Download emboj200852-sup

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

SR protein wikipedia , lookup

Biochemistry wikipedia , lookup

Protein moonlighting wikipedia , lookup

Cell culture wikipedia , lookup

Endomembrane system wikipedia , lookup

Protein wikipedia , lookup

QPNC-PAGE wikipedia , lookup

Plasmid wikipedia , lookup

Gene expression wikipedia , lookup

Protein adsorption wikipedia , lookup

Signal transduction wikipedia , lookup

Intrinsically disordered proteins wikipedia , lookup

Cell-penetrating peptide wikipedia , lookup

Polyclonal B cell response wikipedia , lookup

Expression vector wikipedia , lookup

Proteolysis wikipedia , lookup

List of types of proteins wikipedia , lookup

Western blot wikipedia , lookup

Transcript
SUPPLEMENTARY INFORMATIONS
Material and Methods
Reagents
DMSO, MG132, chloroquine, E64, MDL and propidium iodide were purchased from
SIGMA. Mowiol was purchased from Calbiochem. 35S-translabel was obtained from ICN.
Yeast 2-hybrid screen with Human MAFbx.
A bait plasmid was prepared by inserting cDNA encoding the NH2 terminal region of
human MAFbx (amino acids 1 to 227) in-frame with the GAL4 DNA-binding domain
plasmid, pGBKT7 (Clontech). This MAFbx fragment contains the Leucine Zipper (LZ) and
the leucine charged domains (LCD) and was used as a bait to screen a human adult skeletal
muscle library cloned in pACT2 (Clontech). Bait and library plasmids were co transformed
into yeast (strain Y190), and approximately 5x106 co transformants were screened. Primary
selection was accomplished by plating cells on medium lacking Trp, Leu, and His, in the
presence of 5mM 3-aminotriazol. Plating colonies on the same medium lacking adenine
performed a more stringent secondary selection. Surviving colonies were replica-plated on
medium containing X--Gal to assess the activity of -galactosidase. The inserts were
sequenced from those plasmids scoring positive when cotransformed with the original bait,
but negative when transformed alone and in combination with an irrelevant bait plasmid
(p53 in this case). The eIF3-f plasmid, pACT2-eIF3-f, which was identified in the screen,
was sequenced and found to contain the entire coding region of eIF3-f in-frame with the
GAL4 activation domain.
Plasmid constructs
eIF3-f constructs. The coding sequence of human eIF3-f obtained from the two-hybrid
screen was transferred in pCMV-Myc (Clontech) after Bgl2 restriction digest. The fulllength coding sequence and eIF3-f mutants were amplified by PCR to introduce BamHI and
EcoRI sites on each side of the open reading frame and cloned as BamHI and EcoRI
fragments into pGEX-3X. The coding sequence of Mouse eIF3-f was amplified by RT-PCR
by using forward primer: 5’-ggatccatggcttctccggccgtaccgg-3’ and reverse primer 5’gaattctcagccctgtggtgaaaacctc-3’ and subcloned into pCDNA3-T7-3HA after BamHI and
EcoRI restriction digest. The eIF3-f antisense construct was created by cloning the same
RT-PCR fragment in pCDNA3 after Bgl2-EcoRI restriction digest. The muscle specific
expression plasmid for eIF3-f was carrying out first by using the 1256 bp HindIII-BstEII
filled-in fragment of the muscle regulatory elements of Muscle Creatine Kinase (MCK) and
subcloned in pEGFP-C1 instead of the CMV promoter (pMCK-GFP). Then deletion of the
GFP sequence was introduced by NheI-BspEI filled-in digestion of pMCK-GFP plasmid
and reannealing of the resulting plasmid (pMCK). The HA-tagged eIF3-f coding sequence
was cloned in sense into SmaI–XbaI sites of pMCK (pMCK-eIF3-f sense). pMCK-eIF3-f
antisense was made by inserting in antisense at the XbaI site of pMCK expression vector,
the 1.8kb XbaI fragment of the pCMV-Myc-eIF3-f. Full-length mouse eIF3-f was cloned in
frame at the BamHI and EcoRI sites of the pMCK-IRES-GFP vector (Tintignac et al.,
2005). MAFbx constructs. Deletion in the F-box of MAFbx was introduced by PvuII
digestion of pACT2-MAFbx and self-annealing of the resulting plasmid. The full-length
coding sequences as well as mutants of MAFbx were amplified by PCR to introduce BamHI
and EcoRI sites on each side of the open reading frame and cloned as BamHI / EcoRI
