• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
from_Bi_150_molbiol
from_Bi_150_molbiol

... single-nucleotide polymorphisms (SNPs) ...
ReliaTech GmbH Recombinant Human p16
ReliaTech GmbH Recombinant Human p16

... p16-INK4a is a nuclear protein that regulates the cell cycle by inhibiting cyclin dependent kinase-4 (CDK4) and CDK6. p16-INK4a inhibits CDK activity by binding to the CDK molecules in a manner that interferes with their ability to interact with cyclin D. This activity has the effect of suppressing ...
Supporting Information Legends Supplementary Table S1
Supporting Information Legends Supplementary Table S1

... from where it is retrieved by SlSUT2 back into the plant root cells. Efflux might potentially be mediated by still uncharacterized SWEET proteins which are known to act as sugar efflux carrier (Chen et al., 2010). Alternatively, sucrose is cleaved by the cell wall invertase LIN6 that is inducible by ...
Analysis of 3 dimensional interactions in DNA and chromatin
Analysis of 3 dimensional interactions in DNA and chromatin

... Human genome is composed of approximately 22 000 protein coding genes. All the somatic cells in the human body contain exactly the same genes, so why do we have various different cell types and tissues? The answer lies on strictly regulated gene expression. During the differentiation some genes are ...
“bDNA for gene expression in plant and animal tissue”
“bDNA for gene expression in plant and animal tissue”

... “bDNA for gene expression in plant and animal tissue” December 2nd, 2014 at 12:00-1:00pm Genomics bldg. Room 1102A Speaker: Harry Vacek, Quantigene Specialist Please RSVP to [email protected] food will be provided for RSVPs Measure up to 80 genes or 4 RNA targets in 1 sample Imagine if you c ...
EE150a – Genomic Signal and Information Processing
EE150a – Genomic Signal and Information Processing

... linked via sugar-phosphate bonds (strong), strands are linked via hydrogen bonds (weak) • Genome is the part of DNA that encodes proteins: – …AACTCGCATCGAACTCTAAGTC… genetics.gsk.com/ graphics/dna-big.gif ...
Chapter 16 - Recombinant DNA
Chapter 16 - Recombinant DNA

... • DNA spliced into plasmid DNA can be replicated in cells • "Expression" vectors have regulatory DNA segments for cells to transcribe and translate inserted foreign DNA • Expression vectors are specialized for their host organism ...
Chapter 17 Applications of Molecular Genetics
Chapter 17 Applications of Molecular Genetics

... Key Points Valuable proteins that could be isolated from eukaryotes only in small amounts and at great expense can now be produced in large quantities in genetically engineered bacteria. Proteins such as human insulin and human growth hormone are valuable pharmaceuticals used to treat diabetes an ...
Ch 15 - .Gene Regulation
Ch 15 - .Gene Regulation

... Ex. Lac operon ...
Slide 1
Slide 1

... ...
Bioinformatics Needs for the post
Bioinformatics Needs for the post

... • We are conducting genome wide scans for RNA regulatory elements and RNA genes using state of the art comparative genomics tools. • The analysis involves comparison of the human and mouse genomes using tools such as stochastic context-free grammars ...
Lecture Slides
Lecture Slides

... ASD are in large parte genetic conditions but many ASD-genes are not identified yet Whole exome and whole genome analysis accelerated discoveries ...
Final Report
Final Report

... of Noxo1 is that they have identical sequences with the exception of the gamma form having a five amino acid insert in the lipid-binding domain. Even though they are sequentially very similar, the two forms have differences in how active the enzyme complex is, where the proteins are located in a cel ...
< 1 ... 217 218 219 220 221

Expression vector

An expression vector, otherwise known as an expression construct, is usually a plasmid or virus designed for protein expression in cells. The vector is used to introduce a specific gene into a target cell, and can commandeer the cell's mechanism for protein synthesis to produce the protein encoded by the gene. Expression vectors are the basic tools in biotechnology for the production of proteins.The plasmid is engineered to contain regulatory sequences that act as enhancer and promoter regions and lead to efficient transcription of the gene carried on the expression vector. The goal of a well-designed expression vector is the production of protein, and this may be achieve by the production of significant amount of stable messenger RNA, which can then be translated into protein. The protein may be expressed constitutively, or induced when necessary using an inducer. Escherichia coli is commonly used as the host for protein expression, other cell types however may also be used. An example of the use of expression vector is the production of insulin which is used for medical treatments of diabetes.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report