Download EOC_CUMMULATIVE_REVIEW

EOC CUMMULATIVE REVIEW
Answer all questions and use word banks when given
I. Scientific Investigation: (independent variable, control, experiment,
hypothesis, qualitative, dependent variable, variables, quantitative)
1. ____________________- is the type of data gathered using the 5 senses.
2. ____________________- is the type of data gathered using actual measured
numbers.
3. ____________________- is an educated guess/prediction; usually in
“IF...THEN” form.
4. ____________________- are the factors that are measured in an experiment.
5. ____________________- is the variable that you purposely change
6. ____________________- is the variable that changes as a result of changing
the other variable.
7. ____________________- the thing(s) that are purposely kept the same in the
experiment.
8. ____________________- is a structured way to test a hypothesis
II. Characteristics of Living Things
A. List the 7 Characteristics of Life (homeostasis, development, made of cells,
growth, gets energy, reproduction)
1. ____________________- at least one that can perform the characteristics of
life
2. ____________________- by absorbing as autotrophs do or consuming as
heterotrophs do
3. ____________________- to get bigger or gain mass by adding new cells
4. ____________________- change; puberty during adolescence
5. ____________________- either asexually or sexually
6. ____________________- ex. body temperature, metabolism
B. Place the following biological terms in order from smallest to largest
(biosphere, cell, community, ecosystem, organ, organism, organ system,
population, species, tissue)
III. Life at the Molecular Level
A. Inorganic Compounds~ (Typically DO NOT contain carbon)
1. Water (hydrogen bonding, float, acids, body temperature, capillary action,
water, polar, 7, 4, 14, 0, cohesion, solvent, bases, high heat of vaporization,
homeostasis, surface tension)
a. Water molecules have a slightly negative charge at one end and a
slightly positive charge at the other, this means that the molecule is
____________________.
b. ____________________ is the attraction between the positive end of
one water molecule and the negative end of another water molecule.
c. Many of the 5 unique properties of water are caused by hydrogen
bonding
~ ____________________ is the movement of water up thin plant tubes,
caused by ____________________ which means that water molecules
‘stick’ to each other.
~ The property that helps bugs stand on water is called
____________________.
~ Water expands when it freezes which makes ice
____________________.
~ Water has a ____________________ which means it takes a lot of
energy to change it from a liquid to a gas. This is important because it
helps organisms to maintain the amount of water they have in their bodies.
~ Water also resists temperature changes which means that organisms
can maintain ____________________ by keeping a constant
____________________.
d. Because water is a polar molecule, it is called the universal
____________________ which means that it can dissolve many
substances.
e. Cells are 95% ____________________, therefore 95% of your entire
body is made of water.
~~The pH scale is from 0-14. _________ range 0-6. _______ range 8-14.
A neutral solution has a pH of _______.
2. The Water Cycle (terms: condensation, transpiration, precipitation, capillary
action, evaporation, run-off, ground
water)
a. water falls to the ground in
the form of
____________________
(letter _____)
b. it percolates through the
soil to make
____________________
(letter ____)
c. water that doesn’t go into the ground is called _______________ (letter
_____)
d. water is taken into plants through the roots by ____________________
e. ____________________- the process of releasing water vapor into the
atmosphere from plant leaves. (letter ____)
f. ____________________ puts water from oceans and lakes into the
atmosphere. (letter____)
g. water in the atmosphere forms droplets in clouds by
____________________. (letter ____)
h. In Arizona there is probably more ____________________ than
____________________
i. Places with much ground water probably have much
____________________
3. The Carbon Dioxide/Oxygen Cycle (terms: heterotrophs, CO2, water, O2,
glucose, chloroplasts, mitochondria, photosynthesis, chemical, respiration,
autotrophs, solar, ATP/energy)
a. ____________________ use
organelles called
____________ in their leaves
to collect _____________
energy.
b. ____________________
occurs so plants can make
_________________ to use for
energy.
c. photosynthesis converts
____________________
energy into
____________________
energy.
d. photosynthesis uses ___________,
____________________ and (_________________ ) energy to form
____________________ and ____________________.
e. animals can not make their own food therefore they are called
____________________.
f. animals use organelles called ____________________ to perform a
process called ____________________ which breaks down food
molecules to produce ATP for energy.
