Download Genetic Engineering Laboratory Announcements One

Genetic Engineering Laboratory
Announcements
Constructing a Phage λ Library
• Exam Short Answer
– Back today; average = 22.2/25
• Presentation marks
– Back today; average = 8.8/10
• Assignment marks
– Back next Tuesday
• Quiz #2 - next Tuesday
• Lab website
– Good genetic engineering links
2
Biology 162 Laboratory #4 - Genetic Engineering Lab
Joseph W. Brown - February 7, 2006
One-Minute Paper Feedback
Genetic Engineering
• All life contains similar genetic machinery
• This similarity allows splicing together of
unrelated genes
– Amplify gene of interest
– Modify genes
– Move genes
• Study properties/defects of genes
• Quiz #1
– Fair, but too long
• Participation points
– Unfair to require questions
– Alternatives?
3
Biology 162 Laboratory #4 - Genetic Engineering Lab
Joseph W. Brown - February 7, 2006
4
Biology 162 Laboratory #4 - Genetic Engineering Lab
Joseph W. Brown - February 7, 2006
1
Laboratory Goals
Plasmids
• Double stranded circular DNA ‘chromosome’
– Occurs naturally, though modified for our uses
– Similar to mtDNA - relatively short, few genes
– However, not essential to organism (normally)
– Replicates independently of the host
– Can have many (many) copies per cell
• A plasmid is a vector in the sense that it can carry
DNA from one organism to another
• To learn important concepts and jargon in genetic
engineering
• To perform hands-on cloning
• To understand and implement the selection/
screening process
• To learn the ‘sterile technique’
5
6
Biology 162 Laboratory #4 - Genetic Engineering Lab
Joseph W. Brown - February 7, 2006
Biology 162 Laboratory #4 - Genetic Engineering Lab
Joseph W. Brown - February 7, 2006
Restriction Endonucleases
Example Enzyme
• Cut double-stranded DNA fragments at specific
nucleotide sequences (4-6 bases)
– Also called “restriction enzymes”
– Break phosphodiester bonds between nucleotides
– Different enzymes recognize different patterns
– Some cleave “cleanly” and leave “blunt ends”
– Others make “staggered cuts” and leave “sticky
ends” - overhanging of nucleotides
– Type of end left is important in ligation stage
BamHI
AGTCCAGAGGATCCTACAGGATAGACGAATAGACCA
TCAGGTCTCCTAGGATGTCCTATCTGCTTATCTGGT
“sticky ends”
AGTCCAGAG
GATCCTACAGGATAGACGAATAG
TCAGGTCTCCTAG
GATGTCCTATCTGCTTATC
7
Biology 162 Laboratory #4 - Genetic Engineering Lab
Joseph W. Brown - February 7, 2006
8
Biology 162 Laboratory #4 - Genetic Engineering Lab
Joseph W. Brown - February 7, 2006
2
Ligation
Transformation
• Forms phosphodiester bonds between DNA fragments
via the enzyme DNA Ligase
– Opposite function of restriction enzymes
– Only joins ends that are compatible
• Any Blunt with any Blunt
• Specific Sticky with specific Sticky
• Important to note that ligation is “blind”
– Will join any compatible ends (very inefficient)
• Most cells do not readily take up DNA
– Have nucleases and impermeable membranes
nucleases
– Griffith was lucky
• Many cells can be made transformable membrane
– Treatment with MgCl2 and CaCl2
• Transformation efficiency is very low
– Only a few insertions will be ‘correct’
– Only a few cells pick up plasmids
9
Biology 162 Laboratory #4 - Genetic Engineering Lab
Joseph W. Brown - February 7, 2006
10
Biology 162 Laboratory #4 - Genetic Engineering Lab
Joseph W. Brown - February 7, 2006
Cloning
• The process of putting a gene of interest into a plasmid
for the purpose of making many copies of the gene
within an organism
– Also called Genetic Engineering or Recombinant DNA
technology
– Involves cleaving both plasmid and target DNA with
restriction enzymes, followed by ligation and
transformation (putting plasmid in a cell)
– Must use compatible enzymes on both fragments *
Transformation
Biology 162 Laboratory #4 - Genetic Engineering Lab
Joseph W. Brown - February 7, 2006
11
12
Biology 162 Laboratory #4 - Genetic Engineering Lab
Joseph W. Brown - February 7, 2006
3
Selection/Screening
Plasmid for today - pGEM3z
• Required to determine which cells (if any) contain the
desired DNA fragment
– Use genes present on plasmid but not in native cell
• Selection: determine which cells contain a plasmid
• Screening: from those above, determine which cells
contain a recombinant plasmid
• Our strain of E. coli (DH5α) cells have their lacZ genes
‘knocked out’
– These cells will not be able to metabolize lactose
How can we use this for our purposes?
