Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Organ-on-a-chip wikipedia , lookup
Histone acetylation and deacetylation wikipedia , lookup
Protein moonlighting wikipedia , lookup
Magnesium transporter wikipedia , lookup
Signal transduction wikipedia , lookup
Nuclear magnetic resonance spectroscopy of proteins wikipedia , lookup
Distinct Cellular and Molecular Mechanisms Underlie Functional Remodeling of Repolarizing Kⴙ Currents With Left Ventricular Hypertrophy Céline Marionneau,* Sylvain Brunet,* Thomas P. Flagg, Thomas K. Pilgram, Sophie Demolombe, Jeanne M. Nerbonne Downloaded from http://circres.ahajournals.org/ by guest on June 14, 2017 Abstract—Left ventricular hypertrophy (LVH) is associated with electric remodeling and increased arrhythmia risk, although the underlying mechanisms are poorly understood. In the experiments here, functional voltage-gated (Kv) and inwardly rectifying (Kir) K⫹ channel remodeling was examined in a mouse model of pressure overload–induced LVH, produced by transverse aortic constriction (TAC). Action potential durations (APDs) at 90% repolarization in TAC LV myocytes and QTc intervals in TAC mice were prolonged. Mean whole-cell membrane capacitance (Cm) was higher, and Ito,f, IK,slow, Iss, and IK1 densities were lower in TAC, than in sham, LV myocytes. Although the primary determinant of the reduced current densities is the increase in Cm, IK,slow amplitudes were decreased and Iss amplitudes were increased in TAC LV cells. Further experiments revealed regional differences in the effects of LVH. Cellular hypertrophy and increased Iss amplitudes were more pronounced in TAC endocardial LV cells, whereas IK,slow amplitudes were selectively reduced in TAC epicardial LV cells. Consistent with the similarities in Ito,f and IK1 amplitudes, Kv4.2, Kv4.3, and KChIP2 (Ito,f), as well as Kir2.1 and Kir2.2 (IK1), transcript and protein expression levels were similar in TAC and sham LV. Unexpectedly, expression of IK,slow channel subunits Kv1.5 and Kv2.1 was increased in TAC LV. Biochemical experiments also demonstrated that, although total protein was unaltered, cell surface expression of TASK1 was increased in TAC LV. Functional changes in repolarizing K⫹ currents with LVH, therefore, result from distinct cellular (cardiomyocyte enlargement) and molecular (alterations in the numbers of functional channels) mechanisms. (Circ Res. 2008;102:0-0.) Key Words: hypertrophy 䡲 arrhythmia 䡲 heart failure L eft ventricular hypertrophy (LVH) is an adaptive response of the myocardium to an increase in load.1 LVH is seen in various disease states including hypertension and myocardial infarction, as well as in valvular and congenital heart diseases.1 LVH is also observed in physiological states following rigorous, prolonged exercise.2 Although physiological LVH does not confer increased morbidity and mortality, pathological LVH is consistently associated with prolongation of ventricular action potentials and alterations in the dispersion of repolarization, both of which result in electric instability and increase the propensity to develop lifethreatening arrhythmias.3 Several lines of evidence suggest that these electric changes reflect, at least in part, alterations in the functioning of the K⫹ channels that underlie ventricular action potential repolarization.3,4 Various experimental models of LVH,5–7 including pressure overload–induced LVH,8,9 have been developed to explore the mechanisms underlying K⫹ current remodeling. Although several studies have examined regional differences in remodeling,8 –11 few have probed the underlying molecular and cellular mechanisms. In the studies here, a mouse model of pressure overload–induced LVH, produced by transverse aortic constriction (TAC), was exploited to quantify the effects of LVH on repolarizing K⫹ currents in LV myocytes and to delineate the mechanisms underlying K⫹ current remodeling. These experiments revealed that APDs were prolonged in TAC LV myocytes and that QTc intervals were increased in TAC mice. Mean whole-cell membrane capacitance (Cm) was increased significantly, and the densities of voltage-gated K⫹ (Kv) and inwardly rectifying K⫹ (Kir) currents were reduced in TAC LV myocytes. Further electrophysiological, molecular, and biochemical analyses revealed marked regional differences in the effects of LVH and that distinct cellular and molecular mechanisms contribute to the functional remodeling of repolarizing Kv and Kir currents. Original received August 13, 2007; resubmission received December 17, 2007; revised resubmission received April 17, 2008; accepted April 23, 2008. From the Departments of Molecular Biology and Pharmacology (C.M., S.B., J.M.N.), Cell Biology and Physiology (T.P.F.), and Radiology (T.K.P.), Washington University Medical School, St Louis, Mo; and INSERM U533, L’Institut du Thorax and Université de Nantes (S.D.), Faculté de Médecine, France. Present address for S.B.: Department of Pharmacology, University of Washington, Seattle. *Both authors contributed equally to this work. Correspondence to Jeanne Nerbonne, Washington University School of Medicine, Molecular Biology and Pharmacology, 660 Euclid Ave, Box 8103, St Louis, MO 63110. E-mail [email protected] © 2008 American Heart Association, Inc. Circulation Research is available at http://circres.ahajournals.org DOI: 10.1161/CIRCRESAHA.107.170050 1 2 Circulation Research June 6, 2008 Figure 1. Detection of LVH 7 days after TAC. A, Representative echocardiographic M-mode images of sham and TAC LV. Scale bars are 1 mm and 100 ms. AW and PW designate anterior and posterior wall thicknesses, respectively. B, LVM/BW in sham (n⫽18) and TAC (n⫽39) mice; individual values and means⫾SEM are plotted. *P⬍0.001. C, Mean⫾SEM mRNA expression levels (arbitrary units) of the hypertrophy markers ANF and -MHC are significantly (*P⬍0.001; §P⬍0.05) higher in TAC (n⫽6) than in sham (n⫽6) LV. Downloaded from http://circres.ahajournals.org/ by guest on June 14, 2017 Materials and Methods Animals were handled in accordance with the Guide for the Care and Use of Laboratory Animals (NIH). Detailed methods are provided in the online data supplement at http://circres.ahajournals.org. Induction of LVH Pressure overload–induced LVH was produced in adult mice by TAC.12 Sham-operated animals underwent surgery but without aortic constriction. Seven days after surgery, echocardiographic images were acquired and analyzed using described methods.12,13 Electrophysiological Recordings Electrocardiographic (ECG) recordings were obtained from anesthetized mice.14 Myocytes were isolated from the LV (and RV), as well as from the epicardial (EPI) and endocardial (ENDO) LV surfaces, of sham and TAC hearts by enzymatic dissociation and mechanical dispersion using described methods.15 Whole-cell membrane currents and action potentials were measured as previously described.15 Quantitative RT-PCR Total RNA from RV, LV, EPI, and ENDO was isolated and DNase treated using described methods.16 RNA concentrations were determined by optical density measurements. TaqMan low-density arrays (Applied Biosystems) were used in a 2-step RT-PCR process as described previously.16 The 96 genes selected for quantification (supplemental Table I) encode 68 ion channel ␣, , and regulatory subunits; 11 Ca2⫹ homeostasis regulators; 6 transcription factors; 7 markers of vessels, neurons, fibroblasts, inflammation, and hypertrophy; and 4 controls.17 Data were analyzed using the threshold cycle relative quantification method, with hypoxanthine guanine phosphoribosyl transferase (HPRT) as the endogenous control. Because hypertrophy is associated with a generalized increase in transcript and protein content without an increase in cell numbers,18 transcript expression data determined in each sham and TAC (LV, EPI and ENDO) sample were multiplied by the LV mass to body weight ratio (LVM/BW) determined in the same animal. The expression of genes encoding atrial natriuretic factor (ANF), -myosin heavy chain (-MHC), and the 2-pore domain K⫹ (K2P) channel subunits TASK1, TASK2, and TREK1 was determined by SYBR green quantitative RT-PCR using sequence specific primers. Expression data were normalized to HPRT and to the measured LVM/BW. Biochemical Analyses Protein lysates were prepared from sham and TAC LV, EPI, and ENDO using described methods.19 Biotinylation of isolated LV myocytes was used to examine cell surface protein expression. Protein quantification was performed with the BCA Protein Assay Kit (Pierce). Proteins were loaded on SDS-PAGE gels in amounts proportional to the relative LVM/BW in TAC and sham mice. Statistics Results are expressed as means⫾SEM. Statistical analyses were performed using the Student’s t test. Multiple regression analysis was used to determine the significance of regional (EPI/ENDO) differences. Results Pressure Overload–Induced LVH Preliminary echocardiographic experiments revealed that the extent/severity of LVH did not vary appreciably in mice examined 7 days to 3 months after TAC (not shown). Experiments here, therefore, were completed 7 days following surgery. Reduced chamber volume and increased anterior and posterior wall thicknesses were observed in echocardiographic 2D short axis cine loops of the LV in TAC mice (Figure 1A). M-mode