g. respiration uses ____________________ and ____________________
to produce ____________________ and ____________________.
h. the gas made by respiration is ____________________; the gas taken
in by photosynthesis is ____________________.
i. the gas taken in by respiration is ____________________; the gas
produced by photosynthesis is ____________________.
j. The letter ______represents the rabbit dying and replacing nutrients in
the soil.
k. The letter _____ represents carbon dioxide being taken in to perform
photosynthesis.
l. The letters _______ and ______ show CO2 being released into the
atmosphere by respiration.
m. The letters _______ and _______ show carbon compounds being
ingested for metabolic purposes.
>Write the equation for photosynthesis
>Write the equation for cellular respiration
4. The Nitrogen Cycle (terms: decompose, heterotrophic, autotrophs,
producers, consume, nitrogen-fixing bacteria)
a. nitrogen is absorbed from the soil by ____________________ (plants)
to build compounds
b. ____________________ organisms ____________________ plants to
build their own compounds.
c. when organisms die, the bodies ____________________ and nitrogen
goes back to the soil.
d. ______________________________ use the nitrogen compounds for
themselves and to make nitrogen available for other organisms to use.
e. The number ____________________
represents organic wastes from plants
and animals adding nitrogen to the soil.
f. The number ____________________
depicts plants using nitrogen in the soil
to grow, develop, and reproduce.
g. The number _______________
shows that plants are eaten by animals
(including people) to gain nitrogen.
h. The number ________ is where
bacteria in the soil convert nitrogen in to
forms that plants can use.
B. Organic Compounds or Macromolecules: there are
____________________ macromolecules.
All organic molecules contain ____________________!!!!
1. Carbohydrates (terms: starch, cellulose, monosaccharides, built, glucose,
broken down, disaccharide, hydrolysis, polysaccharide, lactose)
a. carbohydrates are ____________________ to store energy in plants
and are ____________________ to be used as cellular energy to
accomplish the characteristics of life.
b. ____________________- monomers (building blocks) of carbohydrate,
an example of simple sugar is ____________________
c. 2 simple sugars make a ____________________, examples are
sucrose and ____________________.
d. a ____________________ is a carbohydrate made of many sugars.
e. a polysaccharide found in plant cell walls is ____________________.
f. a polysaccharide used to store energy in plants is _________________.
2. Lipids (terms: fatty acids, fat, cuticle, oil, store, plants, wax)
a. lipids are macromolecules that are insoluble in water, including
____________________, ____________________, and
____________________.
b. the building blocks of lipids are ________________________________
c. lipids are used to ____________________ energy in animals.
d. ____________________ have a waxy coating on their leaves called a
____________________ which keeps from losing too much moisture or
from becoming water logged.
3. Proteins(terms: amino acids, peptide, enzymes, speed up)
a. Proteins are made up of ____________________ joined together by
____________________ bonds.
b. ____________________ are a special group of proteins that
____________________ reactions.
4. Nucleic Acids (adenine, cytosine, guanine, thymine, uracil, replication, sugar,
ribose, Watson & Crick, nucleotide, double helix, genetic, insulin, deoxyribose,
phosphate, DNA, RNA, nitrogen base)
a. The two types of nucleic acids are ____________________ and
____________________.
b. The monomer of a nucleic acid is a ____________________, which is
made of a ____________________, a ____________________, and a
___________________________________.
c. ____________________ is common to all living things and it stores
genetic information.
d. In DNA, ____________________ bonds with ____________________
and ____________________ bonds with ____________________.
e. The shape of a DNA molecule is a ____________________,
discovered by ____________________.
f. ____________________ is a process that makes an exact copy of
DNA.
g. The sugar in DNA is ____________________, but the sugar in RNA is
____________________.
h. In DNA adenine bonds with ____________________, but in RNA it
bonds with ____________________.
i. ____________________ is single stranded, and __________________
is double stranded.
j. ____________________ is copied by ____________________ which
becomes the pattern for making proteins.
k. ____________________ engineering is inserting foreign DNA into host
DNA to make recombinant DNA to make ____________________,
interferon, and human growth hormone.
