• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Variations in amino acid composition in bacterial single stranded
Variations in amino acid composition in bacterial single stranded

... Two domains with three distinctive elements can be found in the SSBs: N-terminal domain which forms DNA-binding domain (OB-fold), and C-terminal domain which is a largely unstructured region often rich in glycine and proline residues with a conserved acidic Cterminal motif. While studying structure/ ...
Building proteins from C, coordinates using the dihedral probability
Building proteins from C, coordinates using the dihedral probability

... correlation between the backboneenergy and the RMSfit to the crystal structure backbone. The backboneof the crystal structure itself has an energy of 759.8 kcal/mol, higher than 12 of the 20 model conformations. Thisis likely due to limitations of the force field, to effects of crystal packing and s ...
Determination of Protein Concentrations Using AAA
Determination of Protein Concentrations Using AAA

... hindrance. Proteins with an exceptionally low composition of dye-binding amino acids (e.g., collagen) produce lower color development and thus underestimate the protein content when calibrated against a dissimilar protein (e.g., BSA). Under conditions where the accuracy of protein determination is a ...
The CamSol Method of Rational Design of Protein Mutants with
The CamSol Method of Rational Design of Protein Mutants with

... represents also a major biotechnological issue, preventing many proteins to be produced at economically convenient yields [13,20,22]. Effective experimental approaches to improve protein solubility during recombinant expression include the use of weak promoters, modified growth media, low temperatur ...
167 renal and small intestinal sodium
167 renal and small intestinal sodium

... transporter, additional Na+/Pi symporters have been identified in cDNA libraries from mouse and human kidney cortex (Chong et al. 1993; S. S. Chong, unpublished data). An intestinal apical Na+/Pi symport system has not yet been identified by expression cloning. However, it has recently been demonstr ...
Enzymatic activation of sulfur for incorporation into biomolecules in
Enzymatic activation of sulfur for incorporation into biomolecules in

... NifS although it fulfills more general roles in the cell. This became evident when IscS was identified in A. vinelandii and it was found that in contrast to NifS its gene could not be inactivated (Zheng et al., 1998). The iscS gene of A. vinelandii is located at the 5 0 end of an operon, which also ...
Separation of Recombinant Human Erythropoietin (rEPO
Separation of Recombinant Human Erythropoietin (rEPO

... Recombinant human EPO protein is one of the most widely produced by many bio and pharmaceutical companies throughout the world for therapeutic agents. Erythropoietin protein (EPO) is a glycoprotein hormone found in plasma. It is a cytokine for erythrocyte (red blood cell) precursors in the bone marr ...
E. coli
E. coli

...  The property that distinguishes these two groups is the presence of the EPEC adherence factor plasmid (pEAF), which is only found in tEPEC  aEPEC strains are emerging enteropathogens that have been detected worldwide  The large variety of serotypes and genetic virulence properties of aEPEC strai ...
Thiele et al.: `Genome-scale reconstruction of E. coli`s transcriptional
Thiele et al.: `Genome-scale reconstruction of E. coli`s transcriptional

... 1 nadph + 1 h --> 1 nadp ...
magamtol talalt cikkek
magamtol talalt cikkek

... groove on the surface of PP1c through a short conserved binding motif--the RVxF motif-which is often preceded by further basic residues. Weaker interactions may subsequently enhance binding and modulate PP1 activity/specificity in a variety of ways. Several putative targeting subunits do not possess ...
Novel Riboswitch Ligand Analogs as Selective Inhibitors of Guanine
Novel Riboswitch Ligand Analogs as Selective Inhibitors of Guanine

... possible to design novel antibiotics that bind to guanine riboswitches and therefore inhibit bacterial growth. Pyrimidine-based molecules that could fit into the guanine riboswitch aptamer binding site were selected based on molecular modeling of crystal structures [26,27] (Figure 2A). Using this ap ...
Lipid profiling and transcriptomic analysis reveals a functional
Lipid profiling and transcriptomic analysis reveals a functional

... pharmacological doses of E2 in humans inhibits GH-regulated endocrine (e.g., IGF-I) and metabolic (e.g., lipid oxidation, protein synthesis) effects [22,23] but these effects are attenuated when E2 is administered transdermally, suggesting that liver is the major target of regulatory cross-talk betw ...
Autotaxin–Lysophosphatidic Acid Axis Acts Downstream of
Autotaxin–Lysophosphatidic Acid Axis Acts Downstream of

... Figure IA and IB in the online-only Data Supplement). After sorting, RNA was extracted and hybridized to an Agilent 4×44 microarray. The data were analyzed to compare between the outcomes of (1) high and normal lipoprotein levels (apoCII versus WT), (2) low and normal lipoprotein levels (stl versus ...
Production of exopolysaccharide from mycelial culture of Grifola
Production of exopolysaccharide from mycelial culture of Grifola

... Exopolysaccharide (EPS) was prepared by submerged mycelial culture of a newly isolated mushroom Grifola frondosa HB0071 in a 5-l stirred-tank fermenter. This fungus produced a high concentration of biomass (24.8 g l1 at day 4), thereby achieving high EPS concentration (7.2 g l1 at day 4). EPS was ...
Folic Acid and Its Receptors - OPUS
Folic Acid and Its Receptors - OPUS

