* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Midterm Practice Test
Microbial metabolism wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Molecular cloning wikipedia , lookup
Evolution of metal ions in biological systems wikipedia , lookup
Light-dependent reactions wikipedia , lookup
Photosynthesis wikipedia , lookup
Genetic code wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Point mutation wikipedia , lookup
Photosynthetic reaction centre wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Midterm Practice Test Mr. Haas Biology 1. Which of the following answers below are not one of the characteristics of life as discussed in the book? a) can adjust to changes in their environment b) use energy d) move c) grow and develop e) both b and d 2) Which of the answers below is the correct order of how scientists use the scientific method? a) Hypothesis->theory->observation->conclusion->results->research b) Purpose->Hypothesis->Research->experiment->results->conclusion c) Theory-> Purpose->Research->Observation->Conclusion->Results d) Purpose->Research-> Hypothesis->Experiment-> Analysis-> Conclusion 3) Recently throughout the annals of Canyon Crest Academy, there has been some discussion that chewing gum improves blood flow to the brain and thus helps students get higher grades. Design an experiment using the scientific method to test this claim. 4) Recently at Canyon Crest Academy, some young men have complained about the design of the urinals in the bathrooms, claiming that the incorrect design causes “splashing.” How would you go about redesigning the urinals and testing your new design to ensure they are an improvement over the previous design. 5) In the chart below, what are the independent and dependent variables? Then graph the data using a line graph and explain the relationship between the 2 columns as shown by the graph. Time spent studying Test score (total points) (min) 17 37 19 46 75 77 79 91 80 91 110 99 6) Where does the Earth receive almost all of its life-supporting energy from? 7) Autotrophs could be found at which levels above: 8) The relationship between ticks and dogs can best be described as what? Explain. 9) Each organism occupies a particular level in a food chain. Moving from one level to the next involves an energy loss of 10) In the carbon cycle what process takes carbon dioxide out of the air? 11) Assume that rabbits feed entirely on shrubs and foxes eat the rabbits. What would happen if the foxes died? 12) Describe a good adaptation for living in the tundra and explain why? 13) In the carbon cycle, what two substances are used by producers to build the organic compounds that make up their bodies? _____________ ______________ 14) All the populations of different species that occupy and are adapted to a given area are referred to as a(n): 15) A stream is free of pollutants within a few miles downstream of a point at which a small amount of sewage is being dumped into it. This is most likely the result of what types of organisms? 16) Organisms that use the energy from the sun to make their food are called? 17) A group of organisms of the same species that interbreed and live in the same place are called a ______________. 18) As a general rule, about ________ percent of the energy consumed by one trophic level is passed on to the next trophic level. 19) What organisms convert nitrogen so that plants can use it? 20) The following represents a food chain: rose-bush fly beetle spider frog snake 21) Which organism in the food chain can transform light energy into chemical energy? 22) At which stage in the food chain will the population with the smallest number of animals be found? Explain your answer. 23) Which of these pairs of organisms probably belong to the same trophic level? a) Humans, bears b) Bears, deer c) Humans, mushrooms d) Both a and c 24) In the food chain below, which organism represents a primary consumer? 25) The place where an organism lives is called its: 26) If a population has ideal conditions where all offspring survive, population growth would be called _______________. 27) Acacia trees and ants have a relationship called _____________________. The ants protect the tree in return for nectar and shelter. 28) The diagram below illustrates some of the essential steps in what cycle? The diagram below represents an energy pyramid for a pond. 29) Which level of consumers contains the largest percentage of total stored energy? 30) What percentage of the sun’s energy do the algae capture? 31) Describe an event that illustrates the interaction of an abiotic (non-living) factor with a biotic (living) factor in the environment. 32) The graph below represents a predator-prey relationship. What is the most probable reason for the increasing predator population from day 5 to day 6? 33) Because of the competitive nature of organisms within a given habitat, two species cannot simultaneously occupy the same ecological ________________. 34) In mutualism, who benefits? 35) In an energy pyramid, less energy is available from the first level (plants) to the second level because? 36) If the sun has 10,000,000 joules of energy available, how much energy would a tertiary consumer (3rd level) be able to obtain? 