IV. Life at the Cellular Level
A. The Parts of the Cell Theory
1. ___________________________________________________________
2. ___________________________________________________________
3. ___________________________________________________________
B. Development of the Cell Theory (terms: Hooke, Leeuwenhoek, Schleiden,
Schwann, Pasteur, spontaneous generation, Redi, Virchow)
1. ____________________- observed microorganisms through the 1st
microscope
2. ____________________- observed cork and named cells
3. ____________________- studied plant cells
4. ____________________- studied animal cells
5. ____________________- the idea that living things come from nonliving
matter
6. ____________________- meat/maggot experiment to disprove spontaneous
generation
7. ____________________- S-shaped flask experiment to disprove spontaneous
generation
8. ____________________- proposed/concluded that all cells come from
preexisting cells
C. Types of Cells (terms: prokaryotes, eukaryotes, both)
1. ____________________- have a nucleus
2. ____________________- have organelles
3. ____________________- only include organisms from the kingdom Monera
(bacteria)
4. ____________________- do not have organized structures within the cell,
except ribosomes
5. ____________________- include organisms in the kingdoms Protista, Fungi,
Plant, and Animal
6. ____________________- have DNA, (HINT: ALL kingdoms of organisms have
this in common)
7. ____________________- go through mitosis
8. ____________________- go through binary fission
9. ____________________- have ribosomes to synthesize proteins
D. Cellular Organelles
1. ____________________- command center of the cell; DNA in the form of
chromosomes is here
2. ____________________- small organelle in the nucleus that makes
ribosomes.
3. ____________________- small spheres made of rRNA in the nucleus,
cytoplasm, and on the ER
4. ____________________- the site of protein synthesis in prokaryotes and
eukaryotes
5. ____________________- transport system of the cell
6. ____________________- collects, packages, and distributes proteins
7. ____________________- contains digestive enzymes to break down old cell
parts
8. ____________________- storage tank of the cell
9. ____________________- organelle that conducts ‘respiration’ for the cell
10. ____________________- the powerhouse of the cell
11. ____________________- organelle that conducts ‘photosynthesis’ for plant
cells
12. ____________________- assists in cell division in animal cells only
13. ____________________- the medium in which organelles float inside a cell
14. ____________________- made of cellulose (plants) or chitin (fungi); outer
boundary of some cells
15. ____________________- the outer layer or boundary of an animal cell
16. ____________________- would be quite numerous in a heart muscle cell
because it is very active
17. ____________________ would be numerous in a cell that produces large
quantities of melanin.
E. Differences between plant and animal cells (complete the table by identifying
ONLY the differences)
Differences
1. size of vacuole
2. different organelles present
3. shape b/c of cell wall
Plants
Animals
F. The Fluid Mosaic Model and Movement through the Cell Membrane
(terms: diffusion, proteins, cell membrane, active transport, endocytosis,
exocytosis, phospholipids, energy, low, high, carbohydrates, water, osmosis)
1. The cell membrane is composed of ____________________ and
____________________
2. The Fluid Mosaic Model describes the ____________________
3. Passive transport is also called ____________________ and it doesn’t require
____________________
4. Passive transport moves molecules move from areas of
____________________ to ____________________ concentration.
6. ____________________ is a type of diffusion involving only the movement of
water molecules
7. A nonspecific type of movement that requires energy is __________________
8. The movement that requires energy moves molecules from ______________
to ____________________ concentrations.
12. Movement of large particles out of the cell is called ____________________
13. Our cells are made of 95% ____________________, therefore 95% of our
body is made of water
V. Cell Division
A. Mitosis (terms: nucleus, replicated, interphase, prophase, metaphase,
anaphase, telophase, cytokinesis, centromere, sister chromatid, chromatin,
centrioles, spindle fibers)
1. A chromosome is made of two identical parts called ____________________
2. The parts of a chromosome are held together by a ____________________
3. Only animal cells have ____________________ to help with chromosome
movement.
4. During ____________________ sister chromatids are separated at the
____________________
and are pulled to opposite ends of the cell.