fragments into pGEX-2T (Reynaud et al., 2000). Full-length and MAFbx-F-box were
cloned in pCMV5’-2Flag using BamHI and EcoRI restrictions sites. pshRNAi mouse
MAFbx was constructed by inserting at the BamHI-HindIII sites of the pTER+ plasmid
(Van de Weterring et al., 2003) a double synthetic oligonucleotides (sense oligo: (5’GATCCCCCCAGAAGATTCAACTACGTTTCAAGAGAACGTAGTTGAATGGTTTTTGGAAA3’; antisense oligo: 5’-AGCTTTTCCAAAAACCAGAAGATTCAACTACGTTCTCTTGAAACGT
AGTTGAATCTTCTGGGGG-3’). To design the control construct, two sets of oligonucleotide
pair (sense: 5’ATCCCCGTACGCGGAATACTTCGATTCAAGAGATCGAAGTATTCCGCGTA
CGTTTTTGGAAA-3’ and antisense 5’-AGCTTTTCCAAAAACGTACGCGGAATACTTCGATC
TCTTGAATCGAAGTATTCCGCGTACGGG-3’) directed against the firefly luciferase were
inserted into the BamHI-HindIII sites of the pTER+ plasmid. The coding sequence of human
eIF3-i was amplified by PCR to introduce EcoRI and XhoI sites on each side of the open
reading frame and cloned as EcoRI/XhoI fragment into pCMV-Myc (sense oligo eIF3-i: 5’GGGCGAATTCTGAAGCCGATCCTACCTACTGCAG-3’;
antisense
oligo
eIF3-i:
(5’-
CCGTCTGAGTTCTTAAGCCTCAAACTCAATTC-3’) ; the coding sequence of human
MURF-1was amplified by PCR to introduce BamHI and EcoRI sites on each side of the
open reading frame and cloned as BamHI/EcoRI fragment into pCMV-Flag. (sense oligo
MURF-1: 5’-CCGGAATTCTTGGATTATAAGTCGAGCCTGATCCAGG-3’; antisense MURF-1:
5’-CCGGAATTCCTACCCTAGTCCCTGCTCTCTGAG-3’).
Construction of stable C2C12 myoblasts cell lines for MCK-induced eIF3-f gene
expression in sense and/or antisense
C2C12 myoblasts were co-transfected by the phosphate calcium method with the plasmids
coding for HA tagged eIF3-f (Sense), or antisense (AS) under MCK promotor (pMCK)
together with pSV-Neo plasmid in a 1/20 ratio. Forty-eight hours after transfection, cells were
split in 100 mm diameter plate in the presence of 500 g/ml of geneticin. Stably transfected
cell lines resistant to geneticin after 14 days were isolated and cultured in the presence of 5
g/ml of geneticin.
Immunoprecipitation, Western blot and Antibodies
Muscle cells were rinsed in cold PBS and lysed in IP buffer (50 mM Tris pH 7.4, 150 mM
NaCl, 10% glycerol, 0.5% NP40, 0.5 mM Na-orthovanadate, 50 mM NaF, 80 M glycerophosphate, 10 mM Na-pyrophosphate, 1 mM DTT, 1 mM EGTA and 1 g/ml
leupeptin, 1 g/ml pepstatin and 10 g/ml aprotinin). Lysates were precleaned for 30min
with
protein-G
beads
and
immunoprecipitated
by
using
standard
procedures.
Immunoprecipitated proteins were loaded onto 10% SDS/PAGE gels before electrophoretic
transfer onto nitrocellulose membrane. Western blotting was performed by using an ECL kit
(Amersham Biotech.) according to the manufacturer’s instructions. An anti-MAFbx
antibody was generated by injecting rabbits with a GST-MAFbx fusion protein
corresponding to aa 1-102 of the human MAFbx protein. Antibodies were affinity purified
against an MBP-MAFbx fusion protein. Anti-Troponin T monoclonal (JLT-12), anti Tubulin (DM1A) and anti-Tropomyosins (TM 311) were from Sigma, anti-HA epitope
(12CA5) was from Roche, anti-myogenin (F5D) was from Pharmingen and anti-Flag (M2)
was from Kodak. Monoclonal anti-Myc (9E10), polyclonal anti-Myc (A14) and anti-MyoD
(C20) were purchased from Santa Cruz. Rabbit polyclonal anti-eIF3-f was from Rockland
Immunochemicals Inc. The Texas red-conjugated F(ab’)2 fragments of goat anti-mouse IgG
and the FITC-conjugated F(ab’)2 fragments of goat anti-rabbit IgG were obtained from
Jackson Immunoresearch Inc. Gel loading was normalized to protein concentration. Signals
were quantified by Gelscan.
RNA extraction and RT-PCR analyses
Total RNA was isolated from C2C12 cells using TRI REAGENT (Sigma). For semi
quantitative RT-PCR analysis, 1g of RNA was used to perform reverse transcription with
Superscript II RNaseH Reverse Transcriptase (Invitrogen) and hexanucleotides (Roche). 2l
of each reaction served as a template for PCR analysis. Primer pairs for the amplification of
the gene products were the following: eIF-3-f 5’-GAGTCAGAAGATGAAGTGGC-3’
forward,
5’-GATGAGGTCAACTCCAATGC-3’
GAGCTGAACGGGAAGCTCACT-3’
forward,
