Download Maurizio Gentile Role of mTOR in the Activation of Prof. Andrea Cerutti

Role of mTOR in the Activation of
Marginal Zone B Cells by TACI
Maurizio Gentile
Doctoral Thesis UPF - 2014
DIRECTOR
Prof. Andrea Cerutti
iCREA
Fundación IMIM
Mount Sinai School of Medicine
i
ii
The beginning of knowledge is the discovery
of something we do not understand
-Frank Herbert
Alla mia famiglia
iii
iv
ACKNOWLEDGEMENTS
Non è facile citare e ringraziare, in poche righe, tutte le persone che
hanno contribuito alla nascita e allo sviluppo di questa tesi. Chi con una
collaborazione costante, chi con un supporto morale, chi con consigli e
suggerimenti o solo con parole di incoraggiamento, sono stati in tanti a
dare il loro apporto.
Un ringraziamento speciale va rivolto ad Andrea Cerutti per il privilegio
che mi ha concesso di effettuare questo lavoro di ricerca nel suo
laboratorio, per il suo prezioso aiuto scientifico e per gli impagabili
suggerimenti ricevuti.
Un grazie di cuore ai miei colleghi e amici di laboratorio, senza i quali
questa tesi non sarebbe mai stata realizzata. Ringrazio Linda per essere
stata sempre al mio fianco nei buoni ma soprattutto nei cattivi momenti;
senza di lei questi anni sarebbero stati difficili da vivere. Un grazie a
Giuliana per la sua sinceritá, a volte un pò dura, ma comunque nutrita da
un grande affetto. Irene, una macchina da guerra; instancabile, sempre in
prima linea senza perdere mai il sorriso. Ringrazio Carol per essere stata
una leale compagna di lavoro su cui ho potuto contare. Poi Sabrina,
l’esplosione di gioia fatta persona; una “pija” con dei sentimenti umili e
profondi. Inoltre Laura, con la sua forte metodocità e professionalità;
sempre accurata nei dettagli, con una capacità unica nel trasmettere le
sue conoscenze e con una spiccata sensibilità. David, nonostante mi abbia
tolto il titolo di unico uomo del lab, lo ringrazio per la sua disponibilità
costante e per la sua instancabile voglia di organizzare “escapadas”.
Ringrazio Alessandra per avermi dato un gran aiuto tanto sperimentale
quanto morale; è riuscita a risollevarmi in un difficile momento. Un
grazie è rivolto anche a Jordi Farrés, il componente adottato dal gruppo;
la sua risata travolgente ha dato un tocco di colore all’IMIM. Ringrazio
poi Jordi Sintes, ultimo acquisto del B Cell Biology Lab; un peccato non
v
aver avuto modo di lavorare con lui. Sono sicuro che con la sua pacatezza
avrei affrontato i momenti di stress in maniera molto più filosofica.
Inoltre, ringrazio a tutti i componenti del Mucosal Immunology Lab di
New York. In particolare vorrei ringraziare Meimei, per avermi dato
l’opportunitá di partecipare nel progetto di MUC2. Bing, per avermi
proporzionato reattivi importanti per il mio progetto. Kang, per avermi
dato un caloroso benvenuto a New York e per credere nelle mie capacitá.
Montse, senza la quale il primo anno nella grande mela sarebbe stato
molto duro. Un grazie anche a Cindy, Alejo, Sandra, Cooper e John, per
aver reso piú piacevole il mio soggiorno in USA.
Doveroso inoltre il ringraziamento a Eric Meffre e Rogier W. Sanders per
avermi coinvolto nella realizzazione di un lavoro di ricerca. Inoltre
ringrazio Charlotte Cunningham, Julio Pascual e Marta Crespo per
avermi concesso campioni preziosi di pazienti. Un grazie anche a Patrick
Wilson e a tutti i membri del suo laboratorio per avermi ospitato per due
settimane nella magnifica università di Chicago e per avermi mostrato la
tecnica per generare in maniera rapida anticorpi monoclonali umani.