5. DNA is ____________________ during ____________________ so each cell
will have the same information
6. Chromosomes line up along the equator of the cell in ____________________
7. Loose or uncoiled chromosomes are actually DNA in the form of
____________________
8. During ____________________ spindle fibers shorten which pulls
chromosomes to the poles.
9. After the nucleus divides, ____________________ occurs which is division of
the cytoplasm
12. ____________________ are attached to chromosomes at the centromere
13. ____________________- chromatin condenses and becomes visible
chromosomes
14. ____________________- nuclear membrane begins to form around each set
of chromosomes
15. ____________________- nuclear membrane begins to disappear
16. ____________________- two daughter cells are formed
B. Other types of division and Asexual Reproduction in Organisms (terms:
binary fission, budding, mitosis, spore production, regeneration)
1. ____________________- repairing severed appendage (starfish or lizard tail)
3. ____________________- new mold growing where spores have fallen, also
occurs in ferns
4. ____________________- only occurs in prokaryotes
5. ____________________- occurs in yeast and hydra when a tiny bud sprouts
from a parent
6. ____________________- occurs in single celled eukaryotes like paramecium,
splitting the nucleus
C. Meiosis (gametes, 1, the same, 46, 23, eggs, sperm, homologous, diploid,
half, 2, haploid, prophase)
1. Meiosis is a type of cell division that makes sex cells or __________________
2. The two types of sex cells are _____________ and ____________________
3. Mitosis consists of ________ division(s), while meiosis consists of
____________division(s).
4. Mitosis makes cells with ____________________ number of chromosomes as
the parent cell, but meiosis produces cells with ____________________ the
number of chromosomes as the parent cell.
5. A human’s body cells have ____________________ chromosomes; sex cells
or gametes have ____________________
6. For every chromosome your mother gave you, there is a _________________
chromosome from your father with information regarding the same trait(s).
7. When a cell has a full complement of homologues or homologous
chromosomes from each parent, the cell is said to be ____________________.
8. Sex cells have only ONE set of chromosomes, they are called _____________
9. ____________________ chromosomes exchange information during
____________________ which adds to diversity.
D. Cell Growth (terms: translation, diffusion, transcription, proteins, mRNA,
amino acid, DNA, grow, peptide, tRNA, codon, nitrogen bases, cytoplasm,
ribosome, nucleus, surface to volume ratio)
1. After a new cell is formed it must get bigger or ____________________
2. One important thing that effects a cells’ size is ____________________
4. The process of protein synthesis is comprised of ____________________ and
____________________
5. During ____________________, the genetic code is copied from
____________________ to ____________________
6. Because DNA can’t leave the ____________________, the message is
carried out to the ____________________ by ____________________.
7. Once the message from DNA is copied, the ____________________ leaves
the nucleus and travels to a ____________________ in the ________________.
8. A sequence of 3 bases on DNA or mRNA is called a(n) _________________
9. Each new amino acid is transferred to the ribosome by the _______________
10. Each ____________________ is linked together by ____________________
bonds to form ____________________.
11. Another name for protein synthesis is ____________________.
12. The sequence of ____________________ on ____________________ carry
the genetic code.
E. Transcription and Translation: Use a codon chart to transcribe and translate
the followingDNA sequence.(TACGGCCATTTCGATTTGAGCATC)
1. mRNA____________________
2. amino acids ____________________
3. This protein is made of ____________________ amino acids. (give the
number of amino acids)
F. DNA Technology (terms: DNA sequence, genes, fingerprinting, identical,
fraternal, collaborative, same)
1. DNA ____________________ is used to identity crime suspects (such as
murder and rape).
2. Using electrophoresis, scientists can determine an individual’s DNA fingerprint.
No two people have the ____________________ fingerprint, except for
____________________ twins.
3. Human Genome project is considered a ____________________ effort
because 13 countries worked on it.
4. The objective of the Human Genome Project was to understand the
____________________.
5. Scientists wanted to determine the sequence of bases to ultimately find the
____________________ responsible for certain diseases.
VI. Genetics
A. Vocabulary (terms: phenotype, gene, heredity, genetics, genome, recessive,
dominant, Gregor Mendel, trait, genotype, alleles, homozygous, heterozygous)
1. ____________________- two different alleles, a hybrid (Tt)
2. ____________________- is the passing of characteristics from parent to
offspring
3. ____________________- is the type of genes or alleles present in an
organism’s genome
4. ____________________- form of gene that always shows even in the
presence of recessive allele.
