• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Foundations in Microbiology
Foundations in Microbiology

Equilibrium Statistics of Channel-confined DNA
Equilibrium Statistics of Channel-confined DNA

... of different experimental techniques [31, 33], showing that it is a good model of DNA, except when subjected to very high forces [34, 35], or in the presence of positive polyvalent ions [36]. The contour length can be directly computed from the lateral distance between base pairs as L = (Number of b ...
Tuning Biphenyl Dioxygenase for Extended Substrate Specificity
Tuning Biphenyl Dioxygenase for Extended Substrate Specificity

... 1986; Bopp, 1986). Due to its broad substrate specificity, it was used as the starting template for generating variant enzymes that can act on an extended set of PCB congeners. Because substrate specificity is determined mainly by the bphA region, only this gene fragment was subjected to directed ev ...
Chapter 10 - McGraw Hill Higher Education
Chapter 10 - McGraw Hill Higher Education

... The sequence of the entire human genome was reported on June 26, 2000 It consists of 3.2 billion base pairs If the human genome were a book It would be 500,000 pages long It would take about 60 years to read at the rate of 8 hours a day, every day, at five bases a second ...
Sperm Cell in ART
Sperm Cell in ART

... of the infertile patients who had a F1 below 50% had a ratio outside this range (Khara et al., 1997). Carrel and Liu (2001) describe the undetectable protamine 2 in infertile males. ...
PDF - Molecular Cytogenetics
PDF - Molecular Cytogenetics

... the translocation present in the proband and his sister was maternally inherited. The coincident and unexpected finding of mosaicism of X-chromosome in the aunt (C3) and grandmother (G1) is intriguing. Chromosomal mosaicisms are not heritable since they always occur as post-zygotic segregation anoma ...
Original Article:
Original Article:

... colonies to find the spa type of the minor population. So far very few studies have focused on this issue. In one study by Cespedes et al. the authors have shown that in nasal carriage less than 10% are colonized by more than one strain. Their approach, cultivation of three colonies from each sample ...
Intelligent Icons: Integrating Lite-Weight Data Mining
Intelligent Icons: Integrating Lite-Weight Data Mining

... One could apply this simple mapping to a set of DNA sequences corresponding to different species and examine the icons in a file browser. Unsurprisingly however (and unfortunately for human vanity) there is very little difference between the icons obtained in this way for most mammals. In an attempt ...
PERL - unimore.it
PERL - unimore.it

... $dna=“GCCTACCGTTCCACCAAAAAAAA”; # string -double quotes $dna=‘GCCTACCGTTCCACCAAAAAAAA’; # string -single quotes ...
Variables
Variables

... $dna=“GCCTACCGTTCCACCAAAAAAAA”; # string -double quotes $dna=‘GCCTACCGTTCCACCAAAAAAAA’; # string -single quotes ...
16S rRNA characterization of Bacillus strain and its
16S rRNA characterization of Bacillus strain and its

7. molecular genetics.
7. molecular genetics.

... Each time a somatic cell divides, two daughter cells are produced. Each of these cells receives an identical copy of the parent cell´s genetic information. ...
Inheritance of Nuclear DNA Markers in Gynogenetic Haploid Pink
Inheritance of Nuclear DNA Markers in Gynogenetic Haploid Pink

... problems are likely to be even more serious in organisms such as salmonids that, as a result of their polyploid ancestry, have more duplicated loci. PCR primers designed without detailed knowledge of differences between paralogous loci may or may not amplify sequences from both loci. Moreover, even ...
pdf
pdf

... from natural transposable elements and vice versa. Since viruses move between individuals, at least some transposable elements can move between genomes (between individuals) as well as within an individual’s genome. Given their prevalence in genomes, the function (if any) of transposable elements ha ...
Illustrating Python via Bioinformatics Examples
Illustrating Python via Bioinformatics Examples

... Department of Informatics, University of Oslo ...
imbalances within regions containing large
imbalances within regions containing large

... dot indicates a reported inversion breakpoint; A green dot to the left of a region indicates that it overlaps with segmental duplication and/or is within 100k of a gap ...
The Functions of Introns: From Junk DNA to Designed DNA
The Functions of Introns: From Junk DNA to Designed DNA

... All genes begin with exons (the protein-coding segments), but most have a variable number of introns within them that alternate with the exons. Introns were discovered in 1977 as a result of observing that the mRNA used to code for proteins was almost always shorter than the DNA from which it had be ...
Cloning, DNA nucleotide sequence and distribution
Cloning, DNA nucleotide sequence and distribution

... 18000 and 16500. A Shine-Dalgarno ribosome-binding consensus sequence, GGAGA, was located at position 65-69, exactly 9 bp upstream of the second ATG start codon (position 79). The first ATG start codon (position 46) was located within a region showing the potential to form a significant hairpin loop ...
Use of a novel cassette to label phenotypically a cryptic plasmid of
Use of a novel cassette to label phenotypically a cryptic plasmid of

... microfuge tubes and 50 pl of protoplast suspension with 2-5 pl DNA, 150 pl PEG and 500 pl SPA could be used simply to transfer plasmids into a new strain. Estimation of plasmid stability. Stationary-phase cultures of bacteria carrying the plasmid under test were grown with antibiotic selection and t ...
Damage Control: The Pleiotropy of DNA Repair Genes
Damage Control: The Pleiotropy of DNA Repair Genes

Biotechnology Explorer™ Ligation and Transformation - Bio-Rad
Biotechnology Explorer™ Ligation and Transformation - Bio-Rad

... designed to express a cDNA (complementary DNA) in a mammalian cell line, which is different again from one designed to add a tag to a protein for easy purification. The primary characteristics of any good vector include: ...
spectroscopic studies of mosquito iridescent virus, its capsid
spectroscopic studies of mosquito iridescent virus, its capsid

... orescence excitation spectra were recorded at room temperature with a Varian Cary Eclipse fluorescent spectrophotometer, while an MPF-4 Hitachi spectrofluorimeter was used for measuring the fluorescence and phosphorescence spectra at liquid helium temperature. In both cases, a pulsed xenon lamp with ...
High throughput nucleic acid sample preparation in 96 well plates
High throughput nucleic acid sample preparation in 96 well plates

... 53 different saliva samples of randomly selected volunteers were extracted after stabilization for 2 – 4 weeks at room temperature. 500 µl of stabilized saliva was used for manual extraction and were measured by photometric analysis. An average DNA yield of about 25 µg / 500 µl sample was obtained. ...
Add Health Biomarker - Carolina Population Center
Add Health Biomarker - Carolina Population Center

Biotechnology Explorer - Bio-Rad
Biotechnology Explorer - Bio-Rad

... With the pGLO transformation kit, students use a simple procedure to transform bacteria with a gene that codes for Green Fluorescent Protein (GFP). The real-life source of this gene is the bioluminescent jellyfish Aequorea victoria, and GFP causes the jellyfish to fluoresce and glow in the dark. Fol ...
< 1 ... 25 26 27 28 29 30 31 32 33 ... 492 >

DNA supercoil



DNA supercoiling refers to the over- or under-winding of a DNA strand, and is an expression of the strain on that strand. Supercoiling is important in a number of biological processes, such as compacting DNA. Additionally, certain enzymes such as topoisomerases are able to change DNA topology to facilitate functions such as DNA replication or transcription. Mathematical expressions are used to describe supercoiling by comparing different coiled states to relaxed B-form DNA.As a general rule, the DNA of most organisms is negatively supercoiled.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report