Download Midterm Practice Test

Midterm Practice Test
Mr. Haas Biology
1. Which of the following answers below are not one of the characteristics of life as
discussed in the book?
a) can adjust to changes in their environment
b) use energy
d) move
c) grow and develop
e) both b and d
2) Which of the answers below is the correct order of how scientists use the
scientific method?
a) Hypothesis->theory->observation->conclusion->results->research
b) Purpose->Hypothesis->Research->experiment->results->conclusion
c) Theory-> Purpose->Research->Observation->Conclusion->Results
d) Purpose->Research-> Hypothesis->Experiment-> Analysis-> Conclusion
3) Recently throughout the annals of Canyon Crest Academy, there has been some
discussion that chewing gum improves blood flow to the brain and thus helps
students get higher grades. Design an experiment using the scientific method to
test this claim.
4) Recently at Canyon Crest Academy, some young men have complained about the
design of the urinals in the bathrooms, claiming that the incorrect design causes
“splashing.” How would you go about redesigning the urinals and testing your
new design to ensure they are an improvement over the previous design.
5) In the chart below, what are the independent and dependent variables? Then graph
the data using a line graph and explain the relationship between the 2 columns as
shown by the graph.
Time spent studying
Test score (total points)
(min)
17
37
19
46
75
77
79
91
80
91
110
99
6) Where does the Earth receive almost all of its life-supporting energy from?
7) Autotrophs could be found at which levels above:
8) The relationship between ticks and dogs can best be described as what? Explain.
9) Each organism occupies a particular level in a food chain. Moving from one level
to the next involves an energy loss of
10) In the carbon cycle what process takes carbon dioxide out of the air?
11) Assume that rabbits feed entirely on shrubs and foxes eat the rabbits. What would
happen if the foxes died?
12) Describe a good adaptation for living in the tundra and explain why?
13) In the carbon cycle, what two substances are used by producers to build the
organic compounds that make up their bodies? _____________ ______________
14) All the populations of different species that occupy and are adapted to a given
area are referred to as a(n):
15) A stream is free of pollutants within a few miles downstream of a point at which a
small amount of sewage is being dumped into it. This is most likely the result of
what types of organisms?
16) Organisms that use the energy from the sun to make their food are called?
17) A group of organisms of the same species that interbreed and live in the same
place are called a ______________.
18) As a general rule, about ________ percent of the energy consumed by one trophic
level is passed on to the next trophic level.
19) What organisms convert nitrogen so that plants can use it?
20) The following represents a food chain:
rose-bush  fly  beetle  spider  frog  snake
21) Which organism in the food chain can transform light energy into chemical
energy?
22) At which stage in the food chain will the population with the smallest number of animals
be found? Explain your answer.
23) Which of these pairs of organisms probably belong to the same trophic level?
a) Humans, bears
b) Bears, deer
c) Humans, mushrooms
d) Both a and c
24) In the food chain below, which organism represents a primary consumer?
25) The place where an organism lives is called its:
26) If a population has ideal conditions where all offspring survive, population growth
would be called _______________.
27) Acacia trees and ants have a relationship called _____________________. The
ants protect the tree in return for nectar and shelter.
28) The diagram below illustrates some of the essential steps in what cycle?
The diagram below represents an energy pyramid for a pond.
29) Which level of consumers contains the largest percentage of total stored energy?
30) What percentage of the sun’s energy do the algae capture?
31) Describe an event that illustrates the interaction of an abiotic (non-living) factor with a
biotic (living) factor in the environment.
32) The graph below represents a predator-prey relationship. What is the most probable
reason for the increasing predator population from day 5 to day 6?
33) Because of the competitive nature of organisms within a given habitat, two species
cannot simultaneously occupy the same ecological ________________.
34) In mutualism, who benefits?
35) In an energy pyramid, less energy is available from the first level (plants) to the second
level because?
36) If the sun has 10,000,000 joules of energy available, how much energy would a tertiary
consumer (3rd level) be able to obtain?
37) The Tundra biome is characterized by:
a) trees like maple, beech and oak.
b) high biodiversity
c) Barrenness
d) None of the above
38) What is an isotope? Give an example of an isotope.
39) An atom containing fewer electrons than protons has a ___________charge.
40) What is an ion? Give an example and explain why ions form.
41) Explain the difference between an ionic bond and a covalent bond.
42) The number of protons in an atoms nucleus is the________ ___________.