based LV mass measurements revealed that mean⫾SEM LVM/BW was significantly (P⬍0.001) higher in TAC (4.07⫾0.1 mg/g, n⫽39), than in sham (2.8⫾0.06 mg/g, n⫽18), mice (Figure 1B and supplemental Table II). In addition, the mean⫾SEM E/A wave ratio was significantly (P⬍0.05) larger in TAC animals (supplemental Table II), consistent with diastolic dysfunction.13 Fractional shortening, however, was similar (supplemental Table II), and there was no evidence of altered systolic function or heart failure in TAC animals. SYBR green quantitative RT-PCR revealed that expression of the hypertrophy markers2 ANF (P⬍0.001) and -MHC (P⬍0.05) was increased significantly in TAC, compared with sham, LV (Figure 1C), consistent with the presence of pathological LVH. Marionneau et al Mechanisms Underlying Kⴙ Current Remodeling in LVH 3 Table. Kv and Kir Currents in Sham and TAC LV, RV, EPI, and ENDO Myocytes Cells Cm Ipeak Ito,f IK,slow Iss IK1 Sham LV 132⫾3 d 84⫾3 1281⫾23 pA 6849⫾306 3533⫾219 2408⫾96 714⫾20 ⫺1474⫾48 pA/pF 52.5⫾2.2 27.1⫾1.6 18.4⫾0.7 5.5⫾0.1 ⫺11.2⫾0.2 n RV 73 60 130⫾5 d 74⫾3 1155⫾28 pA 8909⫾607 5087⫾417 2702⫾157 690⫾33 ⫺1618⫾75 pA/pF 68.3⫾3.8 38.9⫾2.8 20.7⫾0.9 5.3⫾0.1 ⫺12.6⫾0.5 n EPI 35 26 138⫾7 d Downloaded from http://circres.ahajournals.org/ by guest on June 14, 2017 87⫾5 1191⫾40 pA 8393⫾519 4105⫾308 3031⫾193 787⫾49 ⫺1427⫾105 pA/pF 61.6⫾3.2 30.2⫾2.2 22.3⫾1.3 5.7⫾0.2 ⫺10.4⫾0.5 n ENDO 13 13 131⫾10 d 89⫾13 1434⫾51 pA 5131⫾469 2335⫾203 2010⫾214 686⫾62 ⫺1579⫾110 pA/pF 39.8⫾2.3 18.3⫾1.3 15.3⫾0.9 5.3⫾0.3 ⫺12.4⫾0.6 n 16 16 TAC LV 172⫾5* d 82⫾2 1553⫾39 pA 5744⫾314‡ 3149⫾235 1747⫾83* 807⫾26† pA/pF 34.1⫾1.8* 18.8⫾1.4* 10.4⫾0.4* 4.7⫾0.1* n RV 70 ⫺1459⫾50 ⫺8.6⫾0.3* 57 122⫾5 d 66.4⫾2 1286⫾39 pA 7123⫾570 4406⫾386 1858⫾150 662⫾38 ⫺1398⫾155 pA/pF 58.4⫾4.1 36.1⫾2.7 15.2⫾1.1 5.4⫾0.2 ⫺11.4⫾1 n EPI 21 12 177⫾9† d 56⫾2 1596⫾53 pA 5754⫾471*b 3684⫾354 1167⫾107*a pA/pF 32.9⫾2.4*b 21.1⫾1.9† 6.7⫾0.6*a n ENDO 4.6⫾0.3† 23 ⫺1310⫾88 ⫺7.1⫾0.4* 21 215⫾11*a d 70⫾3 1626⫾74 pA 5642⫾584 2719⫾369 1856⫾182 pA/pF 26.8⫾2.5* 13.2⫾1.7‡ 8.7⫾0.8* n 802⫾57 18 1039⫾73*a 4.8⫾0.2 ⫺1720⫾99 ⫺7.9⫾0.4* 19 All values are means⫾SEM. Cm, decay (d), amplitude, and density values are expressed in pF, ms, pA, and pA/pF, respectively. Kv and Kir densities were determined at ⫹40 and ⫺120 mV (HP⫽⫺70 mV), respectively. Values were compared in TAC and sham LV myocytes, in TAC and sham EPI myocytes, or in TAC and sham ENDO myocytes, and *P⬍0.001, †P⬍0.01, ‡P⬍0.05 values are indicated. Impact of LVH is significantly (aP⬍0.05, bP⬍0.01) different in EPI and ENDO myocytes. Kⴙ Current Remodeling in TAC LV Myocytes Whole-cell recordings revealed that mean⫾SEM Cm was significantly (P⬍0.001) higher in TAC, than in sham, LV myocytes (Table). Consistent with the increased Cm, peak Kv current (Figure 2A and 2C) and IK1 (Figure 2B and 2G) densities were significantly (P⬍0.001) lower in TAC LV cells (Table). The decay phases of the Kv currents in adult wild-type mouse ventricular myocytes are best described by 4 Circulation Research June 6, 2008 Downloaded from http://circres.ahajournals.org/ by guest on June 14, 2017 Figure 2. Alterations in repolarizing K⫹ currents in TAC LV myocytes. Representative whole-cell Kv currents (A), evoked during 4.5second voltage steps to potentials between ⫺40 and ⫹40 mV from a holding potential (HP) of ⫺70 mV, and Kir currents (B), evoked during 350-ms voltage steps to potentials between ⫺40 and ⫺120 mV (HP⫽⫺70 mV) in sham and TAC LV cells. Mean⫾SEM Ipeak (C), Ito,f (D), IK,slow (E), Iss (F), and IK1 (G) densities in sham and TAC LV myocytes are plotted as a function of test potential. Relative changes in Cm (H), current amplitudes (I), and densities (J) in TAC compared with sham LV myocytes. Values in TAC and sham LV myocytes are significantly (*P⬍0.001, #P⬍0.01) different. the sum of 2 exponentials, reflecting the inactivating currents Ito,f and IK,slow and a noninactivating current, Iss.15 Kinetic analyses of the currents revealed that mean⫾SEM Ito,f (Figure 2D), IK,slow (Figure 2E), and Iss (Figure 2F) densities were significantly (P⬍0.001) lower in TAC, than in sham, LV myocytes (Table). Mean⫾SEM Ito,f and IK1 amplitudes in TAC and sham LV myocytes, however, were indistinguishable (Figure 2I), suggesting that the reductions in Ito,f and IK1 densities (Figure 2J) reflect only the increase in Cm (Figure 2H). In contrast, mean⫾SEM IK,slow amplitude was significantly (P⬍0.001) smaller and mean⫾SEM Iss amplitude was significantly (P⬍0.01) larger in TAC, than in sham, LV myocytes (Figure 2I). The increase in Iss amplitude, however, was not enough to offset the increase in Cm, and Iss density was decreased (Figure 2J). There were no differences in the kinetics or voltage dependences of the Kv currents in TAC and sham LV myocytes, and no significant differences in Cm or current amplitudes/densities in TAC and sham RV myocytes were observed (Table). APDs at 90% repolarization (APD90) were significantly (P⬍0.01) longer in TAC, than in sham, LV myocytes, whereas resting membrane potentials and action potential Marionneau et al Mechanisms Underlying Kⴙ Current Remodeling in LVH 5 Downloaded from http://circres.ahajournals.org/ by guest on June 14, 2017 Figure 3. Action potential and surface ECG abnormalities with TAC. A, Mean⫾SEM resting membrane potentials (Vm), action potential amplitudes (APA), and durations at 50% (APD50) and 90% (APD90) repolarization in sham and TAC RV and LV myocytes. APD90 values are significantly (#P⬍0.01) longer in TAC LV cells (supplemental Table III). B, Representative lead II ECGs from anesthetized sham and TAC mice before and after surgery. QTc interval durations (C) and J wave amplitudes (D) in sham (n⫽8) and TAC (n⫽8) mice before and after surgery; individual values and means⫾SEM are plotted (§P⬍0.05). amplitudes were not significantly different (Figure 3A and supplemental Table III). To assess the functional consequences of reduced K⫹ current densities and action potential prolongation, ECGs were obtained from anesthetized sham and TAC mice before and after surgery. Analysis of ECG recordings revealed significantly (P⬍0.05) longer QT and corrected QT (QTc) intervals in TAC, compared with sham, mice (Figure 3B and 3C and supplemental Table IV). In addition, the J wave, corresponding to the early repolarization phase of murine ventricular action potentials,20 was significantly (P⬍0.05) flattened or inverted (Figure 3B and 3D and supplemental Table IV), suggesting that the dispersion of ventricular repolarization is altered in TAC LV. Regional Differences in the Effects of TAC-Induced LVH on Kⴙ Currents Regional differences in the remodeling of LV K⫹ currents would be expected to alter the dispersion of ventricular repolarization.8 –11 Subsequent experiments focused, therefore, on investigating the effects of LVH on repolarizing K⫹ currents in cells isolated from the EPI and ENDO surfaces of the LV wall. As previously reported in wild-type cells,15 mean⫾SEM Ipeak (Figure 4A and 4C), Ito,f (Figure 4D), and IK,slow (Figure 4E) densities were significantly (P⬍0.001) higher in sham EPI, than ENDO, LV myocytes (Table). Regional differences in current densities15 have been suggested to contribute to the native transmural repolarization gradient.21 There were also marked regional differences in the cellular effects of LVH. The reduction in Ipeak densities was more pronounced in TAC EPI, than ENDO, LV myocytes in spite of the fact that mean⫾SEM Cm was higher in TAC ENDO cells (Figure 4A through 4C and the Table). In addition, mean⫾SEM Ipeak and IK,slow amplitudes were reduced significantly (P⬍0.001) in TAC EPI (Figure 4G), but not in TAC ENDO (Figure 4H), LV myocytes. Mean⫾SEM Iss amplitude, in contrast, was increased significantly (P⬍0.001) in TAC ENDO (Figure 4H), but not EPI (Figure 4G), LV myocytes, and, as a result, Iss density was decreased in TAC EPI (Figure 4I), but not ENDO (Figure 4J), cells. Similar to results obtained in myocytes dispersed from whole LV, the reduced Ito,f and IK1 densities in TAC EPI and ENDO myocytes (Figure 4I, 4J) appear to reflect only cellular hypertrophy (increased Cm), because no changes in Ito,f or IK1 amplitudes were observed in EPI or ENDO cells (Figure 4G and 4H). 