Download Molecular Identity of Hematopoietic Precursor Cells

From www.bloodjournal.org by guest on June 11, 2017. For personal use only.
Molecular Identity of Hematopoietic Precursor Cells Emerging
in the Human Embryo
By Marie-Claude Labastie, Fernando Cortés, Paul-Henri Roméo, Catherine Dulac, and Bruno Péault
It is now accepted from studies in animal models that
hematopoietic stem cells emerge in the para-aortic mesoderm-derived aorta-gonad-mesonephros region of the vertebrate embryo. We have previously identified the equivalent
primitive hematogenous territory in the 4- to 6-week human
embryo, under the form of CD341CD451Lin2 high proliferative potential hematopoietic cells clustered on the ventral
endothelium of the aorta. To characterize molecules involved in initial stem cell emergence, we first investigated
the expression in that territory of known early hematopoietic regulators. We herein show that aorta-associated CD341
cells coexpress the tal-1/SCL, c-myb, GATA-2, GATA-3, c-kit,
and flk-1/KDR genes, as do embryonic and fetal hematopoi-
etic progenitors later present in the liver and bone marrow.
Next, CD341CD451 aorta-associated cells were sorted by
flow cytometry from a 5-week embryo and a cDNA library
was constructed therefrom. Differential screening of that
library with total cDNA probes obtained from CD341 embryonic liver cells allowed the isolation of a kinase-related
sequence previously identified in KG-1 cells. In addition to
emerging blood stem cells, KG-1 kinase is also strikingly
expressed in all developing endothelial cells in the yolk sac
and embryo, which suggests its involvement in the genesis
of both hematopoietic and vascular cell lineages in humans.
r 1998 by The American Society of Hematology.
E
out before the establishment of circulation, the p-SP but not the
yolk sac gave rise to multipotential hematopoietic progenitors
in vitro.10 In contrast, after circulation connected the yolk sac
with the embryo, stem cells endowed with T- and B-lymphoid
potential as well as true long-term repopulating activity were
detected in both the p-SP and yolk sac.10-13 Together, these data
strongly suggested that, independently of the yolk sac, a wave
of HSCs arise within the splanchnopleural mesoderm of the
embryo between the presomitic and liver colonization stages.
Accordingly, transient clusters of CD341, c-Kit1, Flk-11 hematopoietic cells were observed during that developmental period
on the ventral aspect of the mouse aorta and omphalomesenteric
artery,14-16 reminiscent of the intra-aortic and para-aortic blood
cell foci at the origin of definitive hematopoiesis in birds.17,18
The molecular mechanisms that locally influence the emergence and primary expansion of HSCs from mesodermal
precursors remain unclear, although key regulators of these
earliest developmental steps have now been evidenced in mice.
The importance of the c-kit signaling pathway was first
discovered through the severe hematopoietic stem cell defects
that occur in Sl and W mutant mice.19,20 Other potential early
hematopoietic factors have been identified by gene targeting in
mouse embryonic stem (ES) cells. c-myb knock-out causes a
lethal deficit in definitive multipotential progenitors,21 and a
complete block in definitive hematopoietic potential is observed
in ES cells null for the expression of the GATA-2, tal-1/SCL and
AML-1 transcription factors.22-26 Inactivation of the flk-1
tyrosine kinase gene prevents yolk sac blood island formation
and endothelial development,27 but also precludes definitive
hematopoiesis even when normal vascular structures are present.16 It is not clear whether the primary emergence or the
survival and expansion of HSCs are disturbed in these experiments. However, the low numbers of HSCs retrieved in both
c-myb– and GATA-2–null mutant embryos would suggest a role
of these factors in stem cell proliferation rather than in the
commitment of primitive mesoderm to hematopoiesis.21,22,28 On
the other hand, the lack of both primitive and definitive
hematopoiesis resulting from tal-1/SCL and flk-1 targeted
mutations may suggest a common failure of extraembryonic
ARLY IN THE embryogenesis of higher vertebrates,
hematopoietic stem cells (HSCs) arise in situ in the
extraembryonic yolk sac mesoderm and produce locally a
transient wave of primitive nucleated red blood cells. Thereafter, migrating HSCs seed the successively emerging hematopoietic organ rudiments of the embryo, where they give rise to
multilineage differentiated blood cells. The last blood-forming
tissue anlage to be colonized is that of the bone marrow, in
which hematopoiesis becomes definitively stabilized at postnatal stages. Consequently, the yolk sac was long considered as
the original and only provider of self-renewing stem cells for
life-long hematopoiesis.1,2 The demonstration in birds3,4 and in
amphibians5,6 that HSCs responsible for definitive hematopoiesis do not emigrate from extraembryonic tissues but rather
originate within the splanchnopleural mesoderm of the embryo
proper prompted the search for an equivalent intraembryonic
source of HSCs in mammals. Indeed, the para-aortic splanchnopleura (p-SP) in the early mouse embryo and derived aortagonad-mesonephros (AGM) territory were found to harbor, in
parallel with the yolk sac, pluripotential hematopoietic cells
before the onset of fetal liver colonization.7-9 When dissected
From Institut d’Embryologie Cellulaire et Moléculaire-CNRS UPR
9064, Nogent-sur-Marne, France; Unité de Recherche en Hématopoı̈èse Moléculaire-INSERM U474, Hôpital Henri Mondor, Créteil,
France; and the Department of Molecular and Cellular Biology,
Howard Hughes Medical Institute, Harvard University, Cambridge,
MA.
Submitted May 18, 1998; accepted July 10, 1998.
Supported in part by grants from Association pour la Recherche sur
le Cancer. F.C. was the recipient of a fellowship from the European
Commission.
Address reprint requests to Marie-Claude Labastie, PhD, Institut
d’Embryologie Cellulaire et Moléculaire, CNRS UPR 9064, 49bis,
avenue de la Belle Gabrielle, 94736 Nogent-sur-Marne Cedex, France;
e-mail: [email protected].
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734 solely to indicate
this fact.
r 1998 by The American Society of Hematology.
0006-4971/98/9210-0020$3.00/0
3624
Blood, Vol 92, No 10 (November 15), 1998: pp 3624-3635
From www.bloodjournal.org by guest on June 11, 2017. For personal use only.
HUMAN EMBRYONIC BLOOD STEM CELL GENES
and intraembryonic mesodermal precursors to differentiate into
HSCs.29
In humans, hematopoiesis starts in the yolk sac at week 3 of
development and shifts to the liver around week 5.30,31 In an
attempt to identify the primary hematogenous territory where
definitive human HSCs originate, Huyhn et al32 evidenced high
proliferative potential CD341 clonogenic progenitors within the
embryo body deprived from its yolk sac and liver rudiment
around week 5 of gestation. Furthermore, upon immunostaining
of 4- to 6-week human embryo sections, we characterized dense
clusters of CD341 hematopoietic cells closely associated with
the ventral endothelium of the aorta33 that strongly evoked the
intravascular blood cell clumps previously observed in animal
embryos at an equivalent developmental stage.14,16,17,34,35 With
respect to spatio-temporal distribution, typical hematopoietic
stem cell surface phenotype (CD451, CD34hi, CD311, CD382,
Lin2), and high proliferative potential in vitro, these early
emerging HSCs were proposed as the intraembryonic source of
definitive hematopoiesis in the human species.33
The present work was aimed at defining the molecules
involved in the initial emergence and expansion of HSCs within
the aortic wall of the 4- to 6-week human embryo. Transcripts
expressed in HSCs from the aorta were compared with those
from the liver and bone marrow of the embryo and fetus. The
expression of surface receptors and transcription factors already
defined at the earliest steps of mouse hematopoietic development was first investigated by hybridization on embryo sections
and reverse transcription-polymerase chain reaction (RT-PCR)
analysis on HSCs sorted from 12- to 29-week fetal liver and
bone marrow. This study showed important similarities between
successive generations of embryonic and fetal HSCs. We then
searched for novel genes expressed early by the unique HSC
population arising from the human p-SP. To that end, we sorted
by flow cytometry rare aorta-associated CD341 cells from a
single embryo to construct a cDNA library from this primitive
cell population. We then performed a differential screening of
that library with amplified cDNA probes prepared from aortaassociated and embryonic liver HSCs. A novel kinase was
identified whose expression pattern suggests a role in the
development of both hematopoietic and endothelial cell lineages in humans.