43) How many electrons can the energy level nearest the nucleus hold? What is this
level (shell) called?
44) Describe the bonding of a potassium ion (K+) with a chlorine ion (Cl-).
45) Draw a picture of the element in 3rd row, 15th column including protons, neutrons
and electrons.
46) How do Eukaryotes and Prokaryotes differ in structure?
47) Describe the differences between the cells of Anachris and those of a mouse.
48) Draw a picture of the cell membrane and describe how its structure plays an
important role in its function.
49) What are the functions of the following organelles: Nucleus, Ribosomes, Rough
Endoplasmic Reticulum, Mitochondria, Chloroplast, Golgi Apparatus,
Lysosomes.
50) Why do plants wilt when they are not given enough water?
51) What is the purpose of Photosynthesis?
52) What is the overall equation for photosynthesis? How is it different from that of
cellular respiration?
53) What products are made specifically in the light dependent reactions of
photosynthesis and why are they necessary?
54) What molecule is most responsible for releasing energy for many different
cellular process? Where is that energy stored within the molecule?
55) Explain how an antiport works. Include what type of transport it is.
56) How is facilitated diffusion different from simple diffusion?
57) Describe the process of converting glucose into energy, including each step under
both aerobic and anaerobic conditions.
58) The equation below refers to which cellular process? How many ATP are
produced by this step alone?
pyruvate + NADH + ADP
lactic acid + NAD+ + ATP
59) Where does Glycolysis occur in the cell?
60) In passive transport, molecules prefer to move from areas of __________
concentration to areas of __________ concentration. In active transport,
molecules are passed in the opposite direction, from areas of __________
concentration to areas of __________ concentration.
61) If you put some of your cheek cells into a hypotonic glass of water, what will
happen to your cells and why?
62) Describe what a solute and solvent is, giving examples in the process.
63) What is the central dogma of biology?
64) Describe the process of DNA replication.
65) Which of the following is TRUE of tRNA? (1.) It functions in carrying messenger
RNA from the nucleus to the ribosomes. (2.) It is short-lived. (3.) It consists of a
single strand of nucleotides. (4.) It is necessary for transcription.
66) Which is true of a codon? (1.) It consists of three nucleotides. (2.) It may code for
the same amino acid as another codon does. (3.) It never codes for more than one
amino acid. (4.) It extends from one end of a tRNA molecule (5.) It is the basic
unit of the genetic code.
67) What does the term "antiparallel" mean when applied to a DNA double helix?
68) The DNA of all organisms replicates by (1.) dispersive replication (2.) reverse
replication (3.) semi-conservative replication (4.) conservative replication
69) A chromosome is in its most extended (least condensed) form during (1.)
interphase (2.) prophase (3.) anaphase (4.) telophase (5.) metaphase
Which of the following structures is coded for by the shortest (or smallest) sequence of
DNA?
a) an mRNA having 75 codons
b) a tRNA having 75 nucleotides
c) a protein composed of 50 amino acids
d) a tRNA having 83 codons
A bacterial DNA sequence is transcribed into a complementary copy of RNA, which in
turn is translated into a protein sequence by ribosomes and aminoacyl-tRNA complexes.
Starting from the gene below, indicate the mRNA transcript and predict the protein
(amino acid sequence) that could be synthesized in vitro. (Helicase enters from the left).
3' ATTACACGAGTCACAGAGTCGTGTAAC 5'
5' TAATGTGCTCAGTGTCTCAGCACATTG 3'
You are given a solution containing only the enzyme DNA Polymerase III, the nucleotide
precursors dATP, dTTP, DCTP, and dGTP and any necessary ions. You perform 4
separate experiments in which you add a DNA molecule to the solution and test for DNA
synthesizing activity. Which of the DNA molecules listed below would lead to DNA
synthesis when added to your solution? Explain why or why not in each case.
a)A single-stranded closed circle containing 1000 nucleotides
b)A double-stranded closed circle containing 1000 nucleotide pairs
c)A single-stranded closed circle of 1000 nucleotides base paired to a linear strand of
500 nucleotides with a free 3'-OH terminus.
d)A double-stranded linear molecule of 1000 nucleotide pairs with a free 3'-OH at
each end.
70) What role do spindle fibers play in Mitosis?
71) Which type of cancer metastasizes?
72) What is p53 and how does it work?
73) In the cell cycle, when does Cytokinesis occur?