6 Circulation Research June 6, 2008 Downloaded from http://circres.ahajournals.org/ by guest on June 14, 2017 Figure 4. Regional (EPI/ENDO) differences in the effects of LVH on repolarizing K⫹ currents and Cm. A, Representative Kv currents recorded, as described in the legend to Figure 2, from sham and TAC EPI and ENDO LV myocytes. B, Cm in sham and TAC EPI and ENDO cells. Mean⫾SEM Ipeak (C), Ito,f (D), IK,slow (E), and Iss (F) densities in sham and TAC EPI and ENDO LV myocytes are plotted as a function of test potential. Relative changes in current amplitudes (G and H) and densities (I and J) in TAC, compared with sham, EPI (G and I) and ENDO (H and J) LV myocytes. Indicated values in TAC and sham myocytes are significantly (*P⬍0.001, #P⬍0.01, §P⬍0.05) different. Molecular Basis of Kⴙ Current Remodeling in TAC LV Subsequent experiments examined the impact of TACinduced LVH on the transcript and protein expression levels of several channel pore-forming (␣) and accessory () subunits encoding murine myocardial K⫹ channels.14,19,22–24 Because accumulating evidence suggests that cardiac ion channels function as components of macromolecular complexes,25 TaqMan low-density arrays16 were exploited to allow quantitative determinations of multiple transcripts simultaneously. The amount of total RNA isolated from TAC LV was significantly (P⬍0.01) higher (1.7-fold on average) than from sham LV (Figure 5A). This observation is consistent with previous findings demonstrating that RNA synthesis/content in the LV is increased with hypertrophy, reflecting increased myocyte size, without an increase in myocyte number.18 Transcript expression levels determined by quantitative RTPCR on sham and TAC LV, and on EPI and ENDO LV, samples were, therefore, normalized to the LVM/BW determined in each animal. Consistent with the increase in total RNA, expression of several endogenous control genes (18S RNA, GAPDH, HPRT, RNA polymerase II [RNA Pol II])17 was increased in TAC, compared with sham, LV (Figure 5B). In contrast with the global increases in transcript expression with hypertrophy, transcript expression of the Ito,f channel ␣ subunits Kv4.2 (KCND2) and Kv4.3 (KCND3)19,24 was not significantly different in TAC and sham LV, and expression of the Ito,f channel accessory subunit KChIP2 (KCNIP2)24 was actually slightly lower in TAC LV (Figure 5C). The expression of transcripts encoding IK1 channel ␣ subunits Kir2.1 (KCNJ2) and Kir2.2 (KCNJ12),23 and of the K2P channel subunit TASK1 (KCNK3), which has been suggested to underlie Iss in rat cardiomyocytes,26 as well as TASK2 (KCNK5), was unaffected in TAC LV (Figure 5C). In contrast, expression of the transcripts encoding IK,slow1 and IK,slow2 channels Kv1.5 (KCNA5) and Kv2.1 (KCNB1),14,22 as well as of the K2P channel subunit TREK1 (KCNK2), was increased in TAC LV (Figure 5C). The expression levels of several other Kv ␣ subunits Kv1.4 (KCNA4), Kv4.1 (KCND1), and KvLQT1 (KCNQ1), as well as a number of K⫹ channel regulatory proteins including Kv1 (KCNAB1), Kv2 (KCNAB2), minK (KCNE1), KChAP (Pias3), PSD-95 (post-synaptic density 95 protein), and filamin C, were also increased in TAC LV (Figure 5C). Analyses of transcript expression in EPI and ENDO LV samples from sham and TAC animals revealed no regional differences in remodeling. As in wild-type LV,15 KCND2 expression was significantly (P⬍0.001) higher in sham EPI, than ENDO, LV (Figure 5D). This gradient was maintained in TAC LV, and expression of KCND3 and KCNIP2, as well as KCNJ2 and KCNJ12, transcripts was also similar in TAC EPI and ENDO (Figure 5D), consistent with the similarities Marionneau et al Mechanisms Underlying Kⴙ Current Remodeling in LVH 7 Downloaded from http://circres.ahajournals.org/ by guest on June 14, 2017 Figure 5. Transcript expression profiling in TAC and sham LV. A, Total RNA content in sham (n⫽6) and TAC (n⫽8) LV; individual values and means⫾SEM are plotted (#P⬍0.01). Mean⫾SEM RNA expression levels (arbitrary units) of control (B) and K⫹ channel subunit and regulatory (C) genes in sham and TAC LV and of K⫹ channel subunit and regulatory genes in sham and TAC EPI and ENDO LV (D) (n⫽6 mice in each group). Indicated values are significantly (*P⬍0.001, #P⬍0.01, §P⬍0.05) different in TAC and sham LV and in EPI versus ENDO (†P⬍0.001) samples. in Ito,f and IK1 amplitudes in TAC and sham EPI and ENDO LV myocytes (Figure 4). The transcript expression levels of Kv1.5, Kv2.1, and TREK1, as well as SAP-97, which has been postulated to play a role in Kv1.5 trafficking,27 were increased similarly in TAC EPI and ENDO LV (Figure 5D). Western blot experiments were performed to determine the (total and/or cell surface) expression levels of several Kv channel subunit and regulatory proteins. Similar to the RNA data and in accordance with previous reports,18 total LV protein content was significantly (P⬍0.01) higher (1.2-fold on average) in TAC, compared with sham, LV (Figure 6A). To compare protein expression in sham and TAC LV and in sham and TAC EPI and ENDO LV samples, therefore, protein loading on SDS-PAGE gels was normalized to reflect the LVM/BW. Consistent with the global increase in protein content (Figure 6A), expression of the endogenous (transferrin receptor17) control protein, as well as the structural proteins filamin C and -actin, was increased significantly (P⬍0.05) in TAC, compared with sham, LV (Figure 6B and 6C). Consistent with the transcript data (Figure 5), however, no significant differences in the expression levels of the Ito,f (Kv4.2, KChIP2) or IK1 (Kir2.1, Kir2.2) channel subunit proteins were observed in TAC and sham LV (Figure 6B and 6C). Further experiments revealed no regional differences in the impact of LVH: Kv2.1 and -actin 8 Circulation Research June 6, 2008 Downloaded from http://circres.ahajournals.org/ by guest on June 14, 2017 Figure 6. Protein expression in TAC and sham LV. A, Total protein content in sham (n⫽3) and TAC (n⫽4) LV; individual values and means⫾SEM are plotted (#P⬍0.01). Representative Western blots of total protein expression of K⫹ channel subunits, as well as of the control proteins, transferrin receptor (TransR), -actin, and filamin C, in sham and TAC LV (B), EPI (D), and ENDO (E). Quantification of relative differences in total protein expression in sham and TAC total LV (C) and in sham and TAC EPI and ENDO LV (F). Data are means⫾SEM (n⫽3 to 6), and indicated values are significantly (§P⬍0.05) different in TAC and sham LV or TAC and sham EPI or ENDO LV. As in wild-type (WT) LV,15 Kv4.2 expression is higher (†P⬍0.01) in (sham and TAC) EPI than ENDO LV. expression were increased in both TAC EPI and ENDO LV, whereas Kv4.2, TASK1, and TASK2 expression were unaffected (Figure 6D through 6F). Cell surface Kv2.1 expression was also increased in TAC LV (Figure 7). Interestingly, however, although total TASK1 protein expression was unchanged (Figure 6), cell surface TASK1 expression was markedly increased in TAC, compared with sham, LV myocytes (Figure 7), in parallel with the increase in Iss amplitude (Figure 2). Discussion LVH in TAC Mice The experiments here revealed that pathological LVH is clearly evident in TAC mice 7 days following surgery. In parallel with the increase in LVM/BW, mean LV myocyte size, as determined by Cm measurements, was increased with TAC, in agreement with previous reports.8,28 In contrast to Figure 7. Cell surface protein expression in TAC and sham LV. A, Representative Western blots of cell surface expression of K⫹ channel subunit and the control (TransR) proteins in sham and TAC LV. B, Quantification of relative differences in cell surface protein expression in sham and TAC LV. Data are means⫾SEM (n⫽3 to 6), and expression levels are significantly (#P⬍0.01, §P⬍0.05) different in TAC and sham LV. Marionneau et al Mechanisms Underlying Kⴙ Current Remodeling in LVH these earlier reports, however, there was no evidence that mean LVM/BW or myocyte size continued to increase at longer times (up to 3 months) after TAC. Also, in contrast to the effects on LV cells, there were no differences in mean Cm in TAC and sham RV cells, demonstrating that the cellular hypertrophy is specific for the LV. Alterations in Repolarizing Kv and Kir Currents in TAC LV Myocytes Downloaded from http://circres.ahajournals.org/ by guest on June 14, 2017 Kv current and IK1 densities were markedly lower, and action potentials were prolonged in TAC, compared with sham, LV myocytes. In addition, QTc intervals were increased in TAC mice. Reduced Kv current densities and action potential prolongation are consistent findings in experimental LVH models3–9,11 and in failing human hearts.10,29 The analyses completed here, however, revealed that cellular hypertrophy (increased Cm) is the main factor in determining reductions in Ito,f and IK1 densities, because the mean amplitudes of these currents in TAC and sham LV cells were not significantly different. In contrast, mean IK,slow and Iss amplitudes were altered in TAC LV myocytes, suggesting that functional IK,slow and Iss channel expression is modulated with LVH. Regional Differences in the Effects of TAC-Induced LVH As described in failing human hearts,10 as well as in various LVH models,8,9,11 the experiments here revealed marked regional differences in the effects of LVH. Specifically, Ipeak and IK,slow densities were attenuated more in TAC EPI, than TAC ENDO, LV myocytes. The larger reduction in (Ipeak/ IK,slow) densities in TAC EPI cells reflects the decrease in IK,slow amplitudes, which were not affected in TAC ENDO cells. In contrast to previous reports,8 –11,28 however, the experiments here also revealed that the cellular responses to pressure overload are heterogeneous. Specifically, cellular hypertrophy was greater in TAC ENDO, than TAC EPI, LV myocytes. This regional difference may reflect the higher wall tension applied to the ENDO, as compared with the EPI, LV surface.30 No changes in mean Ito,f, IK,slow, and IK1 amplitudes were detected in TAC ENDO myocytes; the reductions in the densities of these currents in TAC ENDO cells appear to reflect only the increased cell size. Interestingly, however, mean Iss amplitude was significantly increased in TAC ENDO myocytes, partially compensating for the increase in cell size. Because this increase occurs only in TAC ENDO LV myocytes, where the increase in cell size is greater, it is tempting