Macromolecule Expert Sheets
... (We will also learn about phospholipids and waxes later in the year.) 2. Give an example of how each is used in living organisms. Fats (triglycerides) – generally used for energy storage (also cushion organs and insulate) Steroids – Cholesterol helps stabilize membranes. Others act as hormones ...
... (We will also learn about phospholipids and waxes later in the year.) 2. Give an example of how each is used in living organisms. Fats (triglycerides) – generally used for energy storage (also cushion organs and insulate) Steroids – Cholesterol helps stabilize membranes. Others act as hormones ...
Genetic changes - Southington Public Schools
... Mutations in gametes will be passed to the offspring. Types of mutations 1. Point mutations—a change in a single base of a DNA chain. This results in a different “message.” Example: normal sequence THE DOG BIT THE CAT mutation THE DOG BIT THE CAR Sense mutation: the changed codon makes a differe ...
... Mutations in gametes will be passed to the offspring. Types of mutations 1. Point mutations—a change in a single base of a DNA chain. This results in a different “message.” Example: normal sequence THE DOG BIT THE CAT mutation THE DOG BIT THE CAR Sense mutation: the changed codon makes a differe ...
Assessment Schedule – 2005 Biology: Describe gene expression
... joins new nucleotides to the unzipped DNA during replication. It joins the new nucleotides from the 3’ end to the 5’ end only / in one direction only. Because DNA polymerase only works from the 3’ end to the 5’ end it has to form the DNA in short segments on the lagging strand. ...
... joins new nucleotides to the unzipped DNA during replication. It joins the new nucleotides from the 3’ end to the 5’ end only / in one direction only. Because DNA polymerase only works from the 3’ end to the 5’ end it has to form the DNA in short segments on the lagging strand. ...
tacttgaaagttcaccggagg
... the tRNA has an amino acid (a.a.) attached to it and the anticodon matches up with the codon on the mRNA and this continues until the mRNA has a STOP codon. This sequence stops protein synthesis. SO- the mRNA sequence controls which amino acids are going to be put together and in what order. Remembe ...
... the tRNA has an amino acid (a.a.) attached to it and the anticodon matches up with the codon on the mRNA and this continues until the mRNA has a STOP codon. This sequence stops protein synthesis. SO- the mRNA sequence controls which amino acids are going to be put together and in what order. Remembe ...
The Genetic Science Glossary - Canadian Council of Churches
... RNA which functions as a blueprint for manufacturing specific sequences of amino acids to produce proteins. Mitochondrial DNA Genetic material found in mitochondria. Mitochondria are involved in the production of energy in a cell. Mitochondria (and, therefore, mitochondrial DNA) are inherited only f ...
... RNA which functions as a blueprint for manufacturing specific sequences of amino acids to produce proteins. Mitochondrial DNA Genetic material found in mitochondria. Mitochondria are involved in the production of energy in a cell. Mitochondria (and, therefore, mitochondrial DNA) are inherited only f ...
Document
... and produced via DNA cloning • Add radioactive phosphorus to DNA • Divide DNA into 4 groups that undergo different chemical treatments that break DNA into pieces • DNA pieces are separated by gel electrophoresis and banding patterns are analyzed to reveal sequence of bases ...
... and produced via DNA cloning • Add radioactive phosphorus to DNA • Divide DNA into 4 groups that undergo different chemical treatments that break DNA into pieces • DNA pieces are separated by gel electrophoresis and banding patterns are analyzed to reveal sequence of bases ...
review_for_final_exam_jan_2016
... what is produced. Be able to use the correct terminology and to define the vocabulary terms listed on page 300 of your text. you are able to show the sequence for a DNA information strand, template strand, mRNA, anticodons when given only one of these. you can determine which amino acids are cre ...
... what is produced. Be able to use the correct terminology and to define the vocabulary terms listed on page 300 of your text. you are able to show the sequence for a DNA information strand, template strand, mRNA, anticodons when given only one of these. you can determine which amino acids are cre ...
Lab 1
... Background on Sickle Cell Anemia (Source: Ward's Natural Science) Sickle cell anemia is a hereditary blood disease due to a defect in the hemoglobin protein structure. The hemoglobin in people with sickle cell anemia differs from normal hemoglobin at a single amino acid. Normal hemoglobin (HbA) con ...
... Background on Sickle Cell Anemia (Source: Ward's Natural Science) Sickle cell anemia is a hereditary blood disease due to a defect in the hemoglobin protein structure. The hemoglobin in people with sickle cell anemia differs from normal hemoglobin at a single amino acid. Normal hemoglobin (HbA) con ...
LOYOLA COLLEGE (AUTONOMOUS), CHENNAI – 600 034
... Define isoelectric point of an amino acid. Mention the components of the nucleus and give their functions. Define enzyme immobilization. What happens during rancidification? How is starch different from glycogen? What are sterols? Give an example. What is Sanger’s reagent? Mention its use. What are ...
... Define isoelectric point of an amino acid. Mention the components of the nucleus and give their functions. Define enzyme immobilization. What happens during rancidification? How is starch different from glycogen? What are sterols? Give an example. What is Sanger’s reagent? Mention its use. What are ...
Ch. 17 - Ltcconline.net
... 4. ribosomes 5. pre-mRNA or primary transcript B. Genetic Information written in codons is translated into protein sequences 1. codons 2. template strand 3. transcription 4. translation 5. reading frame C. code of life 1. two different codons can code for same amino acid 2. redundancy in the code, b ...
... 4. ribosomes 5. pre-mRNA or primary transcript B. Genetic Information written in codons is translated into protein sequences 1. codons 2. template strand 3. transcription 4. translation 5. reading frame C. code of life 1. two different codons can code for same amino acid 2. redundancy in the code, b ...