MATERIALS AND METHODS
Human Tissues
Human embryos and fetal tissues were obtained from voluntary or
therapeutic abortions performed in compliance with the French legislation, after informed consent was obtained from the parents.
Tissue Processing and Section Staining
Embryos fixed overnight at 4°C in phosphate-buffered saline (PBS),
4% paraformaldehyde (vol/vol) were rinsed in PBS, dehydrated, and
included in paraffin. Five-micrometer–thick sections were immersed
three times for 7 minutes in toluene, absolute ethanol, and finally 95%
ethanol. After preincubation for 20 minutes in Tris-buffered saline,
0.25% Triton X100 (TBST) containing 5% fetal calf serum (FCS),
sections were incubated for 1 hour at room temperature with the
anti-CD34 HPCA-1 monoclonal antibody (MoAb; Becton Dickinson,
3625
San Jose, CA) diluted in TBST-2% FCS, followed by three washes in
TBST. Slides were then incubated for 30 minutes with appropriately
diluted rabbit antimouse IgG (DAKO, Glostrup, Denmark), rinsed
again with TBST, and incubated 30 minutes with diluted mouse APAAP
(antialkaline phosphatase coupled to alkaline phosphatase; DAKO).
Immune reaction was shown using the DAKO Fast Red substrate
system according to the manufacturer’s instructions. Endogenous
alkaline phosphatase activity was inhibited by adding levamisole to the
substrate solution at a final concentration of 1 mmol/L.
In Situ Hybridization
Probes. Probes for the human tal-1/SCL, GATA-2, c-kit, flk-1/
KDR, and KG-1 kinase genes were made from PCR fragments
subcloned into the pGEM-T vector (Promega, Madison, WI) and
corresponding to the following nucleotidic sequences in the Genbank
database: tal-1/SCL: nt 4082-4979, accession no. M61108; GATA-2: nt
1861-2673, accession no. M68891; c-kit: nt 4442-5077, accession no.
X06182; flk-1/KDR: nt 1593-2411, accession no. X61656; and KG-1
kinase: nt 28-922, accession no. D43636. The authenticity of the clones
and their orientation were determined by sequence analysis or by
mapping the position of the predicted restriction sites. A pGEM-3Z
plasmid containing the coding sequence of the hGATA-3 cDNA 58 to
the zinc fingers36 and a pBluescript KS plasmid containing the coding
sequence of the c-myb cDNA plus 400 bp of 38UTR (a generous gift of
Dr J. Sores, Université d’Orsay, Orsay, France) were used as templates
for the synthesis of the corresponding sense and antisense riboprobes.
In situ hybridization. In situ hybridization was performed on
sections from paraffin-embedded human embryos. Before hybridization, slides were deparaffinized and treated with proteinase K as
previously described.37 Sense and antisense riboprobes were transcribed
from T3, T7, or SP6 flanking promoters of appropriate linearized
vectors. The protocol used for synthesis and hybridization of 35Slabeled riboprobes was as previously described,37 whereas synthesis
and hybridization of digoxygenin (DIG)-labeled probes was performed
according to Myat et al.38 In case of subsequent staining with the
anti-CD34 MoAb, sections were rinsed extensively in TBST and
processed as described above. Each hybridization was performed at
least three times on tissue sections corresponding to at least two distinct
embryos.
Isolation of Fetal HSCs
Mononuclear cells from 12- to 29-week fetal liver and bone marrow
(4 distinct samples of each tissue) were obtained by sedimentation at
100g over a lymphocyte separation medium (d 5 1.077 g/mL; Eurobio,
Les Ulis, France) for 30 minutes at room temperature. The cells
recovered at the interface were washed in PBS containing 5% FCS and
2 to 4 3 107 cells were incubated for 30 minutes on ice with a mixture of
fluorescein isothiocyanate (FITC)-conjugated anti-CD34 MoAb
(HPCA-2; Becton Dickinson) and phycoerythrin (PE)-conjugated antiCD38 MoAb (Immunotech, Marseille, France) diluted 1/10 in PBS, 5%
FCS. The two populations of CD341CD381 and CD341CD382 cells
were sorted on a FACStar Plus flow cytometer (Becton Dickinson) in
the gates defined on Fig 3A. Control labeling with irrelevant IgG1-PE
and -FITC were used to determine positivity for the CD34 and CD38
antigens. Dead cells and debris were eliminated by using a high forward
and orthogonal light scatter window. After sorting, cells (104 to 105)
were pelleted and processed for RNA extraction or kept at 280°C.
RT-PCR analysis of total cellular RNA. Total RNA was isolated
from cell pellets by the RNAzol method (Tel-Test Inc, Friendswood,
TX), in 200 µL/pellet, according to the instructions of the manufacturer.
RNAs were dissolved in 20 µL H2O containing 200 ng Random Primers
(Promega) and heated at 70°C for 5 minutes. For first-strand cDNA
From www.bloodjournal.org by guest on June 11, 2017. For personal use only.
3626
LABASTIE ET AL
Table 1. Oligonucleotide Primers Used for RT-PCR Analysis of Fetal HSCs
Genes
58 Primer
38 Primer
Size* (bp)
tal-1/SCl†
c-myb
GATA-2
GATA-3
c-kit
flk-1/KDR
CD38
b-Actin
TTGGGGAGCCGGATGCCTTC
ACAGCATATATAGCAGTGACG
CCCTAAGCAGCGCAGCAAGAC
ACCCCACTGTGGCGGCGAGAT
TGTACTGCCAGTGGATGTGCA
CAACAAAGCGGAGAGGAG
ATGGCCAACTGCGAGTTCAGC
AACCGCGAGAAGATGACCCAG
CTCCCGGCTGTTGGTGAA
AGCCTGAGCAAAACCCATCAA
TGACTTCTCCTGCATGCACT
CACAGCACTAGAGACC
TCGTCATCCTCCATGATGGCG
ATGACGATGGACAAGTACCC
GACTTTGGGGAAAAAGGCTTC
TGCGCTCAGGAGGAGCAATGA
135
659
439
770
921
818
1,056
663
Primers were selected to cross introns or checked for no amplification of same-size genomic products.
*Predicted PCR product.