to speculate that ENDO Iss channels undergo remodeling to compensate (although inefficiently) for cellular hypertrophy/stretch. The marked reduction in the functional expression of EPI IK,slow channels, together with the increased expression of ENDO Iss channels, collapses the transmural Kv current gradient in TAC LV and is reflected in the alteration in the polarity of the J wave on ECG recordings. Molecular Remodeling of Kⴙ Channels in TAC-Induced LVH Reductions in the densities of specific K⫹ currents in the diseased myocardium have previously been reported to be associated with alterations in the expression of the subunits 9 underlying these currents.3,4 In the molecular/biochemical analyses completed here, however, no significant changes in the expression levels of the Ito,f (Kv4.2, Kv4.3, KChIP2) or IK1 (Kir2.1, Kir2.2) channel subunits in TAC (EPI and/or ENDO) LV were observed, consistent with the observed similarities in Ito,f and IK1 amplitudes in TAC EPI and ENDO LV myocytes. As previously demonstrated,18 the hypertrophic growth of cardiomyocytes with LVH is characterized by an increase in cell size without significant changes in cell number. In agreement with these previous reports,18 TACinduced LVH was associated with global increases in LV RNA and protein expression. Because cardiomyocytes contribute more than 90% to the total mass of the myocardium,1 the increase in LVM, as well as in RNA and protein content with LVH, predominantly reflects cardiomyocyte enlargement. Taken together, therefore, the results here suggest that the reductions in Ito,f and IK1 densities in TAC LV reflect the fact that the expression of the subunits encoding these channels is not increasing as the cells are enlarging. In contrast to Ito,f and IK1, mean IK,slow amplitude was markedly reduced in TAC EPI myocytes, suggesting downregulation of functional IK,slow channels. Unexpectedly, however, Kv1.5 and Kv2.1 transcripts were increased with TAC. Although the lack of an anti-Kv1.5 antibody that can detect endogenous Kv1.5 in cardiomyocytes reliably precluded analyses of Kv1.5 protein expression, biochemical data presented here demonstrate increased total and cell surface Kv2.1 protein expression in TAC EPI and ENDO LV. If Kv1.5 protein expression increases in parallel with KCNA5, the loss of functional IK,slow channels must reflect altered expression of yet to be identified IK,slow accessory and/or regulatory subunits and/or altered posttranslational processing of the Kv1.5 and/or Kv2.1 proteins. The experiments here also revealed that Iss amplitude was increased in TAC ENDO LV myocytes. Whereas the transcript and total protein expression levels were unchanged in TAC EPI and ENDO, the cell surface expression of TASK1 was markedly increased in TAC LV myocytes. These results are consistent with recent findings demonstrating a role for TASK1 in the generation of Iss in rat cardiomyocytes.26 Relationship to Previous Studies The results presented here demonstrate that distinct mechanisms underlie functional K⫹ channel remodeling with LVH, with the main factor being cellular hypertrophy. Several previous studies have described reductions in K⫹ current densities with LVH or heart failure.5–11,29 Most of these studies reported 30% to 50% decreases in K⫹ current densities, with cell membrane capacitances increased by approximately the same percentage. Although not reported, it seems likely that K⫹ current amplitudes were also largely unaffected in these previous studies and that increased cell size was the primary determinant of the reductions in K⫹ current densities. Some of these previous studies also reported decreased expression of K⫹ channel subunits with LVH. It appears, however, that these RNA/protein expression data were not normalized to reflect the global RNA/protein increases associated with cellular hypertrophy. Had the cellular hypertrophy been taken into account in these previous LVH studies, it seems certain that the expression levels of K⫹ channel 10 Circulation Research June 6, 2008 subunits would, similar to the present findings, be shown to be largely unchanged. The recognition of the important role of cardiomyocyte enlargement on functional K⫹ channel expression with LVH will impact the way future investigations into K⫹ (particularly Ito,f and IK1) channel remodeling with LVH are approached. Indeed, the results presented here suggest that alterations in the functional expression of Ito,f and IK1 channels with LVH do not reflect transcriptional or translational downregulation of the subunits encoding these channels, as has been previously suggested.3,4,29 Rather, the results here suggest that although global transcriptional and translational machineries are activated with LVH,18 the expression of channel subunits do not increase corresponding to the increase in cell size. Therapeutic strategies aimed at reducing cellular hypertrophy or increasing the functional expression of repolarizing K⫹ channels would, therefore, appear to be promising approaches in the treatment of LVH-associated ventricular arrhythmias. Downloaded from http://circres.ahajournals.org/ by guest on June 14, 2017 Acknowledgments We thank the Mouse Cardiovascular Phenotyping Core for surgical expertise and Drs Flavien Charpentier and Attila Kovacs for helpful discussion concerning interpretation of ECGs and echocardiograms. Sources of Funding This work was supported by National Heart, Lung, and Blood Institute grant HL-066388, the Heartland Affiliate of the American Heart Association (Postdoctoral Fellowship), and Agence Nationale de la Recherche grant ANR-05-PCOD-037-01. Disclosures None. References 1. Schoen FJ. The heart. In: Cotran RS, Kumar V, Collins T, eds. Robbin’s Pathologic Basis of Disease. Philadelphia, Pa: WB Saunders Co; 1999: 543–599. 2. McMullen JR, Jennings GL. Differences between pathological and physiological cardiac hypertrophy: novel therapeutic strategies to treat heart failure. Clin Exp Pharmacol Physiol. 2007;34:255–262. 3. Nattel S, Maguy A, Le Bouter S, Yeh YH. Arrhythmogenic ion-channel remodeling in the heart: heart failure, myocardial infarction, and atrial fibrillation. Physiol Rev. 2007;87:425– 456. 4. Armoundas AA, Wu R, Juang G, Marban E, Tomaselli GF. Electrical and structural remodeling of the failing ventricle. Pharmacol Ther. 2001;92: 213–230. 5. Kaab S, Nuss HB, Chiamvimonvat N, O’Rourke B, Pak PH, Kass DA, Marban E, Tomaselli GF. Ionic mechanism of action potential prolongation in ventricular myocytes from dogs with pacing-induced heart failure. Circ Res. 1996;78:262–273. 6. Dong D, Duan Y, Guo J, Roach DE, Swirp SL, Wang L, Lees-Miller JP, Sheldon RS, Molkentin JD, Duff HJ. Overexpression of calcineurin in mouse causes sudden cardiac death associated with decreased density of K⫹ channels. Cardiovasc Res. 2003;57:320 –332. 7. Rose J, Armoundas AA, Tian Y, DiSilvestre D, Burysek M, Halperin V, O’Rourke B, Kass DA, Marban E, Tomaselli GF. Molecular correlates of altered expression of potassium currents in failing rabbit myocardium. Am J Physiol Heart Circ Physiol. 2005;288:H2077–H2087. 8. Wang Y, Cheng J, Chen G, Rob F, Haris Naseem R, Nguyen L, Johnstone J, Hill J. Remodeling of outward K⫹ currents in pressure-overload heart failure. J Cardiovasc Electrophysiol. 2007;18:869 – 875. 9. Volk T, Nguyen TH, Schultz JH, Faulhaber J, Ehmke H. Regional alterations of repolarizing K⫹ currents among the left ventricular free wall of rats with ascending aortic stenosis. J Physiol. 2001;530:443– 455. 10. Nabauer M, Beuckelmann DJ, Uberfuhr P, Steinbeck G. Regional differences in current density and rate-dependent properties of the transient outward current in subepicardial and subendocardial myocytes of human left ventricle. Circulation. 1996;93:168 –177. 11. Zicha S, Xiao L, Stafford S, Cha TJ, Han W, Varro A, Nattel S. Transmural expression of transient outward potassium current subunits in normal and failing canine and human hearts. J Physiol. 2004;561:735–748. 12. Zhang S, Weinheimer C, Courtois M, Kovacs A, Zhang CE, Cheng AM, Wang Y, Muslin AJ. The role of the Grb2-p38 MAPK signaling pathway in cardiac hypertrophy and fibrosis. J Clin Invest. 2003;111:833– 841. 13. Chiu HC, Kovacs A, Blanton RM, Han X, Courtois M, Weinheimer CJ, Yamada KA, Brunet S, Xu H, Nerbonne JM, Welch MJ, Fettig NM, Sharp TL, Sambandam N, Olson KM, Ory DS, Schaffer JE. Transgenic expression of fatty acid transport protein 1 in the heart causes lipotoxic cardiomyopathy. Circ Res. 2005;96:225–233. 14. London B, Guo W, Pan X, Lee JS, Shusterman V, Rocco CJ, Logothetis DA, Nerbonne JM, Hill JA. Targeted replacement of KV1.5 in the mouse leads to loss of the 4-aminopyridine-sensitive component of I(K,slow) and resistance to drug-induced qt prolongation. Circ Res. 2001;88:940–946. 15. Brunet S, Aimond F, Li H, Guo W, Eldstrom J, Fedida D, Yamada KA, Nerbonne JM. Heterogeneous expression of repolarizing, voltage-gated K⫹ currents in adult mouse ventricles. J Physiol. 2004;559:103–120. 16. Marionneau C, Couette B, Liu J, Li H, Mangoni ME, Nargeot J, Lei M, Escande D, Demolombe S. Specific pattern of ionic channel gene expression associated with pacemaker activity in the mouse heart. J Physiol. 2005;562:223–234. 