* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Plant disease - Topic exploration pack
Western blot wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Plant breeding wikipedia , lookup
Non-coding DNA wikipedia , lookup
Cell-penetrating peptide wikipedia , lookup
Molecular cloning wikipedia , lookup
DNA supercoil wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Monoclonal antibody wikipedia , lookup
Community fingerprinting wikipedia , lookup
List of types of proteins wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Plant Disease Task 1 Both animals and plants have primary and secondary defence mechanisms. Primary defences are always present and provide barriers to prevent pathogen entry. If this primary barrier is broken and pathogens enter, then secondary defences are initiated. These can be passive (already formed) or active (have to be made). Look at the statements on the next page and write the statements into the correct sections of this table. Primary defences Passive secondary defences Plant Animal (e.g. human) Version 1 1 Active/induced secondary response Statements: Preformed antimicrobial substances; the Waxy cuticle, cell wall phytoanticipins e.g. glucosides, saponins Phagocytes white blood cells Hypersensitive response - burst of oxygen to trigger antimicrobial response Histamine release to attract blood cells Antimicrobial enzymes such as chitinases Cell wall reinforcement (callose, lignin, suberin, cell wall proteins) Lymphocytes - white blood cells Antimicrobial substances-phytoalexins (genistein or camalexin) Skin, hairs in nose, hydrochloric acid in stomach etc. Task 2 To understand the primary defences of plants against invasion, it is important you understand the structure of a leaf section. On the next page is a net diagram that can be folded into a cube. Using ‘help sheet 1’ (below), draw onto the net diagram the leaf section and then fold into a cube, using the tabs. Extension Using ‘help sheet 2’, repeat this exercise for the skin cell. What do you notice is similar between the two sections? Version 1 2 A leaf Make a 3D model leaf section. Draw in detail at least one palisade cell. Version 1 3 Help sheet 1 Leaf cell cross section: Version 1 4 Help sheet 2 Skin cell cross section: Version 1 5 Task 3 - Determining if a plant is infected or not Antigens are typically proteins that are present on the surface of all cells. These can be detected in the laboratory using antibodies which can bind specifically to the antigen. If a plant is infected with a pathogen the antigens from that pathogen will be present in the plant. To identify if the plant is infected scientists use the enzyme-linked immunosorbent assay ELISA test to see if the plant contains the pathogen antigen A simple summary of this test is shown below: Method: 1. Obtain your plant sample. 2. Liquidise the plant sample. 3. Add the plant sample to a plastic tube or ‘microtiter’ plate (96 well plate). 4. Leave for 5 minutes for all the proteins in the plant sample to bind to the plastic (including the disease antigen if present). 5. Wash the wells with a buffered salt solution to wash off any proteins that are not bound to the plastic. 6. Add a blocking agent (e.g. reconstituted milk powder). This is to block all the plastic that has not been covered with protein (as the antibody is a protein it will therefore stick to any free plastic and give a false positive result). 7. Wash again with buffered salt solution to remove the unbound blocking agent. 8. Add an antibody-enzyme complex (an antibody that is chemically bound to an enzyme) that is specific for the pathogen’s antigen. 9. Wash again with buffered salt solution to remove any unbound antibody-enzyme complex. 10. Add a colourless chemical (substrate) that the enzyme can change into a coloured product. 11. If the plant pathogen (antigen) is in the liquid in the tube will change colour. Version 1 6 Determining a particular antigen present in a plant sample Method: Using your knowledge of antigens and antibodies, draw a diagram to summarise the main stages in carrying out an ELISA test. 1. 2. 3. 4. Version 1 7 Task 4 - PCR techniques Using the link below, work through the animation and answer the following questions http://learn.genetics.utah.edu/content/labs/pcr/ 1. What does PCR stand for? 2. What is the purpose of PCR? 3. What are the 4 nucleotides that make up DNA? 4. What is a primer? Version 1 8 5. What is the role of DNA polymerase? 6. Why is the DNA heated to 95oC? 7. What property must a PCR tube have? Version 1 9 Task 5 - Polymerase Chain Reaction (PCR) A single piece of DNA can be amplified in the laboratory using the polymerase chain reaction (PCR). This process is done in vitro opposed to in vivo (in vitro in Latin means ‘in glass’ although now glass is typically replaced with plastic, in vivo means ‘within the living’ and typically means ‘in cells’). The ingredients for the process are: Sample DNA A plastic tube or microtiter plate (multi- Heat stable DNA polymerase (eg Taq DNA polymerase) welled plate) Thermocycler Primers Nucleotides (A, C, G & T) DNA nucleotides Cut out the stages below and put into the correct order using the template on the next page: Add the tube to the thermo cycler Extract DNA using a commercially available kit Denature DNA at 95C You have now turned one piece of DNA into two ATGCGTAGGGCTTAGCTTTCGGATTCTTCTTGCTATTC TACGCATCCCGAATCGAAAGCCTAAGAAGAACGATAAG ATGCGTAGGGCTTAGCTTTCGGATTCTTCTTGCTATTC + TACGCATCCCGAATCGAAAGCCTAAGAAGAACGATAAG ATGCGTAGGGCTTAGCTTTCGGATTCTTCTTGCTATTC TACGCATCCCGAATCGAAAGCCTAAGAAGAACGATAAG + ATGCGTAGGGCTTAGCTTTCGGATTCTTCTTGCTATTC TACGCATCCCGAATCGAAAGCCTAAGAAGAACGATAAG Add primers (TWO), nucleotides and DNA Heat to 72C the optimum temperature for the enzyme polymerase to the DNA sample in an Eppendorf tube ATGCGTAGGGCTTAGCTTTCGGATTCTTCTTGCTATTC TACGCATCCCGAATCGAAA + CGGATTCTTCTTGCTATTC TACGCATCCCGAATCGAAAGCCTAAGAAGAACGATAAG Cool to 55C this allows the primers to anneal ATGCGTAGGGCTTAGCTTTCGGATTCTTCTTGCTATTC TACGCA + CTATTC TACGCATCCCGAATCGAAAGCCTAAGAAGAACGATAAG Now repeat steps 5-7 34 times and you will have made 9 billion copies Obtain sample (e.g. blood at scene of crime) Version 1 10 1. 2. 4. 3. 5. 6. 8. 7. 9. Version 1 11 Task 6 Match the observations to the plant disease. Crown Gall disease Version 1 Barley powdery mildew 12 Tobacco mosaic virus 2. 1. Circular, powdery white spots on upper surface of the leaf 3. As galls grow, plants often become stunted, weak and may eventually die 4. Presence of fungus Erysiphe graminis 5. ‘Mosaic’- like mottling and discolouration on the 6. leaves 7. Presence of bacterium Agrobacterium tumefaciens 8. Tumour-like growths above soil level 10. 9. Fungal hyphae are produced on both upper and lower leaf surfaces Version 1 13