5. ____________________- all of the genes in an organism
6. ____________________- are different forms of the same gene (ex: tall vs.
short)
7. ____________________- two alleles of the same form that make up a
genotype, pure breed (TT or tt)
8. ____________________ is the Father of Modern Genetics
9. ____________________- form of a gene only expressed in a homozygous
state
10. ____________________- is an inherited characteristic
11. ____________________- is an organism’s physical appearance
12. ____________________- is the study of heredity
13. ____________________- is a segment of DNA located on a chromosome
B. Mendelian Genetics (terms: monohybrid, dihybrid, independent assortment,
genotypic, phenotypic, segregation, Punnett square, incomplete dominance,
codominance, sex-linked traits)
1. ____________________- table used to diagram the probability of getting
certain genotypes
2. A ____________________ cross constitutes a study of only one trait
3. A ____________________ cross constitutes a study of two traits at a time
4. The Law of ____________________ states that each gene is inherited
separately from others if they are on different chromosomes
5. The Law of ____________________ states the 2 alleles for each trait
separate as gametes form
6. ____________________ is blending of traits; red flowers + white flowers =
pink
7. ____________________- both alleles are expressed equally, as in blood
typing (A+B = AB)
8. ____________________- controlled by genes on sex chromosomes;
colorblindness, hemophilia
C. Mutations~ there are 2 major types ‘gene’ and ‘chromosomal’
1. Gene Mutations (gene, point, frameshift, mutagens, UV light, chemicals)
a. A ____________________ mutation is a change in one or more
nucleotide bases of DNA.
b. Mutations are caused by ____________________ like
____________________ or ____________________
c. A ____________________ mutation is when 1 nucleotide base in DNA
is changed.
d. A ____________________ mutation occurs if 1 or more nucleotides in
DNA are added or deleted; this causes the codon sequence to be shifted.
~ if the original DNA is ATAACGCCTATT...
~ then the number of codons is ____________________
~ then the mRNA sequence would be ____________________
~ if the original DNA were replicated and the “G” was deleted...
~ then the DNA sequence would be ____________________
~ then the number of codons would be ____________________
~ then the mRNA sequence would be ____________________
~ if the original DNA is replicated and “C” was added to the
beginning...
~ then the DNA sequence would be ____________________
~ then the number of codons would be ____________________
~ then the mRNA sequence would be ____________________
2. Chromosomal Mutations (terms: inversion, translocation, nondisjunction, ,
haploid, diploid, chromosomal)
a. A ____________________ mutation occurs if there is a change in the
number or structure of a single chromosome or whole sets of
chromosomes
b. ____________________- occurs when chromosomes don’t separate
during meiosis
c. ____________________- chromosome pieces are moved onto another
chromosome
d. ____________________- a segment of chromosome is inserted in
reverse order
e. In plants and animals, sex cells are ____________________ which
means that they have half the number of chromosomes of a body cell
f. ____________________- a cell with 2 sets of chromosomes (1 from
mother; 1 from father)
D. Genetic Disorders (terms: 21st, 23rd, karyotype, trisomy, chromosomal,
monosomy, nondisjunction)
1. A ____________________ detects a ____________________ mutation
caused by nondisjunction
2. Down Syndrome is trisomy on the ____________________
chromosome pair; caused by ____________________
3. ____________________ occurs when there is an extra copy of a chromosome
in a diploid cell.
