• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Macromolecule Review (PP)
Macromolecule Review (PP)

... repellent for bird’s feathers ...
BB350 Lecture 36 Highlights
BB350 Lecture 36 Highlights

... 12. ATCase is the primary regulatory enzyme of pyrimidine biosynthesis. It provides balance between purines and pyrimidines, since it is activated by a purine (ATP) and inactivated by a pyrimidine (CTP). 13. Pyrimidine synthesis also includes very simple precursors, such as amino acids. The first py ...
UV-Induced DNA Damage and Repair
UV-Induced DNA Damage and Repair

... mutagenesis in Drosophila. Henri's discovery was not followed up because many people at that time did not believe that bacteria even had genes or genetic systems! It was not until the ascendance of bacteriophage genetics in the 1940’s that Demerec sdemonstrated a 103 X enrichment of E. coli T1-resis ...
Wzór streszczenia/Abstract form:
Wzór streszczenia/Abstract form:

... Oxidative stress influences DNA and other biomolecules damage via oxidative changes to their chemical structure. These changes are believed to increase the risk of cancer, heart disease and aging processes. It has been demonstrated that antioxidants such as ascorbic acid, tocopherols and flavonoids ...
ch_07_study guide
ch_07_study guide

... bind to other proteins to form chromatin fibers. Eukaryotic cells also contain extrachromosomal DNA in mitochondria, chloroplasts, and plasmids. DNA Replication DNA replication is a simple concept: A cell separates the two original strands and uses each strand as a template for the synthesis of a ne ...
View/Open - Oregon State University
View/Open - Oregon State University

... (UAA, UGA, UAG) tell the ribosome to STOP translating. A start codon (AUG) is among the 61 above. 3. The genetic code is universal (all cells use the same code - only very rare exception have very slightly altered codes) 4. Codons you should know include the codon that always starts translation (AUG ...
Recombinant DNA Technology
Recombinant DNA Technology

Acids and Bases Lab
Acids and Bases Lab

... The man ____ ____ ____ ____ ____ ____ ____ ____ Insert a R after the h  the three letter words should shift down The man hit Delete the I here ...
TransformationSimulation
TransformationSimulation

Initiation
Initiation

... 1. Initiation – attachment of mRNA to the ribosome (This was already covered in Step # 3) 2. Elongation – the addition of amino acids to the growing protein chain A Site ...
Ch 20- Mini Clicker Review Qs
Ch 20- Mini Clicker Review Qs

... Gene expression refers to the transcription and translation of a gene or set of genes. Gene regulation refers to the control of gene expression. Hybridization is the process by which two complementary strands of nucleic acid base pair to one another to form a duplex. If two strands of nucleic acid a ...
Transcription and Translation Review Lesson Plan
Transcription and Translation Review Lesson Plan

... National Science Education Standard B. Grades 9-12. The Molecular Basis of Heredity. In all organisms, the instructions for specifying the characteristics of the organism are carried in DNA, a large polymer formed from subunits of four kinds (A, G, C, and T). The chemical and structural properties o ...
PPT Blank
PPT Blank

... ____________= 3 fatty acids + 1 glycerol ____________: all single bonds in chain - solid at room temp (ex: butter, lard) ____________: one or more C=C bond in chain - liquid at room temp (ex: all oils) ...
Lab5CysticFibroShort
Lab5CysticFibroShort

... To find the CF gene, geneticists looked for markers (fragments of identifiable DNA) on specific chromosomes by comparing the DNA of CF-affected individuals to DNA of people without the disease. Eventually, it was determined that the gene codes for a protein channel and is located on chromosome 7. Yo ...
Dominant trait - Integrated Science 3
Dominant trait - Integrated Science 3

... Long pieces of DNA which contains genes DNA from two different species, recombined for a purpose Manufactures proteins using mRNA and tRNA Three nitrogen bases together, code for an amino acid Science term for offspring or “kids” Matching chromosomes, based on length, color when stained, and type of ...
BDS Ist YEAR EXAMINATION 2008-09
BDS Ist YEAR EXAMINATION 2008-09