†PCR was performed at a 1.5 mmol/L MgCl2 final concentration and 58°C annealing temperature.
synthesis, 10 µL of a mixture containing 6 µL of 53 SuperScript buffer
(GIBCO-BRL, Paisley, Scotland), 1.5 µL of 10 mmol/L dNTPs
(Boehringer Mannheim, Mannheim, Germany), 0.5 µL of RNA guard
(Pharmacia, Uppsala, Sweden), 1 µL of 10 mmol/L dithiothreitol (DTT;
GIBCO), and 1 µL of SuperScript II reverse transcriptase (GIBCO)
were added and the reaction was performed at 37°C for 1 hour. One
thirtieth of the reaction was used for each subsequent PCR analysis,
performed in a 50 µL final volume containing 5 µL of Gene Amp 103
PCR Buffer II (Perkin Elmer, Norwalk, CT), 2.5 mmol/L MgCl2, 200
µmol/L dNTPs, and 1 U Taq polymerase (GIBCO). Approximately 1.5
pmol (50 ng) of each gene-specific primer (Table 1) was added and 35
cycles of PCR (94°C for 1 minute, 55°C for 1 minute, and 72°C for 1.5
minutes) were performed, with a final extension step of 7 minutes.
Aliquots of PCR products were agarose gel electrophoresed, transferred
onto N1 nylon membranes (Amersham, Amersham, United Kingdom),
and hybridized with specific 32P-labeled internal cDNA probes as
described below.
Isolation of Aortic and Hepatic Embryonic HSCs
The aorta and liver were microdissected and dissociated by incubation for 1 hour at 37°C in 50 µL collagenase/dispase (Boehringer)
0.25% (vol/vol) in PBS without Ca21 and Mg21. After washing, the cell
suspension was double-labeled for 30 minutes on ice with FITCHPCA-2 anti-CD34 and either PE-anti-CD45 (DAKO) or PE-antiCD38 MoAbs and sorted as above. After sorting, the cells (,60) were
directly collected in thin-walled PCR tubes (Perkin Elmer) containing
PBS, pelleted, resuspended in 4 µL ice-cold cell lysis buffer, and
immediately processed for 38cDNA synthesis.
Synthesis of Total cDNA and Southern Blot Analysis
The procedure for first-strand cDNA synthesis and amplification
from low numbers of cells sorted by fluorescence-activated cell sorting
(FACS) was derived from the protocol of Brady and Iscove39 and
performed exactly as described by Dulac and Axel.40 Aliquots of
amplified cDNAs were run on 1.5% agarose gels in Tris-borate buffer,
denatured in NaOH/NaCl, and transferred onto Hybond N1 nylon
membranes (Amersham). After prehybridization for 1 hour at 65°C in
0.5 mol/L sodium phosphate buffer (pH 7.3) containing 1% bovine
serum albumin (BSA) and 4% sodium dodecyl sulfate (SDS), hybridization was performed in the same buffer overnight at 65°C by adding 106
cpm/mL of 32P-labeled cDNA probe (Random Primer Labeling Kit;
Stratagene, La Jolla, CA). After two washes at 65°C in 0.53 SSC, 0.1%
SDS, membranes were autoradiographed on a Kodak X-OMAT film
(Eastman Kodak, Rochester, NY) for 30 minutes to 24 hours.
Probes. Probes were excised from plasmids containing the appropriate 38cDNA sequences: tal-1/SCL and GATA-2 (idem in situ hybridization); GATA-3, 0.8-kb Pst I/BamHI fragment encompassing the final
exon of the GATA-3 gene41; c-myb, 1.1-kb Xmn I-EcoRI 38 fragment of
the full-length cDNA cloned into pUC 18 (a generous gift of Dr J.
Sores); G3PDH, 1.1 kb (purchased from Clontech, Palo Alto, CA). The
CD34 (nt 1665-2555; accession no. M81104) and b-actin (nt 10421741: accession no. M10279) 38cDNAs were PCR-amplified using
human genomic DNA as a template and subcloned into the pGEM-T
vector as described above.
Construction of a cDNA Library From Purified Aortic HSCs
and Differential Screening
The procedure for cDNA library construction and differential screening was exactly as previously described.40 Briefly, 10 µL of cDNAs
from CD341CD451 aorta-associated cells was submitted to an additional polymerization step (94°C for 5 minutes, 42°C for 5 minutes, and
72°C for 30 minutes), phenol/chloroform-extracted, and EcoRIdigested. After agarose gel purification, 50 ng of cDNAs was ligated
into the l ZAP II vector (Stratagene) and packaged according to the
instructions of the manufacturer. The resulting library consisted of 9 3
105 plague forming units, with insert sizes comprised between 500 and
800 bp. Probes for differential screening were obtained by reamplifying
for 10 cycles in the presence of 100 µCi [32P] a-dCTP, 1 µL cDNAs
from CD341CD451 5-week aortic HSCs (probe 1), same-stage
CD341CD451 liver HSCs (probe 2), and 6.5-week CD341CD382 liver
HSCs (probe 3). An average of 6,000 recombinant phages were plated
and two differential screenings were performed in parallel. After a
6-hour prehybridization step at 65°C in 0.5 mol/L sodium phosphate
buffer, pH 7.3, containing 1% bovine serum albumin and 4% SDS, one
half of replica filters (Hybond N1; Amersham) was hybridized with
probes 1 and 2 and the second half was hybridized with probes 1 and 3
(107 cpm/mL, overnight at 65°C). One hundred candidate clones that
exhibited specific hybridization or much brighter intensity with the
probe 1 were isolated. Phage inserts were amplified by PCR using the
T3 and T7 primers and the PCR products were rehybridized with the
three cDNA probes on three independent Southern blots. Only clones
=
Fig 2. Expression of growth factor receptors by CD341 aortaassociated cells from 5-week human embryos. (A) All cells within
hematopoietic clusters (arrow) are uniformly labeled upon hybridization of a c-kit 35S-labeled riboprobe (original magnification 3 260). (B)
higher magnification of (A; original magnification 3 650). (C) Flk-1/
KDR transcripts are detectable in aorta endothelial cells upon hybridization of a DIG-labeled riboprobe (arrow), whereas intra-aortic
hematopoietic clusters are unlabeled (arrowhead; original magnification 3 200). (D) Hybridization of a radioactive flk-1/KDR probe allows
to evidence positive cells in the innermost layer within hematopoietic
foci (arrowhead; original magnification 3 650). No signals were
observed upon hybridization of sense riboprobes (not shown).
From www.bloodjournal.org by guest on June 11, 2017. For personal use only.
Fig 1. Expression of hematopoietic transcription factors in CD341 aorta-associated cells from 5-week human embryos. (A) Immunostaining
with an anti-CD34 antibody. Arrowheads point to hematopoietic cell clusters in the aorta. Hematoxylin counter-staining (original magnification 3 200). (B) Hybridization on an equivalent section of a tal-1/SCL radioactive probe. All cells in the intra-aortic cluster are specifically labeled
(original magnification 3 260). (C through E) Hybridization of DIG-labeled riboprobes (purple staining) specific for c-myb (C), GATA-2 (D), and
GATA-3 (E). Further incubation of these sections with an anti-CD34 antibody (red staining) shows the coexpression of both markers in
aorta-associated blood cell progenitors (original magnification 3 260). Arrows in (D) point to circulating GATA-21 cells in the lumen of the aorta
and those in E to a faint GATA-3 signal in mesenchymal cells subjacent to the ventral endothelium of the aorta. (F) GATA-3 labeling in
mesenchymal cells underlying the ventral wall of the aorta is obvious using a 35S-radiolabeled probe (arrow). Note the higher expression of
GATA-3 mRNA in the innermost cells within a large hematopoietic cluster (original magnification 3 650). No signals were observed upon
hybridization of sense riboprobes (not shown).
