(lip) that - Repositories
... regulatory elements. The transcriptional activity of the lip gene was monitored under a variety of growth conditions in an attempt to detect changes in lip expression. Several models of gene regulation were evaluated in this manner. Among these were catabolite repression, end-product repression, and ...
... regulatory elements. The transcriptional activity of the lip gene was monitored under a variety of growth conditions in an attempt to detect changes in lip expression. Several models of gene regulation were evaluated in this manner. Among these were catabolite repression, end-product repression, and ...
Mitochondria, the cell cycle, and the origin of sex via a syncytial
... The typical eukaryotic cell cycle comprises two major stages: The interphase and the mitotic phase or M-phase (fig. 1A) (Mitchison 1971). Interphase is further separated into the synthesis (S-) phase, during which the genome is replicated, and the gap (G-) phases, G1 and G2 (Norbury and Nurse 1992). ...
... The typical eukaryotic cell cycle comprises two major stages: The interphase and the mitotic phase or M-phase (fig. 1A) (Mitchison 1971). Interphase is further separated into the synthesis (S-) phase, during which the genome is replicated, and the gap (G-) phases, G1 and G2 (Norbury and Nurse 1992). ...
PlantDirectTM Multiplex PCR System
... 2. Dispense the lysis solution from step 1 into the sample tube containing plant tissue or cells. Mix and incubate the samples at 95 oC for 10 min. a. ...
... 2. Dispense the lysis solution from step 1 into the sample tube containing plant tissue or cells. Mix and incubate the samples at 95 oC for 10 min. a. ...
Supporting information S1.
... The suicide vector pKNG101 was used to introduce the CAT* reporter gene within the Escherichia coli chromosome (Table S2). This plasmid contains a defective pir minus origin of replication (oriR6K), the strAB genes encoding the streptomycin phospotransferase (SmR) as a positive selection marker and ...
... The suicide vector pKNG101 was used to introduce the CAT* reporter gene within the Escherichia coli chromosome (Table S2). This plasmid contains a defective pir minus origin of replication (oriR6K), the strAB genes encoding the streptomycin phospotransferase (SmR) as a positive selection marker and ...
ETS-dependent regulation of a distal Gata4 cardiac enhancer
... mice lacking GATA4 in the myocardium display defective cardiomyocyte proliferation and embryonic lethality (Rojas et al., 2008; Zeisberg et al., 2005). Mice lacking Gata4 in the endothelium have defective endocardial cushion development and die around E12.5 of apparent heart failure (Rivera-Felician ...
... mice lacking GATA4 in the myocardium display defective cardiomyocyte proliferation and embryonic lethality (Rojas et al., 2008; Zeisberg et al., 2005). Mice lacking Gata4 in the endothelium have defective endocardial cushion development and die around E12.5 of apparent heart failure (Rivera-Felician ...
Avian Infectious Bronchitis Virus (IBV)
... is included in the same reaction mixture which consists of a DNA probe labeled with a 5`dye and a 3`-quencher. During PCR amplification, the probe is cleaved and the reporter dye and quencher are separated. The resulting increase in fluorescence can be detected on a range of real-time PCR platforms. ...
... is included in the same reaction mixture which consists of a DNA probe labeled with a 5`dye and a 3`-quencher. During PCR amplification, the probe is cleaved and the reporter dye and quencher are separated. The resulting increase in fluorescence can be detected on a range of real-time PCR platforms. ...
University of Groningen Expression and engineering of
... the translational unit of the SC3 cDNA was sufficient to obtain SC3 mRNA levels similar to those obtained with the genomic coding sequence naturally containing 5 introns. Addition of an intron to a cDNA of the GFP-gene of Aequorea victoria was necessary to produce this protein in S. commune. Run-on ...
... the translational unit of the SC3 cDNA was sufficient to obtain SC3 mRNA levels similar to those obtained with the genomic coding sequence naturally containing 5 introns. Addition of an intron to a cDNA of the GFP-gene of Aequorea victoria was necessary to produce this protein in S. commune. Run-on ...
The Age of the Common Ancestor of Eukaryotes and
... average over all possible combinations. It was shown that the asymptotic bias of the estimate cx can be significantly reduced if an appropriate weight function is chosen for combining the estimates of three-sequence sets (Gu 1996). The computer program, which was originally developed for nucleotide ...