4. Turner Syndrome is monosomy on the ____________________ chromosome
5. Name of disease and sex of child represented by above karyotype.
6. Name of disease represented by karyotype above.
VII. Taxonomy- is the naming and organization of organisms developed by
Carolus Linneaus, based on structural similarities
A. Classification: Arrange the terms listed from largest to smallest (use these
terms: Genus, Kingdom, Species, Phylum, Class, Family, Order)
B. Naming Organisms (genus, Linneaus, species, different, the same, binomial
nomenclature, kingdom)
1. ____________________, or ‘2 name naming’ was developed by
____________________
2. An organism’s scientific name is made of its ____________________ then
its ____________________
3. If 2 organisms are in the same genus, they must be in ________________
family
4. Clostridium tetani and Clostridium botulinum are two types of bacteria from
the Kingdom Eubacteria. They are in ____________________ species, but
they are in ____________________ genus
5. The Class of Mammals includes organisms such as rabbits and elephants
which are in ____________________ Phylum but ____________________
Species
6. Only organisms that interbreed and produce fertile offspring are in the
same ____________________
C. Kingdoms (complete the chart using the terms: eukaryote, binary fission,
unicellular, both, multicellular, algae, autotroph, heterotroph, wall, prokaryote,
dogwood, jellyfish, plantae, fungi, bacteria, mold, mildew, spore production,
sexual, mitosis, paramecium, amoeba, membrane, Eubacteria, Fungi, Animalia,
Archeabacteria, Plantae, asexual)
Kingdom Cell type
Cell Outer Number of
Boundary cells
Type of
Source of
Reproduction energy
Cell wall
Autotroph
Bacteria
only
Autotroph,
from
chemicals
prokaryote
Membrane Both, usually
Protista
2
examples
Both
unicellular
Eukaryote
Wall made
of chitin
Multicellular Sexual
Sexual
Fern,
Heterotroph Sponge,
D.Kingdom Specimens (eubacteria, protista, fungi, plant, animal, chitin,
cellulose, cell walls, nucleus, arthropods)
1. The least complex kingdom which includes thousands of types of
bacteria is _______________________
2. The next kingdom to evolve was _______________________, which
consists of only single celled organisms.
3. Fleas are multicellular heterotrophs with segmented legs, thus they are
in the _______________________ kingdom.
4. _______________________ are heterotrophic organisms that get
nutrients from dead or decaying organisms.
5. The _______________________ kingdom includes multicellular
organisms that make their own food
6. The _______________________ kingdom includes
unicellular organisms that don’t have nuclei.
7. Most _______________________ are unicellular, except for
plant-like varieties like sea weed.
8. Fungi are different than plants because fungi have cell walls
made of _______________________
9. Insects in the _______________________ kingdom are called
_______________________ because their legs are segmented.
10. The highest level of organization for Porifera (a sponge) is tissue. It’s
in the _______________________ kingdom.
E. Viruses, agents of disease (virus, host, capsid, antibodies, DNA, against,
lysogenic, cell, living, nonliving)
1. Viruses are considered _______________________ because they can
not perform the characteristics of life without a
_______________________
2. Viruses are made of only 2 organic
compounds, _______________________
and a _______________________ made
of protein.
3. The _______________________ cycle
is a process by which a virus infects a
_______________________ which
eventually bursts, releasing newly
assembled viruses.
4. A virus infects a cell by injecting
_______________________ into a cell.
5. The cold and the flu are caused by a
_______________________.
6. Antibiotics are typically used to fight bacterial infections. The
word antibiotic literally means _______________________ life. Because
viruses are considered _______________________, antibiotics don’t work
against viruses.
7. Vaccines are used to help organisms make
_______________________ to build immunity. Vaccines are made from
destroyed or weakened forms of a______________________.
F. Immune System (spleen, skin, vaccine, antibodies, pathogen)
1. The body’s first line of defense is the ___________________________
2. ___________________________ are made by your body to fight
specific pathogenic organisms or viruses.
3. If you have ___________________________ for a certain pathogen,
you may be immune and won’t get sick.
4. A ___________________________ is any organism or agent (virus)
that causes illness.
5. An organ/gland involved with building immunity is the ______________.
6. A ___________________________ is made to help your body build
___________________________ against a specific pathogen.
7. A ___________________________ can be made by using dead or
weakened viruses that are injected into the body
G. Sexual Reproduction in Plants (sperm,
meiosis, plants, mitosis, eggs, wind, insects,
birds, ovary, running water, pollination, spores,
sexual, asexual, stamen, pistil)
1. ONLY the most complex kingdoms, like animals
and _______________________ use _______________________
reproduction which requires 2 distinct gametes called
_______________________ and _______________________
2. body cells of a plant are made by _______________________,
while sex cells are made by _______________________
3. In _______________________, the _______________________ is
located inside a pollen grain which will fertilize an egg
4. The female part of a flower that contains ovules or
_______________________ is called the ____________________
5. Pollen is located on the anther or _______________________,
which is the male part of a flower.