Vorrei poi ringraziare tutte le persone dell’IMIM e del PRBB in generale.
I gruppi di José Yélamos, José Aramburu, Cristina López-Rodríguez,
Miguel López-Botet e il gruppo di genetica dell’osteoporosi. Ringrazio
anche tutto lo staff delle core facilities, in particolare Òscar, Eva ed
Erika. Un grande grazie anche a Rosa, Marta e Monica per avermi
coinvolto nelle diverse iniziative di comunicazione scientifica. Un grazie
speciale va rivolto a Andrea Vera, Rocio, Romilde, Leonor, Rocco,
Matteo, Arnau, Steven, Guy, Jordina e Josep.
Alla mia famiglia tutta, ai miei genitori, ai mei fratelli, va forse il
ringraziamento piú grande: quello che sono lo devo al loro amore e alla
costante dedizione nella mia crescita. Siete il mio riferimento piú bello e
dolce.
vi
Non posso concludere questa pagina di ringraziamenti senza citare le
persone che quotidianamente mi sono state vicine in questi anni. Un
grazie di cuore va a Walter. Non ci sono parole per esprimere la
gratitudine che ho nei suoi confronti; un enorme “grazie” per farmi
sentire in famiglia ogni qualvolta sono con lui. Un ringraziamento
speciale è rivolto anche a Pedro, per essermi stato vicino, per credere in
me, per sopportare i miei continui sbalzi di umore e per accompagnarmi
ai diversi colloqui di lavoro in giro per l’Europa.
Infine ringrazio a tutti gli amici, Leonardo, Diego, Eddie, Carlos e ai
membri della Famigghia. Grazie per avermi aiutato nei momenti difficili e
aver creato sempre nuove occasioni per ridere e stare insieme.
Grazie a tutti!
vii
viii
THESIS ABSTRACT
The marginal zone (MZ) of the spleen contains an innate-like subset of B
cells that mount rapid protective antibody responses to polysaccharides
and lipids from blood-borne viruses and bacteria. These antigens activate
MZ B cells by engaging somatically recombined B cell receptors (BCRs)
and germline-encoded pattern-recognition receptors, including Toll-like
receptors (TLRs). MZ B cells receive additional co-stimulatory signals
from a proliferation-inducing ligand (APRIL) and B cell-stimulating
factor of the TNF family (BAFF), two tumor necrosis factor (TNF)-related
cytokines released mainly by macrophages, dendritic cells and neutrophils
in response to microbes. BAFF and APRIL stimulate MZ B cells through
a poorly characterized receptor called transmembrane activator and
CAML interactor (TACI). Here we show that TACI induces antibody
production and class switching by activating the kinase mammalian target
of rapamycin (mTOR) through MyD88, an adaptor protein usually
associated with TLRs. The discovery of this rapamycin-sensitive signaling
pathway may facilitate the development of novel strategies for the
modulation of protective or pathogenic antibody responses emanating
from MZ B cells.
ix
RESUM DE LA TESI
La zona marginal (ZM) de la melsa conté un subgrup de cèl·lules B de
tipus innat que organitzen de forma ràpida respostes d’anticossos
protectors contra polisacàrids i lípids de virus i éacteris transmesos per la
sang. Aquests antígens activen les cèl·lules B de la ZM en interaccionar
amb receptors de les cèl·lules B (BCR) que han patit recombinació
somàtica i receptors de reconeixement de patrons, incloent els receptors de
tipus Toll (TLR). Les cèl·lules B de la ZM reben senyals co-estimuladores
addicionals del lligand inductor de proliferació (APRIL) i el factor
estimulant de cèl·lules B de la família del TNF (BAFF), dos citocines
relacionades amb el factor de necrosis tumoral (TNF) alliberades
principalment per macròfags, cèl·lules dendrítiques i neutròfils en resposta
a microbis. BAFF i APRIL estimulen les cèl·lules B de la ZM mitjançant
un receptor poc caracteritzat anomenat activador de transmembrana i
interactor de CAML (TACI). En aquest estudi demostrem que TACI
indueix producció d’anticossos i canvi de classe de la cadena pesada de
les immunoglobulines activant la quinasa diana de la rapamicina dels
mamífers
(mTOR)
mitjançant
MyD88,
una
proteïna
adaptadora
habitualment associada amb els TLRs. El descobriment d’aquesta via de
senyalització sensible a la ramapicina podria facilitar el desenvolupament
de noves estratègies per la modulació de les respostes protectores o
patogèniques dels anticossos produïts per les cèl·lules B de la ZM.