Chapter 12 - WordPress.com
... certain nitrogen bases and provide enough force to hold the two strands together • Hydrogen bonds could only form between certain base pairs adenine and thymine and guanine and cytosine • This principal is called Base pairing • This explains Chargaff’s Rule ...
... certain nitrogen bases and provide enough force to hold the two strands together • Hydrogen bonds could only form between certain base pairs adenine and thymine and guanine and cytosine • This principal is called Base pairing • This explains Chargaff’s Rule ...
SAT II Protein Synthesis
... 10. E, RNA is active during translation 11. The enzyme used in transcription is D, RNA polymerase 12. Protein synthesis takes place outside the nucleus in the cytoplasm or C 39. Use the base pairing rules to find the DNA (just include Ts not Us) so the answer should be D 40. mRNA does not have deoxy ...
... 10. E, RNA is active during translation 11. The enzyme used in transcription is D, RNA polymerase 12. Protein synthesis takes place outside the nucleus in the cytoplasm or C 39. Use the base pairing rules to find the DNA (just include Ts not Us) so the answer should be D 40. mRNA does not have deoxy ...
Test Review Answers - Northwest ISD Moodle
... 6. What is the chemical formula for water? H2O . Is water considered organic? (YES OR NO). Why? To be organic, a substance needs to contain carbon. Water does not contain carbon! 7. Enzymes are specialized proteins that help catalyze reactions. What two things can affect enzyme function? Temperature ...
... 6. What is the chemical formula for water? H2O . Is water considered organic? (YES OR NO). Why? To be organic, a substance needs to contain carbon. Water does not contain carbon! 7. Enzymes are specialized proteins that help catalyze reactions. What two things can affect enzyme function? Temperature ...
Life: The Science of Biology, 8e
... inside cells; many have RNA instead of DNA so reverse the process. Synthesis of DNA from RNA is called reverse transcription. Viruses that do this are called retroviruses ...
... inside cells; many have RNA instead of DNA so reverse the process. Synthesis of DNA from RNA is called reverse transcription. Viruses that do this are called retroviruses ...
amino acid
... transfers information blueprint for new cells blueprint for next generation proteins ...
... transfers information blueprint for new cells blueprint for next generation proteins ...
File - cOACH RICH`S BIOLOGY CLASS
... • The exact copying of DNA • Replication occurs in both directions • DNA must be copied before cells divide each daughter cell has a complete set of DNA • Original strands serve as templates for new strands ...
... • The exact copying of DNA • Replication occurs in both directions • DNA must be copied before cells divide each daughter cell has a complete set of DNA • Original strands serve as templates for new strands ...
Asymptotics of RNA Shapes: secondary structure
... Computational molecular biology is concerned with the development of mathematical models and novel algorithms to solve fundamental problems of molecular biology in the post-genome era. A central problem of structural biology concerns the algorithmic prediction of the structure of RNA and protein fro ...
... Computational molecular biology is concerned with the development of mathematical models and novel algorithms to solve fundamental problems of molecular biology in the post-genome era. A central problem of structural biology concerns the algorithmic prediction of the structure of RNA and protein fro ...
Additional Slides Ch Biotech Dr Violet
... gene of interest. • If the sequence of the gene is unknown, the amino acid sequence of the protein-that is the gene product-may be used to construct a probe. Short, single-stranded DNA sequences (15-30 nucleotides) are synthesized, using the genetic code as a guide. • Because of the degeneracy of th ...
... gene of interest. • If the sequence of the gene is unknown, the amino acid sequence of the protein-that is the gene product-may be used to construct a probe. Short, single-stranded DNA sequences (15-30 nucleotides) are synthesized, using the genetic code as a guide. • Because of the degeneracy of th ...
DNA webquest
... (text), answer the questions below, and then click “OK.” 1. In a real cell, what does the DNA molecule do before it unzips? 2. What molecules break the rungs (bases) apart? Drag the correct bases over to “synthesize” the new DNA halves. Read the script, answer the questions below and then click “OK. ...
... (text), answer the questions below, and then click “OK.” 1. In a real cell, what does the DNA molecule do before it unzips? 2. What molecules break the rungs (bases) apart? Drag the correct bases over to “synthesize” the new DNA halves. Read the script, answer the questions below and then click “OK. ...
Nucleic acid analogue
Nucleic acid analogues are compounds which are analogous (structurally similar) to naturally occurring RNA and DNA, used in medicine and in molecular biology research.Nucleic acids are chains of nucleotides, which are composed of three parts: a phosphate backbone, a pucker-shaped pentose sugar, either ribose or deoxyribose, and one of four nucleobases.An analogue may have any of these altered. Typically the analogue nucleobases confer, among other things, different base pairing and base stacking properties. Examples include universal bases, which can pair with all four canonical bases, and phosphate-sugar backbone analogues such as PNA, which affect the properties of the chain (PNA can even form a triple helix).Nucleic acid analogues are also called Xeno Nucleic Acid and represent one of the main pillars of xenobiology, the design of new-to-nature forms of life based on alternative biochemistries.Artificial nucleic acids include peptide nucleic acid (PNA), Morpholino and locked nucleic acid (LNA), as well as glycol nucleic acid (GNA) and threose nucleic acid (TNA). Each of these is distinguished from naturally occurring DNA or RNA by changes to the backbone of the molecule.In May 2014, researchers announced that they had successfully introduced two new artificial nucleotides into bacterial DNA, and by including individual artificial nucleotides in the culture media, were able to passage the bacteria 24 times; they did not create mRNA or proteins able to use the artificial nucleotides. The artificial nucleotides featured 2 fused aromatic rings.