... The patient responded to the treatment by the drugallopurinol. What is the diagnosis of the disease? Discuss the clinical interpretation of data and mechanism of action of the drug allopuinol. ...
Lecture 8. DNA AND THE LANGUAGE OF LIFE
Lecture 8. DNA AND THE LANGUAGE OF LIFE

... • The then created a new molecule of two strands of nucleotides wound around each other, called a double helix. • Their model had the sugar-phosphate backbones on the outside of the double helix and the nitrogenous bases on the inside. • They hypothesized that the bonds between the bases were hydrog ...
Restriction Enzymes by Dr. Ty C.M. Hoffman
Restriction Enzymes by Dr. Ty C.M. Hoffman

... The  table  shows  just  a  sample  of  the  many  restriction  endonucleases  that  have  been  discovered  (and   the  bacterial  species  in  which  they  were  discovered).  While  restriction  endonucleases  are  naturally   used  by ...
Evidence of relationships between organisms
Evidence of relationships between organisms

... DNA of the new species will initially be very similar. • Due to mutations the sequences of nucleotide bases in DNA changes. • Over time the new species will accumulate more differences in its DNA. • Therefore we would expect species that are more closely related to have more similarities in their DN ...
1 - web.biosci.utexas.edu
1 - web.biosci.utexas.edu

Cells: The Living Units Part 2
Cells: The Living Units Part 2

... o Genes that cause cancer ...
mi-PCR Purification Kit Troubleshooting Guide
mi-PCR Purification Kit Troubleshooting Guide

File
File

... methionine. This tells the protein synthesis process to begin. When this signal is given, the nRNA slides along the ribosome to the next codon. e. Another tRNA molecule carrying an amino acid will pair with the mRNA codon, and so on, and so on, down the chain. f. When the different amino acids are s ...
The Central Dogma of Molecular Biology - APBiology2010-2011
The Central Dogma of Molecular Biology - APBiology2010-2011

... amino acids into proteins encoded into DNA? • There are 20 amino acids, but there are only four nucleotide bases in DNA • How many bases correspond to an amino acid? ...
tacaatccgttat g c cactcatgattagagtcgcgg gatt
tacaatccgttat g c cactcatgattagagtcgcgg gatt

... DNA is the molecule of life. It contains genes that provide the code to make proteins that control an organism’s functions. It is shaped like a double helix which allows it to replicate itself. Once it divides, each cell will have identical DNA and function the same way. If the body needs to make a ...
< 1 ... 812 813 814 815 816 817 818 819 820 ... 1036 >

Nucleic acid analogue



Nucleic acid analogues are compounds which are analogous (structurally similar) to naturally occurring RNA and DNA, used in medicine and in molecular biology research.Nucleic acids are chains of nucleotides, which are composed of three parts: a phosphate backbone, a pucker-shaped pentose sugar, either ribose or deoxyribose, and one of four nucleobases.An analogue may have any of these altered. Typically the analogue nucleobases confer, among other things, different base pairing and base stacking properties. Examples include universal bases, which can pair with all four canonical bases, and phosphate-sugar backbone analogues such as PNA, which affect the properties of the chain (PNA can even form a triple helix).Nucleic acid analogues are also called Xeno Nucleic Acid and represent one of the main pillars of xenobiology, the design of new-to-nature forms of life based on alternative biochemistries.Artificial nucleic acids include peptide nucleic acid (PNA), Morpholino and locked nucleic acid (LNA), as well as glycol nucleic acid (GNA) and threose nucleic acid (TNA). Each of these is distinguished from naturally occurring DNA or RNA by changes to the backbone of the molecule.In May 2014, researchers announced that they had successfully introduced two new artificial nucleotides into bacterial DNA, and by including individual artificial nucleotides in the culture media, were able to passage the bacteria 24 times; they did not create mRNA or proteins able to use the artificial nucleotides. The artificial nucleotides featured 2 fused aromatic rings.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report