Fig 2.
From www.bloodjournal.org by guest on June 11, 2017. For personal use only.
3628
LABASTIE ET AL
specifically hybridizing to probe 1 were further processed for phagemid
rescue as instructed by the manufacturer (Stratagene) and sequenced.
DNA Sequencing and Sequence Analysis
DNA sequencing was performed using the PRISM Ready Reaction
Dye Deoxy Terminator Cycle Sequencing Kit (Perkin Elmer) on the
ABJ model 377 DNA Sequencer (Applied Biosystems, Foster City,
CA). Sequence comparisons with all available nucleic acids were
performed using the National Center for Biotechnology Informations’
Basic Local Alignment Search Tools [BLASTN, available at the
National Center for Biotechnology Information (NCBI) website].
RESULTS
Expression of Early Hematopoiesis-Regulating Factors
in CD341 Embryonic and Fetal Human HSCs
Expression in aorta-associated CD341 cells. In situ hybridization of digoxygenin- or 35S-labeled riboprobes on 5-week
embryo cross-sections was first used to detect the expression by
aorta-associated CD341 cells of known hematopoietic transcription factors and surface receptors. To label both endothelial and
hematopoietic cells in the region of interest, CD34 immunostaining was performed as a control either on adjacent sections,
when radiolabeled probes were used, or directly on the same
slide when labeled with a digoxygenin-labeled probe. As shown
in Fig 1, the cell clusters associated with the endothelial floor of
the 5-week aorta express mRNAs encoding the tal-1/SCL,
c-myb, GATA-2, and GATA-3 transcription factors. We noticed
a higher expression of the GATA-3 transcript in CD341 cells
that were closely adjacent to the aortic endothelium, as well as
in mesodermal cells underlying the floor of the aorta (Fig 1E
and F). Circulating CD341GATA-21 cells visible in the lumen
of the aorta (Fig 1D) might reflect the ongoing process of liver
colonization, which was shown by the presence of c-myb1 cells
scattered in the epithelial framework of the hepatic rudiment
(not shown).
Lower amounts of mRNA encoding the c-kit and flk-1/KDR
signal-transducing tyrosine kinases were evidenced only upon
hybridization of 35S-labeled probes. Whereas the c-kit messenger appeared uniformly expressed within hematopoietic cell
clusters (Fig 2A and B), the flk-1/KDR mRNA was essentially
=
Fig 3. Expression of hematopoiesis-regulating factors by HSCs
sorted from 12- to 29-week fetal liver (FL) and bone marrow (FBM). (A)
CD34/CD38 two-color stainings of mononucleated cells from 12-week
FL and 20-week FBM. The percentages of cells that fall within each of
the sorting gates are indicated. The purity of recovered populations
was ascertained by PCR-amplification of CD38 cDNA, as shown in (B).
(B) Semiquantitative RT-PCR analysis of hematopoiesis-specific genes
in the selected CD341CD381 and CD341CD382 cell subsets. Each track
is representative of at least four experiments performed on subpopulations sorted from different organs of various stages (see Materials
and Methods). Negative control with no cDNA added was included in
each PCR experiment and the product size was checked by running
molecular weight markers. The amplified products were transferred
to nylon membranes and hybridized with internal specific 32P-labeled
cDNA probes. Autoradiography was prolonged for 18 hours for
flk-1/KDR PCR products but did not exceed 2 hours for the other gene
products. Signals obtained for b-actin amplification were used as
reference to normalize quantitative differences between cDNA
samples.
From www.bloodjournal.org by guest on June 11, 2017. For personal use only.
HUMAN EMBRYONIC BLOOD STEM CELL GENES
3629
Fig 4. Schematic representation of the protocol used to sort rare double-stained CD341CD451 HSCs contained in the aorta of a single 5-week
human embryo. Less than 20 double-positive cells were finally recovered from 30,000 total cells obtained after collagenase dissociation. An
analogous protocol was used to sort CD341CD451 and CD341CD382 HSCs from a 5- and a 6.5-week embryonic liver, respectively.
confined therein to the most basal layers of cells, closest to the
vascular endothelium (Fig 2D), which itself also exhibited
flk-1/KDR intense staining (Fig 2C and D), as did the whole
vascular network of the embryo (not shown).
Expression in fetal liver and bone marrow HSCs. The
presence of hematopoiesis-associated transcripts was also examined in HSCs that later populate regular fetal blood-forming
tissues, ie, liver and bone marrow. Larger and heterogenous
hematopoietic populations are present in these organs. For this
reason, the study was performed by RT-PCR on CD341 cell
subsets sorted by FACS from 12- to 29-week fetal liver and
bone marrow. Because the expression of the CD38 cell surface
molecule defines an early step of human HSC activation and
commitment, CD381 and CD382 cells were analyzed separately
(Fig 3A). At least four distinct experiments were performed independently using different donor tissues. The absence of CD381
cells within sorted CD341CD382 subpopulations was confirmed by RT-PCR using CD38-specific primers (Fig 3B).
As shown in Fig 3B, the tal-1/SCL, c-myb, GATA-2, and
GATA-3 transcription factor mRNAs were ubiquitously expressed among subsets of liver and bone marrow fetal progeni-
tors. The c-kit and flk-1/KDR signal-transducing tyrosine
kinase messengers were also present in both CD341CD381 and
CD341CD382 fetal HSCs. However, we noticed that the
amount of PCR-amplified flk-1/KDR transcript was strikingly
lower than that of c-kit (see legend to Fig 3) and even
undetectable in some cases (not shown).
Cloning of Novel Sequences From CD341 Aorta-Associated
Blood Precursor Cells
We next looked for genes that would be differentially
expressed between the primitive population of blood precursor
cells emerging in the wall of the aorta and HSCs that had
colonized the hepatic rudiment. To that end, we constructed a
38cDNA library from 5-week aorta-associated CD341 cells
sorted by FACS and performed a differential screening of that
library with total cDNA probes prepared from aortic CD341
cells and from liver CD341 cells isolated from either samestage or 6.5-week embryos.
Preparation of 38cDNAs from aortic and hepatic CD341
embryonic hematopoietic cells. The dorsal aorta of a 5-week
embryo was microdissected on a 10- to 12-somite length
From www.bloodjournal.org by guest on June 11, 2017. For personal use only.