17. de Kok JB, Roelofs RW, Giesendorf BA, Pennings JL, Waas ET, Feuth T, Swinkels DW, Span PN. Normalization of gene expression measurements in tumor tissues: comparison of 13 endogenous control genes. Lab Invest. 2005;85:154 –159. 18. Hannan RD, Jenkins A, Jenkins AK, Brandenburger Y. Cardiac hypertrophy: a matter of translation. Clin Exp Pharmacol Physiol. 2003;30: 517–527. 19. Guo W, Jung WE, Marionneau C, Aimond F, Xu H, Yamada KA, Schwarz TL, Demolombe S, Nerbonne JM. Targeted deletion of Kv4.2 eliminates I(to,f) and results in electrical and molecular remodeling, with no evidence of ventricular hypertrophy or myocardial dysfunction. Circ Res. 2005;97:1342–1350. 20. Liu G, Iden JB, Kovithavongs K, Gulamhusein R, Duff HJ, Kavanagh KM. In vivo temporal and spatial distribution of depolarization and repolarization and the illusive murine T wave. J Physiol. 2004;555:267–279. 21. London B, Baker LC, Petkova-Kirova P, Nerbonne JM, Choi BR, Salama G. Dispersion of repolarization and refractoriness are determinants of arrhythmia phenotype in transgenic mice with long QT. J Physiol. 2007; 578:115–129. 22. Xu H, Barry DM, Li H, Brunet S, Guo W, Nerbonne JM. Attenuation of the slow component of delayed rectification, action potential prolongation, and triggered activity in mice expressing a dominant-negative Kv2 alpha subunit. Circ Res. 1999;85:623– 633. 23. Zaritsky JJ, Redell JB, Tempel BL, Schwarz TL. The consequences of disrupting cardiac inwardly rectifying K(⫹) current (I(K1)) as revealed by the targeted deletion of the murine Kir2.1 and Kir2.2 genes. J Physiol. 2001;533:697–710. 24. Guo W, Li H, Aimond F, Johns DC, Rhodes KJ, Trimmer JS, Nerbonne JM. Role of heteromultimers in the generation of myocardial transient outward K⫹ currents. Circ Res. 2002;90:586 –593. 25. Nerbonne JM, Kass RS. Molecular physiology of cardiac repolarization. Physiol Rev. 2005;85:1205–1253. 26. Putzke C, Wemhoner K, Sachse FB, Rinne S, Schlichthorl G, Li XT, Jae L, Eckhardt I, Wischmeyer E, Wulf H, Preisig-Muller R, Daut J, Decher N. The acid-sensitive potassium channel TASK-1 in rat cardiac muscle. Cardiovasc Res. 2007;75:59 – 68. 27. Godreau D, Vranckx R, Maguy A, Rucker-Martin C, Goyenvalle C, Abdelshafy S, Tessier S, Couetil JP, Hatem SN. Expression, regulation and role of the MAGUK protein SAP-97 in human atrial myocardium. Cardiovasc Res. 2002;56:433– 442. 28. Hill JA, Karimi M, Kutschke W, Davisson RL, Zimmerman K, Wang Z, Kerber RE, Weiss RM. Cardiac hypertrophy is not a required compensatory response to short-term pressure overload. Circulation. 2000;101: 2863–2869. 29. Kaab S, Dixon J, Duc J, Ashen D, Nabauer M, Beuckelmann DJ, Steinbeck G, McKinnon D, Tomaselli GF. Molecular basis of transient outward potassium current downregulation in human heart failure: a decrease in Kv4.3 mRNA correlates with a reduction in current density. Circulation. 1998;98:1383–1393. 30. Kelly D, Mackenzie L, Hunter P, Smaill B, Saint DA. Gene expression of stretch-activated channels and mechanoelectric feedback in the heart. Clin Exp Pharmacol Physiol. 2006;33:642– 648. Downloaded from http://circres.ahajournals.org/ by guest on June 14, 2017 Distinct Cellular and Molecular Mechanisms Underlie Functional Remodeling of Repolarizing K + Currents With Left Ventricular Hypertrophy Céline Marionneau, Sylvain Brunet, Thomas P. Flagg, Thomas K. Pilgram, Sophie Demolombe and Jeanne M. Nerbonne Circ Res. published online May 1, 2008; Circulation Research is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231 Copyright © 2008 American Heart Association, Inc. All rights reserved. Print ISSN: 0009-7330. Online ISSN: 1524-4571 The online version of this article, along with updated information and services, is located on the World Wide Web at: http://circres.ahajournals.org/content/early/2008/05/01/CIRCRESAHA.107.170050.citation Data Supplement (unedited) at: http://circres.ahajournals.org/content/suppl/2008/05/01/CIRCRESAHA.107.170050.DC1 Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published in Circulation Research can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for which permission is being requested is located, click Request Permissions in the middle column of the Web page under Services. Further information about this process is available in the Permissions and Rights Question and Answer document. Reprints: Information about reprints can be found online at: http://www.lww.com/reprints Subscriptions: Information about subscribing to Circulation Research is online at: http://circres.ahajournals.org//subscriptions/ ONLINE SUPPLEMENT Marionneau et al. MATERIALS AND METHODS Animals used in the present study were handled in accordance with the guidelines published in the Guide for the Care and Use of Laboratory Animals (US National Institutes of Health); all protocols were approved by the Washington University Animal Studies Committee. Induction of Left Ventricular Hypertrophy Pressure overload-induced Left Ventricular Hypertrophy (LVH) was produced in adult (8-9 week) male C57BL6 mice by transverse aortic constriction (TAC), a procedure that results in the development of concentric LVH within days1,2. For surgery, animals were anesthetized with xylazine (16 mg/kg, i.p.) and ketamine (80 mg/kg, i.p.). Once deep anesthesia was confirmed, the chest was opened and, following blunt dissection through the intercostal muscles, the thoracic aorta was identified. A 7-0 silk suture was placed around the transverse aorta and tied around a 26-gauge needle, which was subsequently removed. This procedure was performed on a total of 86 animals. Of these, 21 animals died during the surgery or within the following 24 hours; the remaining 65 animals survived and were used for experiments. Sham-operated animals (n=35) underwent the same surgical procedure, except that the aortic constriction was not put in place and, in contrast to the TAC animals, all of the sham animals survived. Echocardiography Seven days after TAC, animals were examined by non-invasive transthoracic echocardiography using described methods1,3. Under anesthesia (avertin, 0.25 mg/g, i.p.), animals were examined using an Acuson Sequoia 256 echocardiography system (Acuson, 1 Stockton, CA, USA) equipped with a 15-MHz transducer. Digitally acquired and stored twodimensional short axis cine-loops of the LV of TAC and sham mice were viewed and displayed next to images obtained from age-matched wild-type (WT) unoperated controls. Comparisons were then made between the appearance of the LV (i.e., wall thickness and chamber size) in TAC, sham and WT animals. Echocardiograms obtained from sham animals were not significantly different from those recorded from WT animals. To validate this rapid semiquantitative selection process for the detection of LVH, the assignments were compared with the results obtained with quantitative M-mode based LV mass measurements1,3 in a blinded fashion. Results are expressed as means ± SEM from 18 sham and 39 TAC mice. Statistical differences between TAC and sham animals were assessed using the Student’s t-test. LV diastolic function was evaluated by the use of Doppler tissue imaging as described previously4. Trans-mitral flow velocity was obtained from a modified apical 4-chamber view with the pulse-wave Doppler sample volume positioned at the ventricular side of the mitral valve leaflets. Electrocardiograms Surface electrocardiographic (ECG) recordings were obtained from anesthetized (avertin, 0.25 mg/g, i.p.) mice, before and after (TAC) surgery. For signal detection, needle electrodes were inserted through the skin following a standard three-lead scheme (left foreleg, right foreleg and left rear leg). ECG signals were amplified with a four channel differential amplifier (model 1700, A-M Systems, San Diego, CA, USA) and data were collected using a Digidata 1200 analog/digital converter using Axoscope 8 software (Axon Instrument). ECG data were analyzed using both commercial (Clampfit 8.0, Molecular Devices, Sunnyvale, CA, USA) and custom5 softwares. RR, PR, QRS and QT interval durations, as well as J wave amplitudes, were measured 2 as previously described6,7. QT intervals were corrected (QTc) for heart rate using the formula, QTc=QT/(RR/100)1/2, with QT and RR intervals measured in ms8. Results are expressed as means ± SEM from 8 sham and 8 TAC mice. Statistical differences between TAC and sham animals were assessed using the Student’s t-test. Electrophysiological Recordings Myocytes were isolated from the left (LV) and right (RV) ventricles of TAC and sham mouse hearts by enzymatic dissociation and mechanical dispersion using previously described methods9,10. In initial experiments, whole-cell voltage-clamp recordings were obtained from (randomly dispersed) LV wall and RV wall myocytes isolated from TAC and sham animals at 7 and 9-11 days, respectively, following surgery. In experiments aimed at exploring the regional effects of LVH, the epicardial (EPI) and endocardial (ENDO) surfaces of the LV were separated using iridectomy scissors9; the resulting tissue pieces were mechanically dispersed and plated separately. Electrophysiological experiments were conducted within 24 hours of cell isolation at room temperature (22-24°C). Recording pipettes contained (in mmol/L): KCl 135, EGTA 10, HEPES 10, and glucose 5 (pH 7.4, 295-310 mOsm). The bath solution contained (in mmol/L): NaCl 136, KCl 4, MgCl2 2, CaCl2 1, CoCl2 5, tetrodotoxin 0.02, HEPES 10, and glucose 10 (pH 7.4, 295-300 mOsm). For whole-cell current-clamp recordings, tetrodotoxin and CoCl2 were omitted from the bath solution. Experiments were performed using an Axopatch 1D amplifier (Molecular Devices, Sunnyvale, CA, USA) connected to a Gateway 350-MHz Pentium computer interfaced to the recording equipment with a Digidata 1200 analog/digital interface and the pClamp 7 software package (Axon Instrument). Data were filtered at 5 KHz before storage. Recording electrodes were fabricated from soda lime glass (Gerresheimer Glass Inc., Vineland, NJ, USA), coated with Sylgard (Dow Corning, Midland, MI, USA) and fire-polished prior to 3 use. Whole-cell series resistances were routinely compensated electronically (≈ 85%); voltage errors resulting from the uncompensated series resistance were always ≤ 8 mV and were not corrected. Ca2+-independent depolarization-activated outward K+ (Kv) currents were routinely recorded in response to 4.5 s voltage steps to test potentials between -40 and +40 mV from a holding potential (HP) of -70 mV. Inwardly rectifying K+ currents (IK1) were recorded in response to 350 ms voltage steps to test potentials between -40 and -120 mV from the same HP. Whole-cell current-clamp recordings were used to obtain resting membrane potentials (Vm) and to record action potentials, evoked in response to brief (1 ms) depolarizing current injections at a frequency of 1 Hz. Voltage-clamp data were compiled and analyzed using Clampfit 8.0 (Molecular Devices, Sunnyvale, CA, USA) and Excel (Microsoft). For each cell, the spatial control of the membrane voltage was assessed by analyzing the decay of the capacitative transient evoked during brief (25 ms) subthreshold ± 10 mV voltage steps from the HP (-70 mV); only cells with capacitative transients well described by single exponentials were analyzed further. In each cell, integration of the capacitative transient recorded during these brief ± 10 mV voltage steps provided the whole-cell membrane capacitance (Cm), an estimate of cell size. Leak currents were always less then 100 pA and were not corrected. Peak Kv current at each test potential was defined as the maximum value of the outward Kv current during each 4.5 s voltage step. IK1 amplitude at each test potential was measured at the end of each 350 ms voltage steps. The time constants of inactivation (τ) of the Kv current components (Ito,f and IK,slow) and the amplitudes (A) of the individual current components (Ito,f, IK,slow and Iss) were determined from exponential fits of the decay phases of the currents using the following equation: At=A1 exp(-t/τ1)+A2 exp(-t/τ2)+Ass, where At represents the amplitude of the current at time t, A1 and τ1 and A2 and τ2, represent the 4 amplitudes (A) and the time constants (τ) of the fast (Ito,f) and the slow (IK,slow) components of current decay; Ass is the amplitude of the non-inactivating, steady-state component (Iss) of the total outward Kv current. Current densities (in pA/pF) were obtained by normalizing the current amplitudes (in pA) by the Cm (in pF). Action potential amplitudes (APA) and action potential durations at 50% (APD50) and 90% (APD90) repolarization were measured using Clampfit. All voltage- and current-clamp data are expressed as means ± SEM. The statistical significance of observed differences between groups of cells was evaluated using the Student’s ttest. In addition, to determine the statistical significance of apparent regional (EPI/ENDO) differences in the impact of TAC, multiple regression analysis was performed. RNA Preparation For the preparation of RNA, animals were sacrificed by cervical dislocation and the hearts (from TAC and sham mice) were rapidly removed. RV and LV from each heart, or EPI and ENDO from each LV, were dissected (n=6-8 in each group) and flash-frozen in liquid nitrogen for further RNA isolation. Total RNA was isolated and DNase treated using the RNeasy Fibrous Tissue Mini Kit (Qiagen, Valencia, CA, USA). The quality of total RNA was assessed by gel electrophoresis, and RNA concentration was determined by optical density measurement at 260 nm. Genomic DNA contamination was assessed by PCR amplification of total RNA samples without prior cDNA synthesis; no genomic DNA was detected. TaqMan Quantitative RT-PCR TaqMan Low Density Arrays (TLDA, Applied Biosystems, Foster City, CA, USA) were completed in a two-step RT-PCR process as described previously11. Briefly, first strand cDNA was synthesized from 2 μg of total RNA (from individual sham and TAC samples) using the 5 High-Capacity cDNA Archive Kit (Applied Biosystems, Foster City, CA, USA). PCR reactions were carried out in TLDAs using the ABI PRISM 7900HT Sequence Detection System (Applied Biosystems, Foster City, CA, USA). The 384 wells of each array were pre-loaded with 96 x 4 pre-designed FAM-labeled fluorogenic TaqMan probes and primers. The probes were labeled with the fluorescent reporter dye 6-carboxyfluorescein (FAM, Applera Corporation, Norwalk, CT, USA) on the 5’ end and with a non-fluorescent quencher on the 3’ end. The genes selected for analysis (see Online Table I) were ones encoding 68 cardiac ion channel pore-forming (α) and accessory (β) subunit proteins as well as proteins involved in ion channel regulation, 11 proteins involved in Ca2+ homeostasis, 6 transcription factors, 7 specific markers of vessels, neurons, fibroblasts, inflammation and hypertrophy, and 4 endogenous controls. Two ng of cDNA from each sample was combined with 1X TaqMan Universal Master Mix (Applied Biosystems, Foster City, CA, USA) and loaded into each well. The TLDAs were thermal-cycled at 50°C for 2 min and 94.5°C for 10 min, followed by 40 cycles of 97°C for 30 s and 59.7°C for 1 min. Data were collected with instrument spectral compensations using the Applied Biosystems SDS 2.2.2 software and analyzed using the threshold cycle (CT) relative quantification (2-∆Ct) method12. Genes with CT values >32 were not analyzed further. The hypoxanthine guanine phosphoribosyl transferase I (HPRT) gene was used as an endogenous control to normalize the experimental data. As described previously, cardiac hypertrophy results in global increases in the total RNA (Figure 5A) and protein (Figure 6A) content of the LV, as well as increased LV mass and LV mass to body weight (LVM/BW) ratio (Figure 1, Online Table II), without any increases in cell numbers13-15. To quantify transcript expression levels on a per cell basis, therefore, the TLDA (HPRT-normalized) expression data from each LV, EPI and ENDO sample were multiplied by the LVM/BW ratios determined in the 6 same (sham or TAC) animals. Results are expressed as means ± SEM from 6 mice in each group, and statistical differences between samples from TAC and sham animals were assessed using the Student’s t-test. SYBR Green Quantitative RT-PCR First strand cDNA was synthesized from 2 μg of total RNA using the High-Capacity cDNA Archive Kit (Applied Biosystems, Foster City, CA, USA). The expression levels of genes encoding the cardiac hypertrophy markers ANF (Atrial Natriuretic Factor) and β MHC (β Myosin Heavy Chain), as well as the two-pore domain K+ channels TASK1 (KCNK3), TASK2 (KCNK5) and TREK1 (KCNK2), were determined by quantitative PCR using sequence specific primer pairs and 1X SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA). PCR reactions were performed on 10 ng of cDNA in the ABI PRISM 7900HT Sequence Detection System (Applied Biosystems, Foster City, CA, USA). The cycling conditions included a hot start at 95°C for 10 min, followed by 40 cycles at 95°C for 15 s and 60°C for 1 min. Primer sequences were the following: ANF: 5’-CACTGTGGCGTGGTGAACA and 5’- TCGTGATAGATGAAGGCAGGAA; β MHC: 5’-TGAATGAGCACCGGAGCAA and 5’CTGGCTGGTGAGGTCATTGA; 5’-GCTTCCGCAACGTCTATGC TASK1: and 5’- GGGATGGAGTACTGCAGCTTCT; TASK2: 5’-TCAGATCACGTGTACAGCCATCT and 5’CATTCTTCTGTCACCATGAACACA; TREK1: 5’-CCTTTTGTGCCCAGACTGTTTC and 5’-GCAAAGCATTCAGATTCATTCATAG; and HPRT: 5’-TGAATCACGTTTGTGTCATTA GTGA and 5’-TTCAACTTGCGCTCATCTTAGG. PCR primer pairs were tested using mouse cDNA, and primers giving 90-100% efficacy, as well as single amplicons of the appropriate melting temperature or size, were selected. Negative control experiments using total RNA samples incubated without reverse transcriptase during cDNA synthesis showed no 7 amplification. Data were analyzed according to the 2-∆Ct method12. As described above for the TaqMan analysis, transcript expression data in each sham and TAC LV, EPI and ENDO sample were first normalized using the endogenous control gene HPRT, and subsequently multiplied by the LVM/BW ratios measured in the same (sham or TAC) animals. Results are expressed as means ± SEM from 6 mice in each group, and statistical differences between TAC and sham animals were assessed using the Student’s t-test. To validate these analytical methods described above (i.e., multiplication of 2-∆Ct values by the LVM/BW ratios), SYBR Green quantitative RT-PCR experiments on few channel subunits, as well as several endogenous control genes, were also conducted starting with normalized (by LVM/BW ratios) quantities of total RNA. As expected, the results of these analyses were indistinguishable from