... average over all possible combinations. It was shown that the asymptotic bias of the estimate cx can be significantly reduced if an appropriate weight function is chosen for combining the estimates of three-sequence sets (Gu 1996). The computer program, which was originally developed for nucleotide ...
Module Document
... while trying to supply themselves with sufficient food and available oxygen, overcoming competition and predation, and producing gametes for reproduction. They are unable to control the physical environment, and none of the biological challenges is easily met. Any additional physical or biological s ...
... while trying to supply themselves with sufficient food and available oxygen, overcoming competition and predation, and producing gametes for reproduction. They are unable to control the physical environment, and none of the biological challenges is easily met. Any additional physical or biological s ...
Lactobacilli carry cryptic genes encoding peptidase
... promoter region. Northern analysis of pep0 mRNA revealed a 1.1kb transcript indicating that pepQ forms a monocistronic transcriptional unit. Under the growth conditions used, no evidence was obtained t h a t orfZ was expressed, either by mRNA size determination in Northern analysis or by primer exte ...
... promoter region. Northern analysis of pep0 mRNA revealed a 1.1kb transcript indicating that pepQ forms a monocistronic transcriptional unit. Under the growth conditions used, no evidence was obtained t h a t orfZ was expressed, either by mRNA size determination in Northern analysis or by primer exte ...
pcr
... optimized to work correctly within a single reaction, and amplicon sizes, i.e., their base pair length, should be different enough to form ...
... optimized to work correctly within a single reaction, and amplicon sizes, i.e., their base pair length, should be different enough to form ...
Chapter 4 PPT-VIEW
... Energy for Metabolic Reactions Energy • Energy is the ability to do work or change something. • Common forms include heat, light, sound, electricity, mechanical energy, chemical energy • Energy cannot be created or destroyed, but it changes from one form to another. • All metabolic reactions involv ...
... Energy for Metabolic Reactions Energy • Energy is the ability to do work or change something. • Common forms include heat, light, sound, electricity, mechanical energy, chemical energy • Energy cannot be created or destroyed, but it changes from one form to another. • All metabolic reactions involv ...
C1. The start codon begins at the fifth nucleotide. The amino acid
... C16. Bases that have been chemically modified can occur at various locations throughout the tRNA molecule. The significance of all of these modifications is not entirely known. However, within the anticodon region, base modification alters base pairing to allow the anticodon to recognize two or mor ...
... C16. Bases that have been chemically modified can occur at various locations throughout the tRNA molecule. The significance of all of these modifications is not entirely known. However, within the anticodon region, base modification alters base pairing to allow the anticodon to recognize two or mor ...
NIHMS88703-supplement-2
... homozygous ko animals are not viable) had reduced fat/lean ratio as compared to their wild-type (wt) littermates 4. Analysis of additional mice from both sexes confirmed our previous results (Supplementary Table 2; Figure 1a-1d). Interestingly, female C3ar1 ko and female Tgfbr2 heterozygous mice dem ...
... homozygous ko animals are not viable) had reduced fat/lean ratio as compared to their wild-type (wt) littermates 4. Analysis of additional mice from both sexes confirmed our previous results (Supplementary Table 2; Figure 1a-1d). Interestingly, female C3ar1 ko and female Tgfbr2 heterozygous mice dem ...
Document
... C16. Bases that have been chemically modified can occur at various locations throughout the tRNA molecule. The significance of all of these modifications is not entirely known. However, within the anticodon region, base modification alters base pairing to allow the anticodon to recognize two or mor ...
... C16. Bases that have been chemically modified can occur at various locations throughout the tRNA molecule. The significance of all of these modifications is not entirely known. However, within the anticodon region, base modification alters base pairing to allow the anticodon to recognize two or mor ...
Drosophila Forkhead Homologues Are Expressed in
... (prealbumin) gene by binding to the promoter sequence TGACTAAGTCAATAATCAGA (-1 I O to -90 from the start ~ i t e ) .This ~ , ~sequence is not homologous to any other transcription factor DNA binding sequence. HNF-3A is expressed in other tissues besides the liver,4 and thus may not be the sole reaso ...
