segment of chromosome 1 containing the Sa allele from LEW
rats (see Fig. 1).
1 and Table 2). This also eliminates the ␤ and ␥
subunits of the epithelial sodium channel as candidate
blood pressure genes in the S vs. LEW comparison
because these genes are closely linked to the Sa locus
(6, 11, 18). Frantz et al. (4) constructed a congenic
substrain, SHR.WKY-Sa, spanning a region similar to
our Chr1 ⫻ 7 congenic substrain (Fig. 1). Although our
Chr1 ⫻ 7 congenic strain had no effect on blood
pressure, SHR.WKY-Sa had a modest lowering effect on
blood pressure. This difference may be due to a number
of factors, primarily the rat models used (S/LEW vs.
SHR/WKY), diet (salt loading in our case), and age of
rats at which blood pressure was taken (10 wk here vs.
16 and 20 wk). Cursory examination of Fig. 2 and Table
3 also suggests that Sa gene expression in SHR is
uniquely high, and this might represent an Sa allele in
SHR with a unique effect. It will, therefore, be of
interest to determine if congenic substrains involving
SHR also eliminate the Sa locus as a blood pressure
locus.
Introgressing a chromosomal segment harboring the
Sa gene obtained from a strain with low Sa gene
expression levels onto the genetic background of a
hypertensive strain is expected to lower blood pressure
as seen in the work done on the congenic strains
SHR.WKY-Sa and SHR.BN-D1Mit3/Igf2 (4, 26). Introgressing the high-expressing Sa gene allele onto the
background of a normotensive strain increased blood
pressure in the WKY.SHR-Sa and WKY.SHR-D1Mit3/
Rat57 congenic strains (4, 16). The extent of the
congenic segments in these strains is also shown in Fig.
1. The congenic strains used by these groups obviously
also contained a large segment of the chromosome
around the Sa gene, which must contain a large number of other genes. Thus it cannot be concluded that
differential expression of the Sa gene directly results in
changes in blood pressure without further substitution
mapping using congenic substrains. In our study, the
Sa gene was expressed at higher levels in the kidneys of
S rats compared with that of the Chr1 ⫻ 7 congenic
substrain (carrying the LEW Sa allele), where Sa gene
expression was essentially not detectable (Fig. 2). Thus
the S vs. LEW allelic comparison showed a markedly
different expression pattern for the Sa gene, but the
blood pressure effect observed by congenic analysis was
not significant (Fig. 1 and Table 2). This provided
evidence that Sa gene expression is not involved in
blood pressure regulation. Our conclusion corroborates
the work of Lodwick et al. (21), who showed that there
was a major difference in expression of the Sa gene
between the Milan hypertensive strain (MHS) and the
Milan normotensive strains (MNS) but that the Sa
gene in this model did not cosegregate with blood
pressure.
RAT CHROMOSOME 1 BLOOD PRESSURE QTL
REFERENCES
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
10, and 18. Biochem. Biophys. Res. Commun. 235: 343–348,
1997.
Kreutz, R., B. Struk, S. Rubattu, N. Hübner, J. Szpirer, C.
Szpirer, D. Ganten, and K. Lindpaintner. Role of the ␣-, ␤-,
and ␥-subunits of epithelial sodium channel in a model of
polygenic hypertension. Hypertension 29: 131–136, 1997.
Lander, E., P. Green, J. Abrahamson, A. Barlow, M. Daly, S.
Lincoln, and L. Newburg. Mapmaker: an interactive computer
package for constructing primary genetic linkage maps of experimental and natural populations. Genomics 1: 174–181, 1987.
Lindpaintner, K., P. Hilbert, D. Ganten, B. Nadal-Ginard,
T. Inagami, and N. Iwai. Molecular genetics of the Sa gene:
cosegregation with hypertension and mapping to rat chromosome 1. J. Hypertens. 11: 19–23, 1993.
