* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Genetic Engineering Laboratory Announcements One
Non-coding DNA wikipedia , lookup
Community fingerprinting wikipedia , lookup
Genome evolution wikipedia , lookup
Molecular cloning wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Synthetic biology wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Personalized medicine wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Genetic Engineering Laboratory Announcements Constructing a Phage λ Library • Exam Short Answer – Back today; average = 22.2/25 • Presentation marks – Back today; average = 8.8/10 • Assignment marks – Back next Tuesday • Quiz #2 - next Tuesday • Lab website – Good genetic engineering links 2 Biology 162 Laboratory #4 - Genetic Engineering Lab Joseph W. Brown - February 7, 2006 One-Minute Paper Feedback Genetic Engineering • All life contains similar genetic machinery • This similarity allows splicing together of unrelated genes – Amplify gene of interest – Modify genes – Move genes • Study properties/defects of genes • Quiz #1 – Fair, but too long • Participation points – Unfair to require questions – Alternatives? 3 Biology 162 Laboratory #4 - Genetic Engineering Lab Joseph W. Brown - February 7, 2006 4 Biology 162 Laboratory #4 - Genetic Engineering Lab Joseph W. Brown - February 7, 2006 1 Laboratory Goals Plasmids • Double stranded circular DNA ‘chromosome’ – Occurs naturally, though modified for our uses – Similar to mtDNA - relatively short, few genes – However, not essential to organism (normally) – Replicates independently of the host – Can have many (many) copies per cell • A plasmid is a vector in the sense that it can carry DNA from one organism to another • To learn important concepts and jargon in genetic engineering • To perform hands-on cloning • To understand and implement the selection/ screening process • To learn the ‘sterile technique’ 5 6 Biology 162 Laboratory #4 - Genetic Engineering Lab Joseph W. Brown - February 7, 2006 Biology 162 Laboratory #4 - Genetic Engineering Lab Joseph W. Brown - February 7, 2006 Restriction Endonucleases Example Enzyme • Cut double-stranded DNA fragments at specific nucleotide sequences (4-6 bases) – Also called “restriction enzymes” – Break phosphodiester bonds between nucleotides – Different enzymes recognize different patterns – Some cleave “cleanly” and leave “blunt ends” – Others make “staggered cuts” and leave “sticky ends” - overhanging of nucleotides – Type of end left is important in ligation stage BamHI AGTCCAGAGGATCCTACAGGATAGACGAATAGACCA TCAGGTCTCCTAGGATGTCCTATCTGCTTATCTGGT “sticky ends” AGTCCAGAG GATCCTACAGGATAGACGAATAG TCAGGTCTCCTAG GATGTCCTATCTGCTTATC 7 Biology 162 Laboratory #4 - Genetic Engineering Lab Joseph W. Brown - February 7, 2006 8 Biology 162 Laboratory #4 - Genetic Engineering Lab Joseph W. Brown - February 7, 2006 2 Ligation Transformation • Forms phosphodiester bonds between DNA fragments via the enzyme DNA Ligase – Opposite function of restriction enzymes – Only joins ends that are compatible • Any Blunt with any Blunt • Specific Sticky with specific Sticky • Important to note that ligation is “blind” – Will join any compatible ends (very inefficient) • Most cells do not readily take up DNA – Have nucleases and impermeable membranes nucleases – Griffith was lucky • Many cells can be made transformable membrane – Treatment with MgCl2 and CaCl2 • Transformation efficiency is very low – Only a few insertions will be ‘correct’ – Only a few cells pick up plasmids 9 Biology 162 Laboratory #4 - Genetic Engineering Lab Joseph W. Brown - February 7, 2006 10 Biology 162 Laboratory #4 - Genetic Engineering Lab Joseph W. Brown - February 7, 2006 Cloning • The process of putting a gene of interest into a plasmid for the purpose of making many copies of the gene within an organism – Also called Genetic Engineering or Recombinant DNA technology – Involves cleaving both plasmid and target DNA with restriction enzymes, followed by ligation and transformation (putting plasmid in a cell) – Must use compatible enzymes on both fragments * Transformation Biology 162 Laboratory #4 - Genetic Engineering Lab Joseph W. Brown - February 7, 2006 11 12 Biology 162 Laboratory #4 - Genetic Engineering Lab Joseph W. Brown - February 7, 2006 3 Selection/Screening Plasmid for today - pGEM3z • Required to determine which cells (if any) contain the desired DNA fragment – Use genes present on plasmid but not in native cell • Selection: determine which cells contain a plasmid • Screening: from those above, determine which cells contain a recombinant plasmid • Our strain of E. coli (DH5α) cells have their lacZ genes ‘knocked out’ – These cells will not be able to metabolize lactose How can we use this for our purposes? Carries two genes: 1) bla - codes for ß-lactamase - breaks down ampicillin - allows bacteria to survive in a normally lethal medium - use this gene for selection/screening purposes - cells cannot survive exposure to ampicillin 13 Biology 162 Laboratory #4 - Genetic Engineering Lab Joseph W. Brown - February 7, 2006 14 Biology 162 Laboratory #4 - Genetic Engineering Lab Joseph W. Brown - February 7, 2006 IS A PHAGE ALIVE? Phage λ Plasmid for today - pGEM3z • A bacteriophage, or ‘phage’ is simply a virus that infects bacteria – Has genes for invasion and reproduction – Read lab manual for further information • We will clone phage λ DNA into pGEM3z – Gene library - a collection of various pieces of genetic material that altogether provide a good representation of the genome as a whole Carries two genes: 2) lacZ - metabolism of lactose - β-galactosidase - can break down ‘X-Gal’ (similar structure) to a blue product - gene is induced by IPTG (see lab manual) - also good for selection/screening - cannot break down X-Gal without lacZ gene 15 Biology 162 Laboratory #4 - Genetic Engineering Lab Joseph W. Brown - February 7, 2006 16 Biology 162 Laboratory #4 - Genetic Engineering Lab Joseph W. Brown - February 7, 2006 4 Cloning Today • Following cloning we must check to see if we were successful – Plasmids come with genes we can use to screen cells – i.e. genes that allow growth in a normally lethal medium • We will begin our three part laboratory by constructing a phage λ gene library – Vector and phage DNA have been pre-cut • You must: – Perform ligation – Transform recombinant plasmids – Set up selection/screening process 17 Biology 162 Laboratory #4 - Genetic Engineering Lab Joseph W. Brown - February 7, 2006 18 Biology 162 Laboratory #4 - Genetic Engineering Lab Joseph W. Brown - February 7, 2006 Protocol For Today Sterile Technique 1) Ligation (already done) – Incubate 45 minutes at room temperature – Exams/presentation marks back 2) Add competent cells – Incubate on ice for 20 minutes – Learn sterile technique 3) Incubate at 42˚C for 2 minutes 4) Plate 100 µL cells • Introduction of foreign DNA will compromise our results • Therefore, everything we use must be first sterilized • I will walk you through this, plus we will purposely contaminate a control plate to the observe results 19 Biology 162 Laboratory #4 - Genetic Engineering Lab Joseph W. Brown - February 7, 2006 20 Biology 162 Laboratory #4 - Genetic Engineering Lab Joseph W. Brown - February 7, 2006 5 Coming Days • Discussion: more genetic engineering – Get Ctools notes* • Next week: – Continue with Genetic Engineering laboratory – Quiz #2 (Tuesday) • Assignment #2 – Questions 1-5 on page #60 – Due: February 16 (Discussion) 21 Biology 162 Laboratory #4 - Genetic Engineering Lab Joseph W. Brown - February 7, 2006 6