x
PREFACE
Blood-borne encapsulated bacteria such as Streptococcus pneumoniae,
Haemophylus influenzae and Neisseria meningitidis are fast replicating
pathogens that account for the death of millions of children each year,
particularly in developing countries. The pathogenicity of encapsulated
bacteria depends on surface capsular polysaccharides (CPSs), which
interfere with the phagocytic activity of neutrophils and macrophages of
the innate immune system. The adaptive immune system compensates for
this limitation by inducing CPS-reactive antibodies, which opsonize
encapsulated bacteria and thus enhance their clearance by phagocytes.
CPS-specific antibodies are produced by unique B cells positioned in the
MZ of the spleen, a lymphoid compartment strategically interposed
between the circulation and immune system.
Unlike conventional protein antigens, CPS antigens do not efficiently
activate conventional follicular B cells, which generate long-lasting
antibodies with high affinity for antigen by establishing cognate
interactions with T helper cells in the germinal center (GC) of lymphoid
follicles. Instead, CPSs predominantly activate MZ B cells, which produce
antibodies through an extrafollicular pathway that does not require
cognate help from T cells. Despite being short-lived and having low
affinity for antigen, antibodies produced by MZ B cells provide quick
protection against blood-borne microbes. Indeed, these antibodies emerge
as early as 1-3 days after the onset of the infection, whereas the antibodies
produced by follicular B cells require 5 to 7 days.
While lymphoid follicles develop during fetal life, the MZ develops
after birth and reaches full maturation after the second year of life. This
developmental delay may explain why non-vaccinated children are
particularly
susceptible
to
infections
by
encapsulated
bacteria.
Vaccination with protein-conjugated CPSs circumvents this problem by
xi
stimulating T cell-dependent (TD) antibody responses in follicular B cells.
In adults, vaccination with native CPSs provides protection by simulating
T cell-independent (TI) antibody responses in MZ B cells. However, this
protection vanishes in individuals that undergo splenectomy as a result of
trauma or disease.
The overall aim of this work was to gain new insights into the
mechanisms underlying the activation of human MZ B cells. By showing
that MZ B cells utilize a rapamycin-sensitive signaling pathway to
generate immunoglobulin M (IgM) as well as well as class-switched IgG
and IgA antibodies, our studies may facilitate the development of novel,
more effective and less expensive vaccine strategies against encapsulated
bacteria and other blood-borne microbes, including viruses. This need for
new vaccines is particularly pressing in developing countries and in
patients with primary or acquired antibody deficiencies associated with an
impaired function of MZ B cells, including common variable
immunodeficiency (CVID), HIV infection and malaria. Finally, our
findings may have implications in autoimmune disorders involving
abnormal activation of autoreactive MZ B cells, including systemic lupus
erythematosus,
rheumatoid
arthritis
thrombocytopenic purpura.
xii
and
possibly
idiopathic
CONTENTS
Thesis abstract................................................................
Preface............................................................................
List of figures.................................................................