Lodwick, D., L. Zagato, M. A. Kaiser, L. Torielli, G. Casari,
G. Bianchi, and N. J. Samani. Genetic analysis of the Sa and
Na⫹/K⫹-ATPase ␣1 genes in the Milan hypertensive rat. J.
Hypertens. 16: 139–144, 1998.
Nara, Y., T. Nabika, K. Ikeda, M. Sawamura, M. Mano, J.
Endo, and Y. Yamori. Basal high blood pressure cosegregates
with the loci on chromosome 1 in F2 generation from crosses
between normotensive Wistar Kyoto rats and stroke-prone spontaneously hypertensive rats. Biochem. Biophys. Res. Commun.
194: 1344–1351, 1993.
Patel, H. R., A. S. Thiara, K. P. West, D. Lodwick, and N. J.
Samani. Increased expression of the Sa gene in the kidney of the
spontaneously hypertensive rat is localized to the proximal
tubule. J. Hypertens. 12: 1347–1352, 1994.
Pravenec, M., D. Gauguier, J.-J. Schott, J. Buard, V. Kren,
V. Bı́lá, C. Szpirer, J. Szpirer, J.-M. Wang, H. Huang, E. St.
Lezin, M. A. Spence, P. Flodman, M. Printz, G. M. Lathrop,
G. Vergnaud, and T. W. Kurtz. Mapping of quantitative trait
loci for blood pressure and cardiac mass in the rat by genome
scanning of recombinant inbred strains. J. Clin. Invest. 96:
1973–1978, 1995.
Rapp, J. P., and A. Y. Deng. Detection and positional cloning of
blood pressure quantitative trait loci: is it possible? Hypertension
25: 1121–1128, 1995.
St. Lezin, E., W. Liu, J.-M. Wang, N. Wang, V. Kren, D.
Krenova, A. Musilova, M. Zdobinska, V. Zidek, D. Lau, and
M. Pravenec. Genetic isolation of a chromosome 1 region
affecting blood pressure in the spontaneously hypertensive rat.
Hypertension 30: 854–859, 1997.
Samani, N. J., D. Lodwick, M. Vincent, C. Dubay, M. A.
Kaiser, M. P. Kelly, M. Lo, J. Harris, J. Sassard, M. Lathrop,
and J. D. Swales. A gene differentially expressed in the kidney
of the spontaneously hypertensive rat cosegregates with increased blood pressure. J. Clin. Invest. 92: 1099–1103, 1993.
Sokal, R. R., and F. T. Rohlf. Biometry (3rd ed.). New York:
Freeman, 1995, p. 240 and p. 488–490.
Vincent, M., G. Hadour, V. Oréa, N. J. Samani, and J.
Sassard. Left ventricular weight but not blood pressure is
associated with sex chromosomes in Lyon rats. J. Hypertens. 14:
293–299, 1996.
Yagil, C., M. Sapojnikov, R. Kreutz, G. Katni, K. Lindpaintner, D. Ganten, and Y. Yagil. Salt susceptibility maps to
chromosomes 1 and 17 with sex specificity in the Sabra rat model
of hypertension. Hypertension 31: 119–124, 1998.
Yang, T., S. A. Hassan, I. Singh, A. Smart, F. C. Brosius, L. B.
Holzman, J. B. Schnermann, and J. P. Briggs. Sa gene
expression in the proximal tubule of normotensive and hypertensive rats. Hypertension 27: 541–545, 1996.
http://physiolgenomics.physiology.org
Downloaded from http://physiolgenomics.physiology.org/ by 10.220.33.4 on June 14, 2017
1. Angervall, L., and E. Carlström. Theoretical criteria for the
use of relative organ weights and similar ratios in biology. J.
Theoret. Biol. 4: 254–259, 1963.
2. Brown, D. M., A. P. Provoost, M. J. Daly, E. S. Lander, and
H. J. Jacob. Renal disease susceptibility and hypertension are
under independent genetic control in the fawn-hooded rat. Nat.