reverse
and
GAPDH
5’-
5’-TTGTCATACCAGGAAATGC-3’
reverse.
Preparation of recombinant proteins and GST (Glutathione-S-transferase) pull
down assay
GST-tagged forms of MAFbx and eIF3-f were made by transforming pGEX-3X-eIF3-f
constructs and pGEX2T-MAFbx constructs, respectively, into BL21-(DE3)-Lys bacterial
cells (Stratagene). Cells were grown to OD600 = 0.5-0.7 and induced with 0.1 mM isopropyl
-D-thiogalactopyranoside (IPTG) at 21oC for 12 h. Cell lysis, and affinity purification with
glutathione-agarose beads (Sigma) were done as described previously (Reynaud et al.,
2000). Fusion proteins were collected on Glutathione-Sepharose 4B (Pharmacia) and then
the purity of the GST and GST fusion proteins were analyzed by SDS-PAGE followed by
Coomassie brilliant blue staining of the gels. The plasmid coding the protein of interest was
transfected in C2C12 cells, 400 g of the resulting cell lysate, diluted in binding buffer (20
mM HEPES pH 7.9, 50 mM KCl, 2.5 mM MgCl2, 10% glycerol, 1 mM DTT and 10 g/ml
leupeptin 10 g/ml pepstatin and 10 g/ml aprotinin), was pre-cleaned with Glutathione
sepharose beads for 30 min. then the resulting supernatant was incubated with the beads for
3 hours. Beads were washed four times in NTEN buffer at room temperature and then mixed
with 1 volume of 2X SDS loading buffer, and bound proteins were analyzed by SDS-PAGE
using standard procedures. Alternatively (35S)- labeled proteins were prepared by coupled in
vitro transcription-translation using the QuickT7 rabbit reticulocyte lysate system (Promega)
and 1 to 10l of the mixture was loaded on the beads.
Ex vivo ubiquitination.
pCMV-Myc-eIF3-f and pCDNA-HA-Ubiquitin were co-transfected into C2C12 cells in the
presence of expression vectors encoding Flag-tagged MAFbxwt and/or Flag-MAFbx-Fbox. MG132 (30M) was added to the culture medium 2 hours before harvesting the cells.
For detection of eIF3-f-ubiquitin conjugates, cell lysates were prepared in ubiquitination
buffer (20 mM Tris pH 7.5, 150 mM NaCl, 1% NaDOC, 5mM EDTA, 0.05% SDS and 1
g/ml leupeptin 1 g/ml pepstatin and 10 g/ml aprotinin) and were spun at 15,000 g for
15min. The supernatants were immunoprecipitated with the anti-Myc antibody.
Immunoprecipitated proteins were revealed after SDS-PAGE (8%) with an anti-HA
antibody.
Immunofluorescence microscopy.
Confocal microscopy was performed with C2C12 myotubes. Cells grown on glass
coverslips were fixed in 3% paraformaldehyde in PBS at pH 7.4 for 30 minutes at room
temperature. Cells were permeabilized using 0.25% Triton X-100 in PBS for 15 minutes at
room temperature. Myotubes were rinsed in PBS and pre-incubated for 1h at room
temperature in PBS containing 3% BSA and 20% normal goat serum. Coverslips were then
incubated for 1 h at room temperature with the indicated primary antibodies diluted in PBS
containing 3% BSA and 10% normal goat serum. After three washes in PBS, the appropriate
secondary antibody was used in the same buffer. eIF3-f and MAFbx were detected using
rabbit polyclonal anti-eIF3-f and anti-MAFbx and stained with anti-rabbit FITC. DNA was
counterstained with a propidium iodide/RNaseA solution (0.5 g.ml-1/40 g.ml-1) in PBS.
Coverslips were then inverted into Mowiol. Images were acquired with a Zeiss LSM 510
Meta system and processed with LSM Image Browser and Photoshop 9.
References
Reynaud EG, Guillier M, Leibovitch MP and Leibovitch SA (2000) Dimerization of the
amino terminal domain of p57Kip2 inhibits cyclin D1-cdk4 kinase activity. Oncogene 19:
1147-1152.
Van de Wetering M, Oving I, Muncan V, Pon Fong MT, Brantjes H, van Leenen D,
Holstege FC, Brummelkamp TR, Agami R and Clevers H (2003) Specific inhibition of gene
expression using a stably integrated, inducible small-interfering-RNA vector. EMBO Rep. 6:
609-615.
Legends to Figures
Fig. S1. Specific interaction between eIF3-f and MAFbx
(A) C2C12 myoblasts were cotransfected with expression vectors encoding Flag-taggedMAFbx, MuRF-1 or Emi-1 together with Myc-eIF3-f. Cells were harvested 24 hours after
transfection and total cell lysates were immunoprecipitated with anti-Myc antibodies, then