37) The Tundra biome is characterized by: a) trees like maple, beech and oak. b) high biodiversity c) Barrenness d) None of the above 38) What is an isotope? Give an example of an isotope. 39) An atom containing fewer electrons than protons has a ___________charge. 40) What is an ion? Give an example and explain why ions form. 41) Explain the difference between an ionic bond and a covalent bond. 42) The number of protons in an atoms nucleus is the________ ___________. 43) How many electrons can the energy level nearest the nucleus hold? What is this level (shell) called? 44) Describe the bonding of a potassium ion (K+) with a chlorine ion (Cl-). 45) Draw a picture of the element in 3rd row, 15th column including protons, neutrons and electrons. 46) How do Eukaryotes and Prokaryotes differ in structure? 47) Describe the differences between the cells of Anachris and those of a mouse. 48) Draw a picture of the cell membrane and describe how its structure plays an important role in its function. 49) What are the functions of the following organelles: Nucleus, Ribosomes, Rough Endoplasmic Reticulum, Mitochondria, Chloroplast, Golgi Apparatus, Lysosomes. 50) Why do plants wilt when they are not given enough water? 51) What is the purpose of Photosynthesis? 52) What is the overall equation for photosynthesis? How is it different from that of cellular respiration? 53) What products are made specifically in the light dependent reactions of photosynthesis and why are they necessary? 54) What molecule is most responsible for releasing energy for many different cellular process? Where is that energy stored within the molecule? 55) Explain how an antiport works. Include what type of transport it is. 56) How is facilitated diffusion different from simple diffusion? 57) Describe the process of converting glucose into energy, including each step under both aerobic and anaerobic conditions. 58) The equation below refers to which cellular process? How many ATP are produced by this step alone? pyruvate + NADH + ADP lactic acid + NAD+ + ATP 59) Where does Glycolysis occur in the cell? 60) In passive transport, molecules prefer to move from areas of __________ concentration to areas of __________ concentration. In active transport, molecules are passed in the opposite direction, from areas of __________ concentration to areas of __________ concentration. 61) If you put some of your cheek cells into a hypotonic glass of water, what will happen to your cells and why? 62) Describe what a solute and solvent is, giving examples in the process. 63) What is the central dogma of biology? 64) Describe the process of DNA replication. 65) Which of the following is TRUE of tRNA? (1.) It functions in carrying messenger RNA from the nucleus to the ribosomes. (2.) It is short-lived. (3.) It consists of a single strand of nucleotides. (4.) It is necessary for transcription. 66) Which is true of a codon? (1.) It consists of three nucleotides. (2.) It may code for the same amino acid as another codon does. (3.) It never codes for more than one amino acid. (4.) It extends from one end of a tRNA molecule (5.) It is the basic unit of the genetic code. 67) What does the term "antiparallel" mean when applied to a DNA double helix? 68) The DNA of all organisms replicates by (1.) dispersive replication (2.) reverse replication (3.) semi-conservative replication (4.) conservative replication 69) A chromosome is in its most extended (least condensed) form during (1.) interphase (2.) prophase (3.) anaphase (4.) telophase (5.) metaphase Which of the following structures is coded for by the shortest (or smallest) sequence of DNA? a) an mRNA having 75 codons b) a tRNA having 75 nucleotides c) a protein composed of 50 amino acids d) a tRNA having 83 codons A bacterial DNA sequence is transcribed into a complementary copy of RNA, which in turn is translated into a protein sequence by ribosomes and aminoacyl-tRNA complexes. Starting from the gene below, indicate the mRNA transcript and predict the protein (amino acid sequence) that could be synthesized in vitro. (Helicase enters from the left). 3' ATTACACGAGTCACAGAGTCGTGTAAC 5' 5' TAATGTGCTCAGTGTCTCAGCACATTG 3' You are given a solution containing only the enzyme DNA Polymerase III, the nucleotide precursors dATP, dTTP, DCTP, and dGTP and any necessary ions. You perform 4 separate experiments in which you add a DNA molecule to the solution and test for DNA synthesizing activity. Which of the DNA molecules listed below would lead to DNA synthesis when added to your solution? Explain why or why not in each case. a)A single-stranded closed circle containing 1000 nucleotides b)A double-stranded closed circle containing 1000 nucleotide pairs c)A single-stranded closed circle of 1000 nucleotides base paired to a linear strand of 500 nucleotides with a free 3'-OH terminus. d)A double-stranded linear molecule of 1000 nucleotide pairs with a free 3'-OH at each end. 70) What role do spindle fibers play in Mitosis? 71) Which type of cancer metastasizes? 72) What is p53 and how does it work? 73) In the cell cycle, when does Cytokinesis occur?