6. _______________________ occurs when pollen from the
_______________________ is deposited on the pistil, which can
happen by _______________________, ____________________, and
_______________________.
7. Ovules are the same things as _______________________.
8. Ferns and mosses use _______________________ to
reproduce and sometimes need _______________________ to carry
spores.
VIII. Evolution- the theory of gradual change in characteristics over time.
A. Early Theorists
1. Lamarck (Inheritance of Acquired Traits, Law
of Use and Disuse)
a. _______________________- if you
don’t use it, you lose it
b. Lamarck believed that giraffe’s long
necks were a result of being stretched
because they were trying to reach tall
trees, and the one’s who didn’t stretch
died out
c. _______________________- was his belief that if a
characteristic occurs and is beneficial to an organism’s survival,
then it will be passed on; ex. if a toe gets cut off and it’s helpful,
then that trait gets passed on to offspring.
d. NO fossil evidence to support this theory so it was thrown out
2. Charles Darwin (The Origin of Species, finches, Galapagos Islands,
Natural Selection)
a. _______________________- only the
organisms that are best suited to their
environments will survive
b. The _______________________ were a
cluster of islands that had different food
sources. Because of this, the
_________________ had different beaks to
help eat the food.
c. _______________________ was his
book that compiled his evidence for evolution
B. Types and Rates of Evolution (gradualism, convergent, divergent,
punctuated equilibrium)
1. _______________________- related organisms become more distant
(finches with different beaks)
2. _______________________- distantly related organisms develop
similar characteristics
3. _______________________- organisms evolve as a result of small
adaptive changes over time
4. _______________________- short periods of rapid change followed by
long periods of little or no change.
C. Evidence of Common Ancestry (appendix, younger, older,
homologous structures, fish, vestigial organs, common ancestors, rabbits,
DNA sequence, gorillas, embryology)
1. Structures such as the alligator leg and human arm that have similar
forms and functions are said to be ____________________
2. The presence of the same number & type of bones in the wing of a bat
and the arm and hand of a human suggests that a bat and a human must
share _______________________
3. _______________________- similar amino acid sequences in proteins
of horses and humans provides evidence of similar origin, this is the most
specific way to compare organisms.
4. The fact that the DNA of humans and that of monkey species are 99%
similar suggests that they probably share ____________________.
5. The most specific way to provide evidence of common ancestry is by
using _______________________.
6. _______________________- embryos of
different organisms (chicken, human, rabbit) look
similar at certain early stages, which means the
same genes are being expressed at those times.
7. Use the diagram to the right, the embryological
development of the stages in the green box
(middle row) suggest that ___________________
and _______________________ are more closely
related because they look alike.
8. _______________________- is a structure that
has no apparent use; the _______________________ in humans may be
a remnant of a digestive organ still found in other organisms.
9. According to relative dating of fossils: the deeper under ground the
fossil is, the _______________________ it is.
IX. Ecology - the study of organisms and their interactions with the environment
A. Biomes and Ecosystems (ecological succession, desert, rain forest,
deciduous, coniferous, tundra, ocean, grassland, freshwater, climax
community, primary succession)
1. Small shrubs and annual plants are
represented in the pictures to the right by letter
_________________
2. Fires that destroy climax communities can
occur naturally in forests if, for instance,
lightning strikes trees or dry foliage. This helps
ecosystems by allowing __________________
to start over. This is represented by letter
___________________.
3. Hardwood trees and large plants are
associated with a ______________________.
This would be letter _____________________.
4. Place the letters (W-Z) from the diagram to the right in
order from primary succession to climax community.
_______________________
5. Biomes are typically named for the type of vegetation, so biomes that
primarily have varieties of grasses are called _______________________
biomes, but pine trees are usually in a _______________________
biome.