3630
Fig 5. Hybridization of probes for hematopoietic and housekeeping genes to cDNA samples from purified embryonic aorta-associated
and liver HSCs. The lower right panel shows the set of samples
stained with ethidium bromide before blotting onto nylon filters and
probing with the indicated 32P-labeled cDNA probes. Autoradiography times were 1 to 2 hours for b-actin and GAPDH and 8 to 24 hours
for hematopoietic genes. Ao, 5-week CD341CD451 aortic cells; 5L,
5-week CD341CD451 liver cells; 6.5L, 6.5-week CD341CD382 liver
cells.
between the anterior bifurcation and posterior connection with
the vitelline artery. After collagenase dissociation, the cell
suspension was labeled with CD34 and CD45 antibodies and
CD341CD451 double-stained cells were sorted by FACS from
CD341CD452 endothelial cells (Fig 4). The same protocol was
used to sort 5-week CD341CD451 and 6.5-week CD341CD382
cells from liver rudiments. These two populations correspond,
respectively, to the liver counterpart of aortic HSCs and to the
most primitive subset of HSCs present in a 1-week older hepatic
tissue. Less than 60 sorted cells were estimated to be recovered
from each experiment. Total cDNAs were then prepared from
LABASTIE ET AL
the three populations of hematopoietic progenitors by oligo-dT
reverse transcription and subsequent PCR, according to the
method originally described by Brady and Iscove39 and modified by Dulac and Axel.40 At least two distinct samples of
hematopoietic cells sorted from the aorta and embryonic liver
were processed for 38cDNA amplification. The representation
of these amplified cDNAs was then analyzed on Southern blots
hybridized with a panel of ubiquitous and specific probes.
Figure 5 shows Southern blot analysis of the amplified cDNAs
selected to construct the aorta-associated HSC and perform
differential screening. The reliable representation of these
cDNAs was inferred from the presence of all the transcription
factor transcripts previously characterized by in situ hybridization and RT-PCR, together with that of the CD34 messenger and
of high amounts of mRNAs encoding both b-actin and GAPDH.
Construction and differential screening of a library of
embryonic aorta-associated HSC 38cDNAs. cDNAs amplified
from FACS-sorted CD341CD451 aorta-associated cells were
ligated into phage arms to construct a representative cDNA
library. This cDNA as well as cDNAs amplified from 5-week
CD341CD451 and 6.5-week CD341CD382 embryonic liver
cells were 32P-labeled and used as probes for differential library
screening. Two differential screenings were performed in parallel. A first set of filters was hybridized with either CD341CD451
aortic HSCs cDNA probe or with cDNA probe originating from
CD341CD451 same-stage liver HSCs. A second screening was
performed with cDNA probes from CD341CD451 aortic cells
and from 6.5-week CD341CD382 hepatic HSCs. From the
screening of 6,000 recombinant phages, 100 clones were
isolated that showed specific hybridization to cDNA probe
originating from aortic HSCs. To further assess the specificity of
these clones, the corresponding inserts were amplified by PCR
and hybridized on Southern blots with the three cDNA probes
used for the differential screening according to Dulac and
Axel.40 Thanks to this sensitive screen, the specificity of 10
clones was confirmed. The sequence of one of these clones
appeared identical to a kinase-related sequence previously
isolated from the KG-1 cell line and referred to as KIAA0096.42
The expression of this transcript, hereafter designated as KG-1
kinase, was next studied by in situ hybridization on 5-week
embryo cross-sections.
Expression of KG-1-kinase mRNA in the human embryo.
Upon in situ hybridization of a radiolabeled KG-1 kinase probe,
=
Fig 6. KG-1 kinase expression pattern in the early human embryo and yolk sac. (A through C) Cross-sections through a 5-week human
embryo. (A) CD34 immunostaining (red color) is present in the whole endothelial network of the embryo. (B) Dark field illumination of an adjacent
section hybridized with the KG-1 kinase riboprobe shows identical expression pattern in blood vessels and capillaries (original magnification 3
26). (C) High magnification of (B) in the region of the aorta that shows a hematopoietic cell cluster. Note that endothelial cells (arrowheads) and
associated hematopoietic cells (arrow) are labeled, whereas no significant hybridization signal is detected on subaortic mesodermal cells
(original magnification 3 650). (D through F) CD34 expression on transverse sections of a 5-somite (D and E) and a 15-somite human embryo (F).
(D) Section through the postsomitic region of a 5-somite embryo shows CD341 cells in the yolk sac and extraembryonic mesoderm (original
magnification 3 65). (E) Detail of (D) in the yolk sac: flattened endothelial and round hematopoietic CD341 cells are clearly visible in the yolk sac
blood islands (arrows; original magnification 3 260). (F) Section through the heart region of a 15-somite embryo. CD34 staining is obvious in the
yolk sac, as well as in the endocardium and developing dorsal aortae and umbilical veins (original magnification 3 65). (G, H, and I) Dark field
illumination of sections adjacent to those shown, respectively, in (D), (E), and (F), hybridized with the KG-1 kinase riboprobe: labeling parallels
that of the CD34 antigen in both the yolk sac and embryo proper. (H) Higher magnification (original magnification 3 260) of (G; original
magnification 3 65) showing compact aggregates of labeled cells in yolk sac blood islands. The arrow in (I) points to the labeling in the
endocardium (original magnification 3 65). No signal was observed upon hybridization of a sense riboprobe (not shown). a, dorsal aorta; am,
amnios; en, endoderm; end, endocardium; ex.m, extraembryonic mesoderm; lm, lateral mesoderm; ng, neural grove; s, somite; uc, umbilical
cord; uv, umbilical vein; ys, yolk sac.
From www.bloodjournal.org by guest on June 11, 2017. For personal use only.
HUMAN EMBRYONIC BLOOD STEM CELL GENES
3631
From www.bloodjournal.org by guest on June 11, 2017. For personal use only.
3632
LABASTIE ET AL
a faint specific signal was observed within aortic CD341 blood
cell foci in a 5-week embryo (Fig 6C). Unexpectedly, the whole
endothelial network of the embryo in veins, arteries, and
capillaries also specifically expressed the KG-1 kinase messenger (Fig 6B), thus displaying an expression pattern similar to
that of the CD34 antigen (Fig 6A). This observation prompted
us to investigate more closely the ontogeny of KG-1 kinase
expression in the human embryo.
Primitive erythropoiesis occurs in the extraembryonic tissues
of vertebrates in structures known as blood islands, in which
endothelial and hematopoietic cells emerge synchronously.43,44
As judged by CD34 immunostaining on 5-somite embryos (end
of week 3 of gestation), equivalent structures where flattened
CD341 endothelial cells surround round hematopoietic CD341/cells are present in the human yolk sac at that stage (Fig 6D and
E). As shown in Fig 6G and H, KG-1 kinase mRNA is also
detected in these emerging yolk sac blood islands, whereas
blood vessels have not formed yet in the embryo. At 15 somites,
KG-1 kinase expression (Fig 6I) still parallels that of CD34 (Fig
6F) in the yolk sac, as well as in the endothelium of the main
blood vessels now developing within the embryo proper and in
the endocardium, ie, the inner endothelial lining of the heart. No
KG-1 kinase expression was ever detected in any other cell type
but hematopoietic and endothelial throughout embryonic tissues (Fig 6 and not shown). KG-1 kinase thus appears as an
early specific marker of both hematopoietic and endothelial cell
lineages in the human embryo.