Carries two genes:
1) bla - codes for ß-lactamase
- breaks down ampicillin
- allows bacteria to survive in a
normally lethal medium
- use this gene for selection/screening purposes
- cells cannot survive exposure to ampicillin
13
Biology 162 Laboratory #4 - Genetic Engineering Lab
Joseph W. Brown - February 7, 2006
14
Biology 162 Laboratory #4 - Genetic Engineering Lab
Joseph W. Brown - February 7, 2006
IS A PHAGE ALIVE?
Phage λ
Plasmid for today - pGEM3z
• A bacteriophage, or ‘phage’ is simply a virus that
infects bacteria
– Has genes for invasion and reproduction
– Read lab manual for further information
• We will clone phage λ DNA into pGEM3z
– Gene library - a collection of various pieces of
genetic material that altogether provide a good
representation of the genome as a whole
Carries two genes:
2) lacZ - metabolism of lactose
- β-galactosidase
- can break down ‘X-Gal’ (similar
structure) to a blue product
- gene is induced by IPTG (see lab manual)
- also good for selection/screening
- cannot break down X-Gal without lacZ gene
15
Biology 162 Laboratory #4 - Genetic Engineering Lab
Joseph W. Brown - February 7, 2006
16
Biology 162 Laboratory #4 - Genetic Engineering Lab
Joseph W. Brown - February 7, 2006
4
Cloning
Today
• Following cloning we
must check to see if we
were successful
– Plasmids come with
genes we can use to
screen cells
– i.e. genes that allow
growth in a normally
lethal medium
• We will begin our three part laboratory by
constructing a phage λ gene library
– Vector and phage DNA have been pre-cut
• You must:
– Perform ligation
– Transform recombinant plasmids
– Set up selection/screening process
17
Biology 162 Laboratory #4 - Genetic Engineering Lab
Joseph W. Brown - February 7, 2006
18
Biology 162 Laboratory #4 - Genetic Engineering Lab
Joseph W. Brown - February 7, 2006
Protocol For Today
Sterile Technique
1) Ligation (already done)
– Incubate 45 minutes at room temperature
– Exams/presentation marks back
2) Add competent cells
– Incubate on ice for 20 minutes
– Learn sterile technique
3) Incubate at 42˚C for 2 minutes
4) Plate 100 µL cells
• Introduction of foreign DNA will
compromise our results
• Therefore, everything we use must be
first sterilized
• I will walk you through this, plus we
will purposely contaminate a control
plate to the observe results
19
Biology 162 Laboratory #4 - Genetic Engineering Lab
Joseph W. Brown - February 7, 2006
20
Biology 162 Laboratory #4 - Genetic Engineering Lab
Joseph W. Brown - February 7, 2006
5
Coming Days
• Discussion: more genetic engineering
– Get Ctools notes*
• Next week:
– Continue with Genetic
Engineering laboratory
– Quiz #2 (Tuesday)
• Assignment #2
– Questions 1-5 on page #60
– Due: February 16 (Discussion)
21
Biology 162 Laboratory #4 - Genetic Engineering Lab
Joseph W. Brown - February 7, 2006
6