6. Two of the coldest biomes are the _______________________ and
taiga.
7. A biome that has a thick canopy of trees and plants is a
_______________________.
8. In the _______________________, the amount of precipitation
exceeds the amount of evaporation.
9. _______________________ biomes are aquatic and include lakes and
rivers. The organisms in these biomes are sensitive to even the smallest
environmental changes.
10. _______________________ forests have cone baring trees.
11. The _______________________ has varying salinity and temperature
zones.
12. Lions can easily stalk their prey in _______________________
biomes because the vegetation is the same color as
their fur, which serves as camouflage.
13. _______________________ biomes have sparse vegetation. The few
plants that can survive here have shallow root
systems that collect rain water as soon as it falls.
14. _______________________ trees have thin needle-like leaves
instead of broad leaves with a lot of surface area.
15. _______________________ trees have broad leaves that change
color and fall off in the fall.
16. In VA, most of the trees lose their leaves in the fall. The biome is a
_______________________ forest.
B. Vocab (consumer, autotrophic, biotic, abiotic, increase, decrease, species,
carnivore, omnivore, herbivore, scavengers, decomposers, producer, population,
heterotrophic, community, energy, ecosystem, biosphere)
1. A _______________________ is an organism at the beginning of a
food chain; produce their own food
2. Organisms, like plants, that can make their own food are
_______________________.
3. Organisms that feed off of other organisms are ___________________.
4. A _______________________ is an organism that eats producers or
other organisms for energy.
5. A nonliving part of the environment is a(n) _______________________
factor.
6. A living part of the environment is a (n) _______________________
factor.
7. A consumer that eats only producers is called a (n)
_______________________.
8. A consumer that eats both plants and animals is called a (n)
_______________________.
9. A _______________________ is a group of organisms that can
interbreed and produce fertile offspring.
10. Many populations of different organisms living together is a(n)
_______________________
11. A species that lives together and interbreeds is a(n)
_______________________
12. The community of organisms in an area including abiotic factors is a(n)
_______________________
13. The Earth represents a(n) _______________________
14. _______________________ is transferred through an ecosystem by
eating or consuming food.
15. _______________________ eat things that are already dead (ex.
vulture)
16. _______________________ break down decaying organisms and
nutrients are put back into the soil by bacteria and fungi like mushrooms)
17. [A hunter <---- a fox <---- a rabbit <---- grass or plants] In food webs or
food chains, the arrow ALWAYS points to the direction that
_______________________ flows.
18. [A hunter <---- a fox <---- a rabbit <---- grass] In this food chain, the
rabbit is a _______________________, the fox is a _________________,
and the grass is a _______________________
19. [A hunter <---- a fox <---- a rabbit <---- grass] In this example, the
rabbit and fox could not interbreed because they are not in the same
_______________________
20. [A hunter <---- a fox <---- a rabbit <---- grass] In this example, if the
rabbit population increased, then the fox population would probably
_______________________
C. Relationships (commensalism, mutualism, parasitism, symbiosis,
predation, water, sunlight, extinction, limiting factors, competition for food,
pollution, disease, climate)
1. _______________________- one organism harmed; other benefits
2. _______________________- both organisms benefit
3. _______________________- flea and a cat.
4. _______________________- buffalo and an insect eating bird
5. _______________________- organisms living together
6. When one organism benefits and the other is harmed the relationship
is called _______________________.
7. Anemones release poisonous chemicals from their tentacles that
paralyze prey. Clown fish are not affected by the poison & find protection
from predators by living near anemones. This is called ______________
because the fish don’t harm or benefit the anemone.
8. Things that limit the size of populations are called _________________
9. On the rain forest floor, a limiting factor for plants would be availability
of _______________________
10. In the desert, a limiting factor for both plants and animals would be
availability of _______________________
11. Hunting is encouraged for deer populations because they live in such
close proximity to each other that _______________________ is a limiting
factor.
12. Only 3,000 manatee Trichechus manatus are left, and most of them
are in the ocean around Florida. Because there is little genetic diversity, a
disease that reduces fertility might cause _______________________.
BIOLOGY
EOC
REVIEW
PACKET