DISCUSSION
The ontogeny of the hematopoietic system is not limited to
prenatal stages, since most blood cells are permanently renewed
during the whole life of the organism. It is therefore likely that
the identification of novel factors governing the emergence and
amplification of HSCs in the embryo could permit critical
improvements in the experimental and clinical manipulation of
adult HSCs. We first reasoned that blood-forming tissue rudiments should drive the active expansion of ingressing stem cells
at the stage of hematopoiesis incipience. Therefore, these could
be candidate sites for the identification of stromal cells stimulating early progenitors. Although that approach allowed us to
describe the cellular environment of emerging hematopoiesis in
the human early fetal bone marrow, no significant expansion of
progenitors could be detected at these early stages in the
medullary cavities, where blood cells even appeared to develop
in the absence of phenotypically identifiable stem cells.45
Unexpectedly, the highest local concentration of blood cell
progenitors was detected in the ventral wall of the aorta, under
the form of several hundred endothelium-adherent CD341Lin2
hematopoietic cells.33 This finding, together with converging
results obtained in animal models, suggested that aortaassociated CD341 hematopoietic cells represent the p-SP–
derived stem of the human definitive blood system.
The present study was then undertaken to analyze the
molecular events that determine the primary emergence and
expansion of these ancestral hematopoietic cells.
Expression of early hematopoiesis-regulating factors. We
show here that CD341 aorta-associated cells coexpress the
tal-1/SCL, c-myb, GATA-2, and GATA-3 mRNAs. These
transcription factors were previously identified in animal models as key players in the onset of definitive hematopoiesis.
Although their expression within intravascular clumps of hematopoietic cells present at the equivalent stage of mouse development has not been yet reported, the tal-1/SCL and GATA-2 (but
not GATA-3) transcripts were found in lymphohematopoietic
progenitors generated in mouse day-7 embryo cultures.46 tal-1,
GATA-2, and c-myb are also expressed by hematopoietic
progenitors emerging in vitro from ES cells in the course of
their differentiation into embryoid bodies.47 Moreover, tal-1,
GATA-2, GATA-3, and c-myb were shown to be continuously
transcribed in Xenopus from the stage of early neurula in both
the ventral blood islands and dorsal lateral plate, which are
equivalent to the murine yolk sac and p-SP, respectively.48
Altogether these data suggest that hematopoietic commitment
from either extraembryonic or intraembryonic mesoderm involves a similar early transcriptional program from lower
vertebrates to humans.
We also show that HSCs associated with the 5-week human
embryo aorta express two early receptor tyrosine kinase genes,
c-kit and flk-1/KDR, as does the mouse p-SP/AGM,15,16,49 in
which c-Kit1 cells are solely responsible for LTR activity.13,50
As expected, endothelial cells bordering the aortic clusters were
strongly labeled with the flk-1/KDR probe, but interestingly, we
also found a lower level of KDR mRNA in associated hematopoietic cells. This observation supports the hypothesis, first
raised from the results of knock-out experiments in mice, that
vascular endothelial growth factor (VEGF) receptor also plays a
role in hematopoietic development.16,27 However, our observation that only CD341 cells closest to the vessel wall express
detectable KDR messengers, whereas the most peripheral
CD341 cells are negative is striking. This expression gradient
may reflect the commitment to hematopoiesis of bipotential
hemangioblasts, ie, common progenitors for both endothelial
and hematopoietic cell lineages.43,51 The long-assumed existence of hemangioblasts was supported by recent experiments
performed in the quail embryo, in which VEGF-R-21 cells
sorted at the primitive streak stage could be induced to
differentiate along either hematopoietic or endothelial cell
lineages according to culture conditions.52 In mammals, the
existence of a bipotent hemangioblast is suggested by the
identification, within early differentiating embryoid bodies, of
blast colony-forming cells that develop in response to VEGF
and generate mixed cultures of endothelial and hematopoietic
cells.53,54
The hematopoietic molecular markers expressed by aortic
human HSCs were also present in embryonic and fetal HSCs
throughout development. Except for the flk-1/KDR growth
factor receptor, these markers were previously detected in adult
HSCs as well.55-59 The apparent identical expression of these
factors in both quiescent CD341CD382 and cycling
CD341CD381 cells may be explained by the persistence of the
tal-1/SCL transcription factor in the differentiating erythroid
lineage60 and by the expression of GATA-2, c-myb, and c-Kit
receptor by committed hematopoietic progenitors.59,61,62 However, of note, there was a significantly reduced amount of
From www.bloodjournal.org by guest on June 11, 2017. For personal use only.
HUMAN EMBRYONIC BLOOD STEM CELL GENES
flk-1/KDR mRNA in fetal liver and bone marrow HSCs, which
is consistent with previous findings of a dramatic reduction in
mice in the number of Flk-11 HSCs along development of the
hematopoietic system.63
Cloning of a novel early marker of hematopoietic and
endothelial development. A cDNA library differential screening method permitted us to clone a sequence already isolated
from undifferentiated KG-1 cells in a systematic attempt to
clone unidentified human genes.42 The sequence of this gene
includes a serine/threonine kinase consensus motif together
with a presumptive prenyl group-binding site42 similar to that
encountered in the Ras family of protein kinases. KG-1 kinase
shows a striking expression in vascular endothelial cells in the
whole embryo. In the late 3-week yolk sac, the earliest stage
tested so far, the KG-1 kinase mRNA is already detected in the
blood islands. This novel hematopoietic factor thus adds to the
list of markers shared by cells of these two lineages from the
early stages of development, such as MB1 in birds,64 CD34 in
mouse and human,14,33 and, to a lesser extent, flk-1/KDR.16 The
shared expression of the KG-1 kinase by endothelial and
hematopoietic cells in both intraembryonic and extraembryonic
territories of active primary hematopoiesis may be related to the
derivation of these two cell lineages from common hemangioblastic precursors. Interestingly, the closely related expression
of the KDR tyrosine and KG-1 serine/threonine kinase messengers in the early developing human embryo may imply that both
act in concert. On the other hand, the expression pattern of the
KG-1 kinase-encoding gene is reminiscent of that of cloche,
whose mutation in zebrafish dramatically perturbs both hematopoietic and endothelial differentiation.65 Because cloche acts
upstream of flk-1 and GATA-2,66 it would be of interest to
compare the expression patterns of KG-1 kinase, KDR, and
GATA-2 mRNAs in the early human embryo. The identification
of the gene encoding the mouse KG-1 kinase gene will help to
determine its expression from the stage of gastrulation and to
analyze its role in the establishment of the endothelial and
hematopoietic cell lineages through targeted mutation in ES
cells.
ACKNOWLEDGMENT
The authors are indebted to P. Vaigot for expert cell sorting by flow
cytometry and to C. Debacker for excellent technical assistance
throughout. We are grateful to H. San Clemente, F. Viala, F. Beaujean,
and S. Gournet for their help in the design and preparation of figures and
to M. Scaglia who expertly typed the manuscript. We also thank C.
Carrière and Prof E. Aubeny for procurement of first trimester embryos
and Drs M. Catala, F. Narcy, A.-L. Delezoide, and Prof C. Nessmann for
providing fetal tissues. We are thankful for the generous hospitality of
R. Axel that was essential for the further construction of the PCR-based
cDNA library from embryonic HSCs.