those obtained when the normalization was done on the analyzed (TaqMan or SYBR Green) RT-PCR data. Western Blot Analyses Using previously described methods16, western blot analyses were performed on total protein extracts prepared from LV, RV, LV EPI and LV ENDO of sham and TAC mice (n=3-4 in each group). Tissues were homogenized in Dounce homogenizer in 10 volumes of ice-cold lysis buffer (in mmol/L: Tris-HCl 50 (pH 7.5), EDTA 1, NaCl 150) containing protease inhibitor cocktail tablet (Roche, USA), Pefabloc (1 mmol/L), pepstatin A (1 ug/ml) and Triton X-100 (1%). After 15-min incubation with slow rotation at 4°C, the insoluble fraction was removed by centrifugation at 3000 rpm for 10 min at 4°C. Quantification of total proteins in each sample was obtained by using the BCA Protein Assay Kit (Pierce, Rockford, IL, USA). For Western blots, the total amount of (sham or TAC) sample protein loaded on to each lane of the SDS-PAGE gels was normalized to the LVM/BW ratio determined in sham and TAC animals to allow direct 8 comparisons of protein expression levels in comparable numbers of cells. Following fractionation, proteins were transferred to PVDF membranes. The following primary antibodies were used: rabbit polyclonal anti-Kv4.2, anti-Kir2.1, anti-Kir2.2 (Chemicon, Temecula, CA, USA); rabbit polyclonal anti-TASK1, anti-TASK2 and anti-TREK1 (Alomone labs, Jerusalem, Israel); mouse monoclonal anti-Kv2.1 and anti-KChIP2 (NeuroMab, Davis, CA, USA); rabbit polyclonal anti-Filamin C (Kinasource, Scotland, UK); mouse monoclonal anti-transferrin receptor (Invitrogen Corporation, Carlsbad, CA, USA); and mouse monoclonal anti-β-actin (Sigma, Saint Louis, MO, USA). The specificities of the antiKv4.2, anti-KChIP2, anti-Kv2.1 and anti-TREK1 antibodies were tested using total protein extracts from mice in which the genes encoding these subunits have been eliminated by homologous recombination16,17. In each case, no signal corresponding to the targeted channel subunit was detected. Following blocking, PVDF membranes were incubated with one of the anti-channel subunit specific antibodies, and subsequently with one of the anti-endogenous control protein antibodies. After washing, the membranes were incubated with a goat anti-rabbit or anti-mouse horseradish peroxidase-conjugated secondary antibody (Pierce, Rockford, IL, USA). Membranes were incubated with the SuperSignal West Dura Extended Duration substrate (Pierce, Rockford, IL, USA), and signal was exposed to x-ray film (Kodak, Rochester, NY, USA). Films were scanned, and the densities of specific bands were determined. Results are expressed as means ± SEM from 3-4 different sham or TAC mice. Statistical differences between TAC and sham animals were assessed using the Student’s t-test. Cell Surface Expression of K+ Channel Subunits in Mouse Ventricular Myocytes Surface biotinylation of ventricular myocytes were completed as previously described18. Briefly, freshly isolated LV myocytes from sham and TAC mice were incubated in Ringer’s 9 solution (in mmol/L: Hepes (pH 7.4) 10, NaCl 154, KCl 7.2, CaCl2 1.8) at 4oC to inhibit membrane protein internalization, followed by 1 mg/ml Sulfo-NHS-SS-Biotin (Pierce, Rockford, IL, USA) for 45 min with gentle agitation. The biotinylation reaction was quenched with Trissaline solution (in mmol/L: Tris (pH 7.4) 10, NaCl 120), the cells were extensively washed with Tris-saline solution and collected. Detergent-soluble lysates were prepared, and biotinylated cell surface proteins were affinity-purified using NeutrAvidin-conjugated agarose beads (Pierce, Rockford, IL, USA). Purified cell surface proteins were then analyzed by western blots as described above. Results are expressed as means ± SEM from 3-6 different sham or TAC mice. Statistical differences between TAC and sham animals were assessed using the Student’s t-test. 10 REFERENCES 1. Zhang S, Weinheimer C, Courtois M, Kovacs A, Zhang CE, Cheng AM, Wang Y, Muslin AJ. The role of the Grb2-p38 MAPK signaling pathway in cardiac hypertrophy and fibrosis. J Clin Invest. 2003;111:833-41. 2. Rockman HA, Ross RS, Harris AN, Knowlton KU, Steinhelper ME, Field LJ, Ross J, Jr., Chien KR. Segregation of atrial-specific and inducible expression of an atrial natriuretic factor transgene in an in vivo murine model of cardiac hypertrophy. Proc Natl Acad Sci U S A. 1991;88:8277-81. 3. Tanaka N, Dalton N, Mao L, Rockman HA, Peterson KL, Gottshall KR, Hunter JJ, Chien KR, Ross J, Jr. Transthoracic echocardiography in models of cardiac disease in the mouse. Circulation. 1996;94:1109-17. 4. Chiu HC, Kovacs A, Blanton RM, Han X, Courtois M, Weinheimer CJ, Yamada KA, Brunet S, Xu H, Nerbonne JM, Welch MJ, Fettig NM, Sharp TL, Sambandam N, Olson KM, Ory DS, Schaffer JE. Transgenic expression of fatty acid transport protein 1 in the heart causes lipotoxic cardiomyopathy. Circ Res. 2005;96:225-33. 5. McLerie M, Lopatin AN. Dominant-negative suppression of I(K1) in the mouse heart leads to altered cardiac excitability. J Mol Cell Cardiol. 2003;35:367-78. 6. London B, Guo W, Pan X, Lee JS, Shusterman V, Rocco CJ, Logothetis DA, Nerbonne JM, Hill JA. Targeted replacement of KV1.5 in the mouse leads to loss of the 4aminopyridine-sensitive component of I(K,slow) and resistance to drug-induced qt prolongation. Circ Res. 2001;88:940-6. 11 7. Liu G, Iden JB, Kovithavongs K, Gulamhusein R, Duff HJ, Kavanagh KM. In vivo temporal and spatial distribution of depolarization and repolarization and the illusive murine T wave. J Physiol. 2004;555:267-79. 8. Mitchell GF, Jeron A, Koren G. Measurement of heart rate and Q-T interval in the conscious mouse. Am J Physiol. 1998;274:H747-51. 9. Brunet S, Aimond F, Li H, Guo W, Eldstrom J, Fedida D, Yamada KA, Nerbonne JM. Heterogeneous expression of repolarizing, voltage-gated K+ currents in adult mouse ventricles. J Physiol. 2004;559:103-20. 10. Xu H, Guo W, Nerbonne JM. Four kinetically distinct depolarization-activated K+ currents in adult mouse ventricular myocytes. J Gen Physiol. 1999;113:661-78. 11. Marionneau C, Couette B, Liu J, Li H, Mangoni ME, Nargeot J, Lei M, Escande D, Demolombe S. Specific pattern of ionic channel gene expression associated with pacemaker activity in the mouse heart. J Physiol. 2005;562:223-34. 12. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402-8. 13. Bonnin CM, Sparrow MP, Taylor RR. Increased protein synthesis and degradation in the dog heart during thyroxine administration. J Mol Cell Cardiol. 1983;15:245-50. 14. Hannan RD, Jenkins A, Jenkins AK, Brandenburger Y. Cardiac hypertrophy: a matter of translation. Clin Exp Pharmacol Physiol. 2003;30:517-27. 15. Morgan HE, Gordon EE, Kira Y, Chua HL, Russo LA, Peterson CJ, McDermott PJ, Watson PA. Biochemical mechanisms of cardiac hypertrophy. Annu Rev Physiol. 1987;49:533-43. 12 16. Guo W, Jung WE, Marionneau C, Aimond F, Xu H, Yamada KA, Schwarz TL, Demolombe S, Nerbonne JM. Targeted deletion of Kv4.2 eliminates I(to,f) and results in electrical and molecular remodeling, with no evidence of ventricular hypertrophy or myocardial dysfunction. Circ Res. 2005;97:1342-50. 17. Kuo HC, Cheng CF, Clark RB, Lin JJ, Lin JL, Hoshijima M, Nguyen-Tran VT, Gu Y, Ikeda Y, Chu PH, Ross J, Giles WR, Chien KR. A defect in the Kv channel-interacting protein 2 (KChIP2) gene leads to a complete loss of I(to) and confers susceptibility to ventricular tachycardia. Cell. 2001;107:801-13. 18. Eder P, Probst D, Rosker C, Poteser M, Wolinski H, Kohlwein SD, Romanin C, Groschner K. Phospholipase C-dependent control of cardiac calcium homeostasis involves a TRPC3-NCX1 signaling complex. Cardiovasc Res. 2007;73:111-9. 13 FIGURE LEGENDS Online Figure I. Transcript expression profiling in TAC and sham LV. Mean ± SEM transcript expression (arbitrary units) of genes encoding (A) α and β subunits of Na+ and Ca2+ channels, connexins (Cx), (B) Ca2+ homeostasis regulators, and (C) cardiac hypertrophy markers in sham and TAC LV. Data are means ± SEM from 6 mice in each group. *P<0.001, #P<0.01, §P<0.05 in TAC, compared with sham, LV. 14 300 0 * 200 100 # # Online Figure I. Marionneau et al. TAC LV 10 * * * Sham LV * 0 B Sham LV 400 TAC LV 200 * * Cx43 20 mRNA Expression (AU) Sham LV TAC LV SERCA2a # Cx45 30 Ryr2 * Cx40 * PLB * Cavβ2 Cavα2δ1 * NCX1 60 IP3R-2 Casq2 * Cav3.1 Cav1.2 Navβ1 Nav2.3 2 Camk2d 40 Calm1 20 Calcineurin 2B β1 Na/K ATPase Nav1.5 Nav1.4 mRNA Expression (AU) 4 Gata 4 700 α1 skeletal actin C α2 Na/K ATPase 600 β MHC 0 α1 Na/K ATPase mRNA Expression (AU) 0 BNP mRNA Expression (AU) A 60 § 40 20 # Online Table I. Genes Analyzed by TaqMan Low Density Arrays (TLDA) Gene Protein 18S RNA Gene/Protein Name NCBI Gene Reference Assay ID Eukaryotic 18s rRNA X03205 4342379-18S Abcc8 SUR1 ATP-binding cassette, sub-family C (CFTR/MRP), member 8 NM_011510 Mm00803450_m1 Abcc9 ATP-binding cassette, sub-family C (CFTR/MRP), member 9 NM_011511 Mm00441638_m1 Acta1 SUR2 α1 skeletal actin actin, alpha 1, skeletal muscle NM_009606 Mm00808218_g1 Actn2 α2 actinin actinin alpha 2 NM_033268 Mm00473657_m1 Ank2 AnkB ankyrin 2, brain NM_178655 Mm00618325_m1 Ank3 AnkG α1 Na/K ATPase ankyrin 3, epithelial NM_146005 Mm00464776_m1 Atp1a1 ATPase, Na+/K+ transporting, alpha 1 polypeptide NM_144900 Mm00523255_m1 Atp1a2 α2 Na/K ATPase ATPase, Na+/K+ transporting, alpha 2 polypeptide