... folic acid property: the ability to create folate on their own. Folate cannot cross cell walls by diffusion or active transport, into or out of the cell. Cell walls are made of peptidoglycan, crosslinked sugars and amino acids that does not allow for folic acid, or other polar molecules, to pass thr ...
Supplements - Haiyuan Yu
Supplements - Haiyuan Yu

... web server. In defining these paths, we have attempted to avoid spurious results by minimizing the number of steps in each traversal, avoiding descending and climbing the graph in a single traversal, and minimizing the number of databases used. For instance, when converting from Ensembl Gene to RefS ...
Genomics Insights esTs from seeds to Assist the selective Breeding
Genomics Insights esTs from seeds to Assist the selective Breeding

... of J. curcas, a premature push to ­cultivate it could prove to be very unproductive. There is a critical need for scientific ­breeding of Jatropha guided by advanced DNA mapping technologies.15,16 Individuals of J. curcas exhibit high phenotypic interaction with the environment, which makes DNA prob ...
Nonphosphorylating Glyceraldehyde-3-Phosphate
Nonphosphorylating Glyceraldehyde-3-Phosphate

... conserving 100% SnRK activity for at least 3 months. Following this method, the SnRK from wheat endosperm was approximately 18-fold purified, as the specific activity (determined by measuring the incorporation of radioactivity from [32P]g-ATP into npGa3PDHase; see details in “Materials and Methods”) ...
Protein structure
Protein structure

... structure is directly related to the level of accuracy at which atomic positions are known. From Bragg’s Law, we know that the more finely the unit cell is sampled, the closer together the Bragg planes become. At smaller d-spacings, the Bragg requirement that, for a spot to be observed, the total pa ...


... Choice C: Pick any super-secondary structure. Describe, or sketch, its structure and briefly discuss the intramolecular forces that stabilize it. β-α-β an alpha helix placed on top of a two stranded β-sheet (2 pts) H-bonds would stabilize the individual secondary structures. (2 pts) The sheet would ...
Production of exopolysaccharide from mycelial culture of Grifola
Production of exopolysaccharide from mycelial culture of Grifola

... Exopolysaccharide (EPS) was prepared by submerged mycelial culture of a newly isolated mushroom Grifola frondosa HB0071 in a 5-l stirred-tank fermenter. This fungus produced a high concentration of biomass (24.8 g l1 at day 4), thereby achieving high EPS concentration (7.2 g l1 at day 4). EPS was ...
Functional characterization of polypeptide release factor 1b in the
Functional characterization of polypeptide release factor 1b in the

... recognize all three stop codons UAA, UAG and UGA to correctly complete the termination process of protein biosynthesis. The read-through assay was performed to address why Eob/Sc eRF1 could not support the viability of the above yeast cells. The hybrid gene Eob/Sc eRF1 was transformed into yeast str ...
The extraction of collagen protein from pigskin
The extraction of collagen protein from pigskin

... The salting out method Similar to the general protein, collagen proteins also have the properties of salt soluble and salting out. Then different types of collagen proteins can be separated using the relationship between different collagen proteins and salt concentrations. Salting out method is main ...
T-cell Acute Lymphoblastic Leukemia-The
T-cell Acute Lymphoblastic Leukemia-The

... terminal amino acids of SCL/tal excluding the basic domain but including the HLH domain, was constructed in the same way as pCWB, except with a different 5'mer: S'GCTCTACAGCCATGCAGCAGAATGTGAACGGGGCCTTT 3'. pS-3, a construct encoding the full-length SCL/tal product was derived by excising a 1.2-kb Hi ...
Arabidopsis Contains Nine Long-Chain Acyl
Arabidopsis Contains Nine Long-Chain Acyl

... Eleven members of the superfamily contained apparent linker domains near the expected sites within the deduced amino acid sequences. Figure 1A compares the structures and sequences of one candidate LACS enzyme (LACS1) with an acetyl-CoA synthetase and a 4-coumarate-CoA ligase. The four common domain ...
< 1 ... 24 25 26 27 28 29 30 31 32 ... 221 >

Expression vector

An expression vector, otherwise known as an expression construct, is usually a plasmid or virus designed for protein expression in cells. The vector is used to introduce a specific gene into a target cell, and can commandeer the cell's mechanism for protein synthesis to produce the protein encoded by the gene. Expression vectors are the basic tools in biotechnology for the production of proteins.The plasmid is engineered to contain regulatory sequences that act as enhancer and promoter regions and lead to efficient transcription of the gene carried on the expression vector. The goal of a well-designed expression vector is the production of protein, and this may be achieve by the production of significant amount of stable messenger RNA, which can then be translated into protein. The protein may be expressed constitutively, or induced when necessary using an inducer. Escherichia coli is commonly used as the host for protein expression, other cell types however may also be used. An example of the use of expression vector is the production of insulin which is used for medical treatments of diabetes.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report