the ubiquitin ligases and eIF3-f were detected by western blotting using monoclonal anti–
Flag and anti-Myc antibodies respectively (bottom panel). Portions of the cells lysates
corresponding to 10% of the input were subjected to immunoblot analysis (Top panel).
(B) C2C12 myoblasts were transfected with expression plasmids encoding Myc-eIF3-f or
eIF3-i together with Flag-MAFbx and then were treated as describes in (A).
(C) Myotubes at day4 of differentiation were incubated in PBS and myotubes were
harvested 6h later. Cell lysates were prepared , aliquots of total proteins were analyzed by
Western blotting and the remainings were immunoprecipitated with polyclonal anti-MAFbx
antibodies. The resulting precipitates were subjected to immunoblot analysis with anti-eIF3f antibodies, stripped and analyzed with anti-MAFbx antibodie as indicated
Figure S2. eIF3-f is induced during terminal differentiation of C2C12 myotubes
C2C12 myoblasts were cultured in high mitogen medium (20% FCS, GM) or in low
mitogen medium (2% FCS, DM). Proteins were resolved on a 10% SDS-PAGE and eIF3-f,
troponin T, and -tubulin (as standard control) were detected by Western blot analysis using
specific antibodies.
Figure S3. The LCD domain in MAFbx physically interacts with the MOV34 domain
in eIF3-f
(A) Identification of sequences in MAFbx required for interaction with eIF3-f. Various
GST-MAFbx deletion mutants were produced in E.Coli and 2g of the various GSTMAFbx fusion proteins bound to glutathione-agarose were incubated with
35
S-methionine-
labeled eIF3-f. The bound proteins were washed in high stringency and then analyzed by
SDS-PAGE and autoradiography (Left panel). Summary of results of the panel A is shown
(Right panel).
(B) Characterization of MAFbx binding domain in eIF3-f. Various GST-eIF3-f deletion
mutants were produced in E.Coli and 2g of GST-eIF3-f fusion proteins were incubated
with
35
S-methionine-labeled MAFbx. Bound proteins were analyzed by SDS-PAGE and
autoradiography (Left panel). Summary of results of the panel B is shown (Right panel).
Figure S4. Starving cells, glucocorticoid treatment or oxidative stress induces atrophic
responses in C2C12 myotubes
(A) Myotubes at day 4 of differentiation were treated with 225 M H202 (H2O2) for 6h, 50
M dexamethasone (DEX) for 24h or were starved by removal of growth medium, amino
acids and glucose for 6h (starved). Myotubes were assessed for morphological changes.
Scale bar 50m.
(B) Measurement of average myotubes diameter after treatments as described in (A). Results
are presented as the mean (n>100 myotubes per condition) +/- SEM.
(C) Quantitation of changes in total culture protein levels in response to dexamethasone,
oxidative stress (H2O2) and removal of growth medium, amino acids and glucose (starved).
Protein concentrations were determined at indicated time for H202 treatment and starved
myotubes or after 24hr treatment at the indicated concentration of dexamethasone (n= 6
plates of 35 mm per condition) +/- SEM.
Figure S5. Depletion of MAFbx by shRNAi affects eIF3-f polyubiquitination in C2C12
myotubes undergoing atrophy.
(A) C2C12 myoblasts were transfected by pTER+MAFbx or pTER+control. Myotubes at
day 3 of differentiation were incubated in PBS and myotubes were harvested 6h later. Cell
lysates were prepared and total proteins were subjected to Western blot with anti-MAFbx
and anti-TroponinT antibodies.
(B) Cell lysates were prepared from myotubes treated as indicated in (A) and 30g of total
proteins were used for in vitro ubiquitination assay.
35
S-methionine-labeled eIF3-f was
subjected to the in vitro ubiquitination reaction in the presence of control myotubes and/or
atrophic myotubes lysates. Reaction mixtures were separated on SDS-PAGE, followed by
autoradiography.
Figure
S6.
Conditional
expression
of
eIF3-f
antisense
represses
myogenic
differentiation while eIF3-f sense induces hypertrophy in C2C12 cells.
Pools of mock, antisense eIF3-f and sense eIF3-f expressing C2C12 myoblasts were
cultured in differentiation medium for 4 days. Staining with the Hemalin of Hansen shows
the morphology of myotubes. Scale bar 100 m.