Genet. 12: 44–51, 1996.
3. Clark, J. S., B. Jeffs, A. O. Davidson, W. K. Lee, N. H.
Anderson, M.-T. Bihoreau, M. J. Brosnan, A. M. Devlin,
A. W. Kelman, K. Lindpaintner, and A. F. Dominiczak.
Quantitative trait loci in genetically hypertensive rats. Possible
sex specificity. Hypertension 28: 898–906, 1996.
4. Frantz, S. A., M. Kaiser, S. M. Gardiner, D. Gauguier, M.
Vincent, J. R. Thompson, T. Bennett, and N. J. Samani.
Successful isolation of a rat chromosome 1 blood pressure
quantitative trait locus in reciprocal congenic strains. Hypertension 32: 639–646, 1998.
5. Garrett, M. R., H. Dene, R. Walder, Q.-Y. Zhang, G. T. Cicila,
S. Assadnia, A. Y. Deng, and J. P. Rapp. Genome scan and
congenic strains for blood pressure QTL using Dahl salt-sensitive
rats. Genome Res. 8: 711–723, 1998.
6. Gründer, S., L. Zagato, C. Yagil, Y. Yagil, J. Sassard, and
B. C. Rossier. Polymorphisms in the carboxy-terminus of the
epithelial sodium channel in rat models for hypertension. J.
Hypertens. 15: 173–179, 1997.
7. Gu, L., H. Dene, A. Y. Deng, B. Hoebee, M.-T. Bihoreau, M.
James, and J. P. Rapp. Genetic mapping of two blood pressure
quantitative trait loci on rat chromosome 1. J. Clin. Invest. 97:
777–788, 1996.
8. Gu, L., H. Dene, and J. P. Rapp. Three microsatellites defining
four alleles for the Sa gene. Mamm. Genome 5: 833, 1994.
9. Harris, E. L., H. Dene, and J. P. Rapp. Sa gene and blood
pressure cosegregation using Dahl salt-sensitive rats. Am. J.
Hypertens. 6: 330–334, 1993.
10. Hoebee, B., J. M. de Stoppelaar, R. F. Suijkerbuijk, and S.
Monard. Isolation of rat chromosome-specific paint probes by
bivariate flow sorting followed by degenerate oligonucleotide
primed-PCR. Cytogenet. Cell Genet. 66: 277–282, 1994.
11. Huang, H., M. Pravenec, J.-M. Wang, V. Kren, E. St. Lezin,
C. Szpirer, J. Szpirer, and T. W. Kurtz. Mapping and sequence
analysis of the gene encoding the ␤-subunit of the epithelial
sodium channel in experimental hypertension. J. Hypertens. 13:
1247–1251, 1995.
12. Innes, B. A., M. G. McLaughlin, M. K. Kapuscinski, H. J.
Jacob, and S. B. Harrap. Independent genetic susceptibility to
cardiac hypertrophy in inherited hypertension. Hypertension 31:
741–746, 1998.
13. Iwai, N., and T. Inagami. Isolation of preferentially expressed
genes in the kidneys of hypertensive rats. Hypertension 17:
161–169, 1991.
14. Iwai, N., and T. Inagami. Identification of a candidate gene
responsible for the high blood pressure of spontaneously hypertensive rats. J. Hypertens. 10: 1155–1157, 1992.
15. Iwai, N., T. W. Kurtz, and T. Inagami. Further evidence of the
Sa gene as a candidate gene contributing to the hypertension in
spontaneously hypertensive rat. Biochem. Biophys. Res. Commun. 188: 64–69, 1992.
16. Iwai, N., Y. Tsujita, and M. Kinoshita. Isolation of a chromosome 1 region that contributes to high blood pressure and salt
sensitivity. Hypertension 32: 636–638, 1998.
17. Kovács, P., B. Voigt, and I. Klöting. Novel quantitative trait
loci for blood pressure and related traits on rat chromosomes 1,
125