Abbreviations.................................................................
vii
ix
xiii
xiv
CHAPTER 1 INTRODUCTION
1. The Immune system..................................................
1.1. Microbial sensing....................................................
1.1.1. Antigen recognition by TLRs..............................
1.2. Innate immune response..........................................
1.3. Adaptative immune response .................................
3
4
5
6
7
2. B cell..........................................................................
2.1 B cell development...................................................
2.1.1. CSR .....................................................................
2.1.2. SHM.....................................................................
2.2. Antibodies...............................................................
2.3. B cell activation......................................................
2.3.1. TD antibody responses.........................................
2.3.2. Plasma cell and memory B cell differentiation....
2.3.3. TI antibody responses..........................................
2.4. MZ B cell responses................................................
9
9
13
17
18
21
22
24
25
28
3. BAFF and APRIL in B cell responses.......................
3.1. BAFF and APRIL signaling in B cells....................
32
33
4. BAFF and mTOR.......................................................
4.1. Composition of mTOR-containing complexes.......
4.2. Biology of mTORC1 and mTORC2.......................
4.3. Downstream targets of mTOR................................
4.4. mTOR in BAFF signaling.......................................
4.5. mTOR in antibody responses..................................
37
38
39
41
42
43
xiii
CHAPTER 2 AIMS
Aims…...........................................................................
47
CHAPTER 3 MATERIALS AND METHODS
Material and Methods…................................................
51
CHAPTER 4 RESULTS
TACI activates mTOR through a mechanism
involving MyD88...........................................................
65
TACI enhances IRAK, IKK and NF-κB activation
through mTOR...............................................................
72
TACI enhances NF-κB dependent gen transcription
through mTOR...............................................................
76
TACI enhances CSR through mTOR.............................
80
TACI enhances MZ B cell proliferation through
mTOR.............................................................................
85
TACI enhances antibody production through
mTOR............................................................................
92
CHAPTER 5 DISCUSSION
Discussion......................................................................
101
CHAPTER 6 CONCLUSIONS
Conclusions....................................................................
115
Publications....................................................................
References......................................................................
119
121
xiv
LIST OF FIGURES
Figure 1. Pre-BCR and BCR on B cell precursors and
mature B cells...................................................................
11
Figure 2. V(D)J recombination.........................................
12
Figure 3. CSR...................................................................
15
Figure 4. TD antibody responses by Follicular B cells....
22
Figure 5. TI antibody responses by MZ B cells...............
26
Figure 6. Structure of the spleen.......................................
30
Figure 7. Signaling pathway emerging from TACI and
BAFF-R............................................................................
34
Figure 8. Structure of TACI protein.................................
36
Figure 9.Structure of mTOR.............................................
38
Figure10. Signals emanating from TORC1......................
40
xv
ABBREVIATIONS
4EBP1
ADCC
AID
APC
APRIL
BAFF
BCMA
BCR
Blimp1
CAML
CBP
CD40L
CLR
CRD
CSR
CVID
DCs
DD
DEPTOR
FDC
GAP
H
HSPGs
Ig
iNKT
IRAK
L
LKB1
LLPCs
MALT
MHC
mLST8
mTOR
Factor 4E binding protein 1
Antibody-dependent cell-mediated cytotoxicity
Activation-induced cytidine deaminase
Antigen presenting cell
A proliferation-inducing ligand
B-cell activating factor
B cell maturation antigen
B cell receptor
B limphocyte-induced maturation protein 1
Calcium-modulating cyclophilin ligand
Cap binding
CD40 ligand
C-type lectin receptor
Cysteine-rich motifs
Class switching recombination
Common variable immunodeficiencies
Dendritic cells
Death domain
DEP domain containing mTOR - interacting protein
Follicular dendritic cell
GTPase activating protein
Heavy
Heparan sulfate proteoglycans
Immunoglobulin
invariant NKT
IL-1R-associated kinase
Light
Liver kinase B1
Long lived plasma cells
mucosal -associated lymphoid tissue
Major histocompatibility complex
mammalian lethal with sec 13 protein 8
Mammalian target of rapamycin
xvi
mTORC
MZ
NK
pDC
PDGF
PDK1
PRRs
RAG
RAPTOR
RSS
S1P1
SAP
SCID
SHM
SLAM
SLE
SLPCs
TACI
TCR
TD
TFH
TI
TLR
TNFR
TRAF
TSC
V(D)J
XBP1
mTOR complex
Marginal zone
Natural killer
plasmacytoid dendritic cell
Platelet-derived growth factor
Pyruvate dehydrogenase kinase 1
Pattern recognition receptors
Recombination activating gene
regulatory-associated protein of mTOR
recombination signal sequences
Sphingosine 1 phosphate receptor 1
SLAM associated protein
Severe combined immunodeficiency
Somatic hypermutation
Signaling lymphocyte activation molecule
Systemic lupus erythematosus
Short lived plasma cells
Transmembrane activator and CAML interactor
T cell receptor
T cell dependent
T follicular helper cells
T cell independent
Toll-like receptor
Tumor necrosis factor receptor
TNF receptor associated factor
Tuberous sclerosis complex
Variable diversity joining segments
X box binding protein
xvii
xviii
CHAPTER 1
INTRODUCTION
Page 1
Page 2
INTRODUCTION
1. The immune system
The immune system is composed of a series of highly integrated physical
structures and biologic processes that protect our body against disease.