REFERENCES
1. Zon LI: Developmental biology of hematopoiesis. Blood 86:2876,
1995
2. Péault B: Hematopoietic stem cell emergence in embryonic life:
Developmental hematology revisited. J Hematother 5:369, 1996
3. Dieterlen-Lièvre F: On the origin of haemopoietic stem cells in
the avian embryo: An experimental approach. J Embryol Exp Morphol
33:607, 1975
3633
4. Martin C, Beaupain D, Dieterlen-Lièvre F: Developmental relationships between vitelline and intra-embryonic haemopoiesis studied in
avian ‘yolk sac chimaeras.’ Cell Differ 7:115, 1978
5. Turpen JB, Knudson CM, Hoefen PS: The early ontogeny of
hematopoietic cells studied by grafting cytogenetically labeled tissue
anlagen: Localization of a prospective stem cell compartment. Dev Biol
85:99, 1981
6. Maeno M, Tochinai S, Katagiri C: Differential participation of
ventral and dorsolateral mesoderms in the hemopoiesis of Xenopus, as
revealed in diploid-triploid or interspecific chimeras. Dev Biol 110:503,
1985
7. Godin IE, Garcia-Porrero JA, Coutinho A, Dieterlen-Lièvre F,
Marcos MA: Para-aortic splanchnopleura from early mouse embryos
contains B1a cell progenitors. Nature 364:67, 1993
8. Medvinsky AL, Samoylina NL, Muller AM, Dzierzak EA: An
early pre-liver intraembryonic source of CFU-S in the developing
mouse. Nature 364:64, 1993
9. Müller AM, Medvinsky A, Strouboulis J, Grosveld F, Dzierzak E:
Development of hematopoietic stem cell activity in the mouse embryo.
Immunity 1:291, 1994
10. Cumano A, Dieterlen-Lièvre F, Godin I: Lymphoid potential,
probed before circulation in mouse, is restricted to caudal intraembryonic splanchnopleura. Cell 86:907, 1996
11. Godin I, Dieterlen-Lièvre F, Cumano A: Emergence of multipotent hemopoietic cells in the yolk sac and paraaortic splanchnopleura in
mouse embryos, beginning at 8.5 days postcoitus. Proc Natl Acad Sci
USA 92:773, 1995
12. Medvinsky A, Dzierzak E: Definitive hematopoiesis is autonomously initiated by the AGM region. Cell 86:897, 1996
13. Yoder MC, Hiatt K, Dutt P, Mukherjee P, Bodine DM, Orlic D:
Characterization of definitive lymphohematopoietic stem cells in the
day 9 murine yolk sac. Immunity 7:335, 1997
14. Wood HB, May G, Healy L, Enver T, Morriss-Kay GM: CD34
expression patterns during early mouse development are related to
modes of blood vessel formation and reveal additional sites of
hematopoiesis. Blood 90:2300, 1997
15. Bernex F, de Sepulveda P, Kress C, Elbaz C, Delouis C, Panthier
JJ: Spatial and temporal patterns of c-kit-expressing cells in WlacZ/1 and
WlacZ/WlacZ mouse embryos. Development 122:3023, 1996
16. Shalaby F, Ho J, Stanford WL, Fischer KD, Schuch AC,
Schwartz L, Bernstein A, Rossant J: A requirement for Flk-1 in
primitive and definitive hematopoiesis and vasculogenesis. Cell 89:981,
1997
17. Dieterlen-Lièvre F: Emergence of intraembryonic blood stem
cells in avian chimeras by means of monoclonal antibodies. Dev Comp
Immunol 3:75, 1984
18. Cormier F, Dieterlen-Lièvre F: The wall of the chick embryo
aorta harbours M-CFC, G-CFC, GM-CFC and BFU-E. Development
102:279, 1988
19. Russell ES: Hereditary anemias of the mouse: A review for
geneticists. Adv Genet 20:357, 1979
20. Geissler EN, McFarland EC, Russell ES: Analysis of pleiotropism at the dominant white-spotting (W) locus of the house mouse: A
description of ten new W alleles. Genetics 97:337, 1981
21. Mucenski ML, McLain K, Kier AB, Swerdlow SH, Schreiner
CM, Miller TA, Pietryga DW, Scott WJ Jr, Potter SS: A functional
c-myb gene is required for normal murine fetal hepatic hematopoiesis.
Cell 65:677, 1991
22. Tsai FY, Keller G, Kuo FC, Weiss M, Chen J, Rosenblatt M, Alt
FA, Orkin SH: An early haematopoietic defect in mice lacking the
transcription factor GATA-2. Nature 371:221, 1994
From www.bloodjournal.org by guest on June 11, 2017. For personal use only.
3634
23. Shivdasani RA, Mayer EL, Orkin SH: Absence of blood
formation in mice lacking the T-cell leukaemia oncoprotein tal-1/SCL.
Nature 373:432, 1995
24. Robb L, Elwood NJ, Elefanty AG, Köntgen F, Li R, Barnett LD,
Begley CG: The scl gene product is required for the generation of all
hematopoietic lineages in the adult mouse. EMBO J 15:4123, 1996
25. Porcher C, Swat W, Rockwell K, Fujiwara Y, Alt FW, Orkin SH:
The T cell leukemia oncoprotein SCL/tal-1 is essential for development
of all hematopoietic lineages. Cell 86:47, 1996
26. Okuda T, Van Deursen J, Hiebert SW, Grosveld G, Downing JR:
AML1, the target of multiple chromosomal translocations in human
leukemia, is essential for normal fetal liver hematopoiesis. Cell 84:321,
1996
27. Shalaby F, Rossant J, Yamaguchi TP, Gertsenstein M, Wu XF,
Breitman ML, Schuh AC: Failure of blood-island formation and
vasculogenesis in Flk-1-deficient mice. Nature 376:62, 1995
28. Tsai FY, Orkin SH: Transcription factor GATA-2 is required for
proliferation/survival of early hematopoietic cells and mast cell formation, but not for erythroid and myeloid terminal differentiation. Blood
89:3636, 1997
29. Orkin SH: Transcription factors and hematopoietic development.
J Biol Chem 270:4955, 1995
30. Kelemen E, Calvo W, Fliedner TM: Atlas of Human Hemopoietic Development. Berlin, Germany, Springer-Verlag, 1979
31. Migliaccio G, Migliaccio AR, Petti S, Mavilio F, Russo G,
Lazzaro D, Testa U, Marinucci M, Peschle C: Human embryonic
hemopoiesis. Kinetics of progenitors and precursors underlying the
yolk sac=liver transition. J Clin Invest 78:51, 1986
32. Huyhn A, Dommergues M, Izac B, Croisille L, Katz A,
Vainchenker W, Coulombel L: Characterization of hematopoietic
progenitors from human yolk sacs and embryos. Blood 86:4474, 1995
33. Tavian M, Coulombel L, Luton D, San Clemente H, DieterlenLièvre F, Péault B: Aorta-associated CD341 hematopoietic cells in the
early human embryo. Blood 87:67, 1996
34. Garcia-Porrero JA, Godin IE, Dieterlen-Lièvre F: Potential
intraembryonic hemogenic sites at pre-liver stages in the mouse. Anat
Embryol 192:427, 1995
35. Medvinsky AL, Gan OI, Semenova ML, Samoylina NL: Development of day-8 colony-forming unit-spleen hematopoietic progenitors
during early murine embryogenesis: Spatial and temporal mapping.