NM_178405 Mm00617899_m1 Atp1b1 β1 Na/K ATPase ATPase, Na+/K+ transporting, beta 1 polypeptide NM_009721 Mm00437612_m1 Atp2a2 SERCA2a ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 NM_009722 Mm00437634_m1 Cacna1c Cav1.2 calcium channel, voltage-dependent, L type, alpha 1C subunit NM_009781 Mm00437917_m1 Cacna1g calcium channel, voltage-dependent, T type, alpha 1G subunit NM_009783 Mm00486549_m1 Cacna2d1 Cav3.1 Cavα2δ1 calcium channel, voltage-dependent, alpha2/delta subunit 1 NM_009784 Mm00486607_m1 Cacnb2 Cavβ2 calcium channel, voltage-dependent, beta 2 subunit NM_023116 Mm00659092_m1 Calm1 calmodulin 1 NM_009790 Mm00486655_m1 Camk2d Calm1 CamkIIδ calcium/calmodulin-dependent protein kinase II, delta NM_023813 Mm00499266_m1 Casq2 Casq2 calsequestrin 2 NM_009814 Mm00486742_m1 Cav3 Caveolin 3 caveolin 3 NM_007617 Mm00725536_s1 Cdh2 Cadherin 2 cadherin 2 NM_007664 Mm00483213_m1 Cnn1 calponin 1 NM_009922 Mm00487032_m1 Col1a1 Calponin 1 α1 procollagen 1 procollagen, type I, alpha 1 NM_007742 Mm00801666_g1 Dlgh1 SAP-97 discs, large homolog 1 (Drosophila) NM_007862 Mm00492174_m1 Dlgh4 PSD-95 discs, large homolog 4 (Drosophila) NM_007864 Mm00492193_m1 Dmd Dystrophin dystrophin, muscular dystrophy NM_007868 Mm00464475_m1 Dpp4 Dpp4 dipeptidylpeptidase 4 NM_010074 Mm00494548_m1 Dpp6 Dpp6 dipeptidylpeptidase 6 NM_010075 Mm00456605_m1 Dpp7 Dpp7 dipeptidylpeptidase 7 NM_031843 Mm00473420_m1 Dpp8 Dpp8 dipeptidylpeptidase 8 NM_028906 Mm00547049_m1 Dpp9 dipeptidylpeptidase 9 NM_172624 Mm00841122_m1 Dtna Dpp9 α dystrobrevin dystrobrevin alpha NM_207650 Mm00494555_m1 Flnc Filamin C, γ filamin C, gamma (actin binding protein 280) AF119148 Mm00471824_m1 Freq Frequenin frequenin homolog (Drosophila) NM_019681 Mm00490552_m1 Gapdh Gapdh glyceraldehyde-3-phosphate dehydrogenase NM_001001303 Mm99999915_g1 Gata4 Gata4 GATA binding protein 4 NM_008092 Mm00484689_m1 Gja1 Cx43 gap junction membrane channel protein alpha 1 NM_010288 Mm00439105_m1 Gja5 Cx40 gap junction membrane channel protein alpha 5 NM_008121 Mm00433619_s1 Gja7 Cx45 gap junction membrane channel protein alpha 7 NM_008122 Mm00433624_m1 Hcn2 Hcn2 hyperpolarization-activated, cyclic nucleotide-gated K+ 2 NM_008226 Mm00468538_m1 Hprt1 Hprt1 hypoxanthine guanine phosphoribosyl transferase 1 NM_013556 Mm00446968_m1 Hspa1l Hsp70 heat shock protein 1-like NM_013558 Mm00442854_m1 Hspca Hsp90 heat shock protein 1, alpha NM_010480 Mm00658568_gH Il6 IL6 interleukin 6 NM_031168 Mm00446190_m1 Irx5 Irx5 Iroquois related homeobox 5 (Drosophila) NM_018826 Mm00502107_m1 Itpr2 IP3R-2 inositol 1,4,5-triphosphate receptor 2 NM_010586 Mm00444937_m1 Kcna1 Kv1.1 potassium voltage-gated channel, shaker-related subfamily, member 1 NM_010595 Mm00439977_s1 Kcna2 Kv1.2 potassium voltage-gated channel, shaker-related subfamily, member 2 NM_008417 Mm00434584_s1 Kcna4 Kv1.4 potassium voltage-gated channel, shaker-related subfamily, member 4 NM_021275 Mm00445241_s1 Kcna5 Kv1.5 potassium voltage-gated channel, shaker-related subfamily, member 5 NM_145983 Mm00524346_s1 Kcna6 potassium voltage-gated channel, shaker-related, subfamily, member 6 NM_013568 Mm00496625_s1 Kcnab1 Kv1.6 Kvβ1 potassium voltage-gated channel, shaker-related subfamily, beta member 1 NM_010597 Mm00440018_m1 Kcnab2 Kvβ2 potassium voltage-gated channel, shaker-related subfamily, beta member 2 NM_010598 Mm00440022_m1 Kcnb1 Kv2.1 potassium voltage gated channel, Shab-related subfamily, member 1 NM_008420 Mm00492791_m1 Kcnd1 Kv4.1 potassium voltage-gated channel, Shal-related family, member 1 NM_008423 Mm00492796_m1 Kcnd2 Kv4.2 potassium voltage-gated channel, Shal-related family, member 2 NM_019697 Mm00498065_m1 Kcnd3 Kv4.3 potassium voltage-gated channel, Shal-related family, member 3 NM_019931 Mm00498260_m1 Kcne1 MinK potassium voltage-gated channel, Isk-related subfamily, member 1 X60457 Mm00434615_m1 Kcnh2 Merg potassium voltage-gated channel, subfamily H (eag-related), member 2 NM_013569 Mm00465370_m1 Kcnip1 KChIP1 Kv channel-interacting protein 1 NM_027398 Mm00471928_m1 Kcnip2 KChIP2 Kv channel-interacting protein 2 NM_030716 Mm00518914_m1 Kcnj11 Kir6.2 potassium inwardly rectifying channel, subfamily J, member 11 NM_010602 Mm00440050_s1 Kcnj12 Kir2.2 potassium inwardly-rectifying channel, subfamily J, member 12 NM_010603 Mm00440058_s1 Kcnj2 Kir2.1 potassium inwardly-rectifying channel, subfamily J, member 2 NM_008425 Mm00434616_m1 Kcnj3 Kir3.1 potassium inwardly-rectifying channel, subfamily J, member 3 NM_008426 Mm00434618_m1 Kcnj8 Kir6.1 potassium inwardly-rectifying channel, subfamily J, member 8 NM_008428 Mm00434620_m1 Kcnq1 potassium voltage-gated channel, subfamily Q, member 1 NM_008434 Mm00434641_m1 Myh7 KvLQT1 β MHC myosin, heavy polypeptide 7, cardiac muscle, beta NM_080728 Mm00600555_m1 Nedd4l Nedd4-like neural precursor cell expressed, developmentally down-regulated gene 4-like NM_031881 Mm00459584_m1 Mm00452375_m1 Nfatc4 Nfatc4 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4 NM_023699 Nos1 Nos1 nitric oxide synthase 1, neuronal NM_008712 Mm00435175_m1 Nos2 Nos2 nitric oxide synthase 2, inducible, macrophage NM_010927 Mm00440485_m1 Nos3 Nos3 nitric oxide synthase 3, endothelial cell NM_008713 Mm00435204_m1 Nppb BNP natriuretic peptide precursor type B NM_008726 Mm00435304_g1 Pias3 KChAP protein inhibitor of activated STAT 3 NM_146135 Mm00450739_m1 Pln PLB phospholamban NM_023129 Mm00452263_m1 Polr2a RNA Polymerase II polymerase (RNA) II (DNA directed) polypeptide A NM_009089 Mm00839493_m1 Ppap2b phosphatidic acid phosphatase type 2B NM_080555 Mm00504516_m1 Prkaca Calcineurin 2B PKA, catalytic, α protein kinase, cAMP dependent, catalytic, alpha NM_008854 Mm00660092_m1 Prkca PKC, α protein kinase C, alpha NM_011101 Mm00440855_m1 Prkcb1 PKC, β1 protein kinase C, beta 1 NM_008855 Mm00435749_m1 Prkcd PKC, δ protein kinase C, delta NM_011103 Mm00440891_m1 Prkce PKC, ε protein kinase C, epsilon NM_011104 Mm00440894_m1 Ryr2 ryanodine receptor 2, cardiac NM_023868 Mm00465877_m1 Scn1b Ryr2 Navβ1 sodium channel, voltage-gated, type I, beta NM_011322 Mm00441210_m1 Scn4a Nav1.4 sodium channel, voltage-gated, type IV, alpha polypeptide NM_133199 Mm00500103_m1 Scn5a Nav1.5 sodium channel, voltage-gated, type V, alpha NM_021544 Mm00451971_m1 Scn7a Nav2.3 sodium channel, voltage-gated, type VII, alpha NM_009135 Mm00801952_m1 Slc8a1 NCX1 solute carrier family 8 (sodium/calcium exchanger), member 1 NM_011406 Mm00441524_m1 Smyd1 m-Bop SET and MYND domain containing 1 NM_009762 Mm00477663_m1 Snta1 Syntrophin a1 syntrophin, acidic 1 NM_009228 Mm00486270_m1 Sntb1 Syntrophin b1 syntrophin, basic 1 NM_016667 Mm00489473_m1 Sntb2 Syntrophin b2 syntrophin, basic 2 NM_009229 Mm00486275_m1 Sod3 Sod3 superoxide dismutase 3, extracellular NM_011435 Mm00448831_s1 Stx1a Syntaxin 1A syntaxin 1A (brain) NM_016801 Mm00444008_m1 Uchl1 UCHL1 ubiquitin carboxy-terminal hydrolase L1 NM_011670 Mm00495900_m1 Zfpm2 Fog2 zinc finger protein, multitype 2 NM_011766 Mm00496074_m1 Online Table II. Echocardiographic Parameters of Sham and TAC Mice 7 Days After TAC. Sham n TAC n P value BW LVPWd IVSd LVIDd LVPWs IVSs LVIDs FS LVM LVM/BW E/A Dop Vel (g) (mm) (mm) (mm) (mm) (mm) (mm) (%) (mg) (mg/g) (RU) (m/s) 24.2 ± 0.5 0.63 ± 0.01 0.67 ± 0.01 3.42 ± 0.05 1.35 ± 0.03 1.47 ± 0.03 1.46 ± 0.05 57.5 ± 0.9 67.9 ± 1.8 2.8 ± 0.06 1.16 ± 0.05 1±0 18 18 18 18 18 18 18 18 18 18 10 18 22.5 ± 0.3 0.81 ± 0.02 0.89 ± 0.01 3.26 ± 0.04 1.46 ± 0.03 1.60 ± 0.03 1.46 ± 0.06 55.6 ± 1.5 91.4 ± 2.2 4.07 ± 0.1 1.61 ± 0.15 4.8 ± 0.09 39 39 39 39 39 39 39 39 39 39 9 39 <0.01 <0.001 <0.001 <0.05 <0.05 <0.001 NS NS <0.001 <0.001 <0.05 <0.001 All values are means ± SEM. Abbreviations: BW, body weight; LVPWd, LV posterior wall thickness at end-diastole; IVSd, interventricular septum thickness at end-diastole; LVIDd, LV internal dimension at enddiastole; LVPWs, LV posterior wall thickness at end-systole; IVSs, interventricular septum thickness at end-systole; LVIDs, LV internal dimension at end-systole; FS, fractional shortening; LVM, LV mass; LVM/BW, LV mass to body weight ratio; E/A, E/A wave ratio; RU, relative units; Dop Vel, peak flow velocity across TAC; NS, not significant. Online Table III. Resting and Active Membrane Properties of Sham and TAC LV and RV Myocytes. Sham TAC Cm Vm APD90 (mV) APA (mV) APD50 (pF) (ms) (ms) LV 127 ± 9 73 ± 1 56 ± 0.3 3 ± 0.2 25 ± 3 12 RV 107 ± 7 71 ± 1 58 ± 1.3 2 ± 0.1 10 ± 1 9 LV 170 ± 8# 69 ± 1 60 ± 0.5 5 ± 0.7 36 ± 3# 19 RV 126 ± 13 70 ± 2 58 ± 1.1 2 ± 0.2 11 ± 1 7 n All values are means ± SEM; Abbreviations: Cm, whole-cell membrane capacitance; Vm, resting membrane potential, APA, action potential amplitude; APD50 and APD90, action potential durations at 50% and 90% repolarization. #P<0.01 in TAC, compared with sham, LV myocytes. Online Table IV. ECG Parameters in Anesthetized Sham and TAC Mice Before and After Surgery. Sham QTc RR (ms) PR (ms) QRS (ms) QT (ms) (ms) J (mV) Before 124 ± 4 45 ± 1 8 ± 0.3 58 ± 2 52 ± 2 0.07 ± 0.01 After 147 ± 5 55 ± 4 9 ± 0.4 61 ± 4 50 ± 4 0.06 ± 0.02 Before 147 ± 8 49 ± 2 9 ± 0.3 62 ± 4 51 ± 4 0.05 ± 0.02 After 163 ± 9 52 ± 1 9 ± 0.5 85 ± 8§ 67 ± 6§ -0.01 ± 0.01§ n 8 TAC 8 All values are means ± SEM; Abbreviations: RR, PR, QRS, QT and QTc: RR-, PR-, QRS-, QT- and QTc-interval durations; J, J-wave amplitude. §P<0.05 in TAC, compared with sham, mice.