... (prealbumin) gene by binding to the promoter sequence TGACTAAGTCAATAATCAGA (-1 I O to -90 from the start ~ i t e ) .This ~ , ~sequence is not homologous to any other transcription factor DNA binding sequence. HNF-3A is expressed in other tissues besides the liver,4 and thus may not be the sole reaso ...
A systematic search for DNA methyltransferase polymorphisms
... these loci were observed. This was true for both allele-based and genotype-based association analysis (Supplementary Material, Tables S2 and 3). We then asked whether a given extended haplotype (Supplementary Material, Table S4) over an entire gene is associated with an increase or a decrease in DNA ...
... these loci were observed. This was true for both allele-based and genotype-based association analysis (Supplementary Material, Tables S2 and 3). We then asked whether a given extended haplotype (Supplementary Material, Table S4) over an entire gene is associated with an increase or a decrease in DNA ...
Spore Formation Bacillus subtilis during Compartmentalization of
... morphogenesis. The two major phases of compartmentalization are associated with two major morphological events, completion of septation and completion of engulfment. Consequently, we start with a brief description of the morphological changes during sporulation. We discuss in depth the events leadin ...
... morphogenesis. The two major phases of compartmentalization are associated with two major morphological events, completion of septation and completion of engulfment. Consequently, we start with a brief description of the morphological changes during sporulation. We discuss in depth the events leadin ...
Molecular cloning and expression of the male sterility - Funpec-RP
... polar establishment of lateral organs. However, the YABBY gene has not been studied in male sterility and fertility restoration. We homologously cloned the CtYABBY1 gene of male-sterile TC1 in Brassica campestris L. ssp chinensis var. parachinensis; its expression was analyzed by real-time PCR. A 93 ...
... polar establishment of lateral organs. However, the YABBY gene has not been studied in male sterility and fertility restoration. We homologously cloned the CtYABBY1 gene of male-sterile TC1 in Brassica campestris L. ssp chinensis var. parachinensis; its expression was analyzed by real-time PCR. A 93 ...
Gene therapy: Current status and future perspectives
... and liver cells when directly injected, also it has been applied directly. Long term expression has been observed in skeletal muscle following injection for more than 19 months. Although naked DNA injection is a safe and simple method, its efficiency for gene delivery is low so it is only proper for ...
... and liver cells when directly injected, also it has been applied directly. Long term expression has been observed in skeletal muscle following injection for more than 19 months. Although naked DNA injection is a safe and simple method, its efficiency for gene delivery is low so it is only proper for ...
Differential mRNA expression levels and gene sequences of a
... 2.9. Southern blot analysis of genomic DNA from susceptible and resistant strains Genomic DNA was extracted from adult parasitoids using an isolation buffer containing 100 mM Tris–HCl (pH 9), 1% SDS, and 100 mM EDTA. Southern analysis was used to search for esterase gene differences between the A. c ...
... 2.9. Southern blot analysis of genomic DNA from susceptible and resistant strains Genomic DNA was extracted from adult parasitoids using an isolation buffer containing 100 mM Tris–HCl (pH 9), 1% SDS, and 100 mM EDTA. Southern analysis was used to search for esterase gene differences between the A. c ...
SV 96 Total RNA Isolation System Technical Bulletin
... Promega Corporation · 2800 Woods Hollow Road · Madison, WI 53711-5399 USA · Toll Free in USA 800-356-9526 · 608-274-4330 · Fax 608-277-2516 www.promega.com TB294 · Revised 8/16 ...
... Promega Corporation · 2800 Woods Hollow Road · Madison, WI 53711-5399 USA · Toll Free in USA 800-356-9526 · 608-274-4330 · Fax 608-277-2516 www.promega.com TB294 · Revised 8/16 ...
Drosophila Forkhead Homologues Are Expressed in
... (prealbumin) gene by binding to the promoter sequence TGACTAAGTCAATAATCAGA (-1 I O to -90 from the start ~ i t e ) .This ~ , ~sequence is not homologous to any other transcription factor DNA binding sequence. HNF-3A is expressed in other tissues besides the liver,4 and thus may not be the sole reaso ...
... (prealbumin) gene by binding to the promoter sequence TGACTAAGTCAATAATCAGA (-1 I O to -90 from the start ~ i t e ) .This ~ , ~sequence is not homologous to any other transcription factor DNA binding sequence. HNF-3A is expressed in other tissues besides the liver,4 and thus may not be the sole reaso ...