Blood 87:557, 1996
36. Joulin V, Bories D, Eleouet JF, Labastie MC, Chretien S, Mattei
MG, Romeo PH: A T-cell specific TCR delta DNA binding protein is a
member of the human GATA family. EMBO J 10:1809, 1991
37. Labastie MC, Catala M, Grégoire JM, Péault B: The GATA-3
gene is expressed during human kidney embryogenesis. Kidney Int
41:1597, 1995
38. Myat A, Henrique D, Ish-Horowicz D, Lewis J: A chick
homologue of Serrate and its relationship with Notch and Delta
homologues during central neurogenesis. Dev Biol 174:233, 1996
39. Brady G, Iscove NN: Construction of cDNA libraries from single
cells. Methods Enzymol 225:611, 1993
40. Dulac C, Axel R: A novel family of genes encoding putative
pheromone receptors in mammals. Cell 83:195, 1995
41. Labastie MC, Bories D, Chabret C, Grégoire JM, Chrétien S,
Roméo PH: Structure and expression of the human GATA-3 gene.
Genomics 21:1, 1994
42. Nagase T, Miyajima N, Tanaka A, Sazuka T, Seki N, Sato S,
Tabata S, Ishikawa KI, Kawarabayasi Y, Kotani H, Nomura N:
Prediction of the coding sequences of unidentified human genes. III.
The coding sequences of 40 new genes (KIAA0081-KIAA0120)
LABASTIE ET AL
deduced by analysis of cDNA clones from human cell line KG-1. DNA
Res 2:37, 1995
43. Sabin FR: Studies on the origin of blood vessels and of red blood
corpuscles as seen in the living blastoderm of chicks during the second
day of incubation. Carnegie Institute of Washington Publication No.
272. Contrib Embryol 9:214, 1920
44. Péault B, Coltey M, Le Douarin NM: Ontogenic emergence of a
quail leukocyte/endothelium cell surface antigen. Cell Diff 23:165,
1988
45. Charbord P, Tavian M, Humeau L, Péault B: Early ontogeny of
the human marrow from long bones: An immunohistochemical study of
hematopoiesis and its microenvironment. Blood 87:4109, 1996
46. Palacios R, Imhof BA: Primitive lymphohematopoietic precursor cell lines generated in culture from day 7 early-mid-primitive streak
stage mouse embryo. EMBO J 15:6869, 1996
47. Elefanty AG, Robb L, Birner R, Begley CG: Hematopoieticspecific genes are not induced during in vitro differentiation of scl-null
embryonic stem cells. Blood 90:1435, 1997
48. Turpen JB, Kelley CM, Meaf PE, Zon LI: Bipotential primitivedefinitive hematopoietic progenitors in the vertebrate embryo. Immunity 7:325, 1997
49. Marcos MAR, Morales-Alcelay S, Godin IE, Dieterlen-Lièvre F,
Copin SG, Gaspar ML: Antigenic phenotype and gene expression
pattern of lymphohemopoietic progenitors during early mouse ontogeny. J Immunol 158:2627, 1997
50. Sánchez MJ, Holmes A, Miles C, Dzierzak E: Characterization
of the first definitive hematopoietic stem cells in the AGM and liver of
the mouse embryo. Immunity 5:513, 1996
51. Risau W, Flamme I: Vasculogenesis. Annu Rev Cell Dev Biol
11:73, 1995
52. Eichmann A, Corbel C, Nataf V, Vaigot P, Bréant C, Le Douarin
NM: Ligand-dependent development of the endothelial and hemopoietic lineages from embryonic mesodermal cells expressing vascular
endothelial growth factor receptor 2. Proc Natl Acad Sci USA 94:5141,
1997
53. Kennedy M, Firpo M, Choi K, Wall C, Robertson S, Kabrun N,
Keller G: A common precursor for primitive erythropoiesis and
definitive haematopoiesis. Nature 386:488, 1997
54. Choi K, Kennedy M, Kazarov A, Papadimitriou JC, Keller G: A
common precursor for hematopoietic and endothelial cells. Development 125:725, 1998
55. Mouthon MA, Bernard O, Mitjavila MT, Romeo PH, Vainchenker W, Mathieu-Mahul D: Expression of tal-1 and GATA-binding
proteins during human hematopoiesis. Blood 81:647, 1993
56. Labbaye C, Valtieri M, Barberi T, Meccia E, Masella B, Pelosi E,
Condorelli GL, Testa U, Peschle C: Differential expression and
functional role of GATA-2, NF-E2, and GATA-1 in normal adult
hematopoiesis. J Clin Invest 95:2346, 1995
57. Orlic D, Anderson S, Biesecker LG, Sorrentino BP, Bodine DM:
Pluripotent hematopoietic stem cells contain high levels of mRNA for
c-kit, GATA-2, p45 NF-E2, and c-myb and low levels or no mRNA for
c-fms and the receptors for granulocyte colony-stimulating factor and
interleukins 5 and 7. Proc Natl Acad Sci USA 92:4601, 1995
58. Berardi AC, Wang A, Levine JD, Lopez P, Scadden DT:
Functional isolation and characterization of human hematopoietic stem
cells. Science 267:104, 1995
59. Cheng T, Shen H, Giokas D, Gere J, Tenen DG, Scadden DT:
Temporal mapping of gene expression levels during the differentiation
of individual primary hematopoietic cells. Proc Natl Acad Sci USA
93:13158, 1996
60. Pulford K, Lecointe N, Leroy-Viard K, Jones M, Mathieu-Mahul
D, Mason DY: Expression of TAL-1 proteins in human tissues. Blood
85:675, 1995
From www.bloodjournal.org by guest on June 11, 2017. For personal use only.
HUMAN EMBRYONIC BLOOD STEM CELL GENES
61. Gewirtz AM, Calabretta B: A c-myb antisense oligodeoxynucleotide inhibits normal human hematopoiesis in vitro. Science 242:1303,
1988
62. Briddell RA, Broudy VC, Bruno E, Brandt JE, Srour EF,
Hoffman R: Further phenotypic characterization and isolation of human
hematopoietic progenitor cells using a monoclonal antibody to the c-kit
receptor. Blood 79:3159, 1992
63. Kabrun N, Bühring HJ, Choi K, Ullrich A, Risau W, Keller G:
Flk-1 expression defines a population of early embryonic hematopoietic
precursors. Development 124:2039, 1997
3635
64. Péault BM, Thiery JP, Le Douarin NM: Surface marker for
hemopoietic and endothelial cell lineages in quail that is defined by a
monoclonal antibody. Proc Natl Acad Sci USA 80:2976, 1983
65. Stainier DYR, Weinstein BM, Detrich HW, Zon LI, Fishman
MC: Cloche, an early acting zebrafish gene, is required by both the
endothelial and hematopoietic lineages. Development 121:3141, 1995
66. Liao W, Bisgrove BW, Sawyer H, Hug B, Bell B, Peters K,
Grunwald DJ, Stainier YR: The zebrafish gene cloche acts upstream of a
flk-1 homologue to regulate endothelial cell differentiation. Development 124:381, 1997
From www.bloodjournal.org by guest on June 11, 2017. For personal use only.
1998 92: 3624-3635
Molecular Identity of Hematopoietic Precursor Cells Emerging in the
Human Embryo
Marie-Claude Labastie, Fernando Cortés, Paul-Henri Roméo, Catherine Dulac and Bruno Péault
Updated information and services can be found at:
http://www.bloodjournal.org/content/92/10/3624.full.html
Articles on similar topics can be found in the following Blood collections
Hematopoiesis and Stem Cells (3430 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of
Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.