This protection involves the recognition and clearance of foreign agents
referred to as antigens, which range from toxic molecules to complex
microorganisms including viruses, bacteria, fungi, and parasites. These
pathogens usually invade our body through the skin and mucosal
surfaces1. When invasion occurs, various classes of leukocytes of our
immune system sense the presence of intruding microbes and thereafter
mount protective innate and adaptive responses characterized by a
progressively increasing specificity 2, 3.
The immune system can be divided in two fundamental components.
The innate immune system provides a first line of defense that generates
nonspecific responses capable to recognize and completely or partially
clear invading microbes. The adaptive immune system provides a second
line of defense that generates specific responses capable to completely
remove invading antigens and generate immunological memory.
Innate
immunity
is
evolutionarily
conserved
and
provides
fundamental defensive mechanisms against pathogens1. Evolution has
selected poorly specific innate immune receptors called pattern
recognition receptors (PRRs), which recognize highly conserved
microbial motifs termed pathogen associated molecular patterns (PAMPs).
PRRs are non-clonally distributed germline-encoded receptors that
activate neutrophils, macrophages, monocytes, dendritic cells (DCs) and
other phagocytic and non-phagocytic effector cells of the innate immune
system to provide immediate protection2. Although essential in the early
phases of an infection, innate immune cells and their PRRs are not always
adequate to mediate complete pathogen clearance. To compensate for this
Page 3
limitation, vertebrates have evolved an additional and more sophisticated
mechanism of immunological defense known as adaptive immunity4.
Adaptive immune responses involve specific anticipatory immune
receptors known as B cell receptor (BCR) and T cell receptor (TCR),
which are specifically expressed by B and T lymphocytes, respectively.
BCRs and TCRs are encoded by somatically recombined genes and
recognize specific antigenic determinants on invading microbes5-7. Of
note, adaptive immune responses require “preparatory” signals generated
by early innate immune recognition events.
1.1. Microbial sensing
PRRs recognize highly conserved molecules associated with the external
protective structures of bacteria and fungi, including lipopolysaccharide
(LPS), peptidoglycan, lipoteichoic acids, lipoproteins and β-glucan. In
addition, PRRs recognize nucleic acids associated with viruses, including
single-strand RNA (ssRNA), double-strand RNA (dsRNA) and nonmethylated deoxyribocytidinephosphateguanosine (CpG) DNA. This is
probably because the envelope and capsid that protect viral pathogens
often include autologous molecules that originating from the infected cells
of the host. Of note, PRRs do not discriminate between invasive
pathogens and noninvasive commensals, which physiologically inhabit
our mucosal surfaces. Yet, the immune system attacks pathogens but
tolerates commensals, except when commensals breach mucosal barriers8.
According to their cellular localization, PRRs can be broadly grouped
into secreted, transmembrane and intracellular molecules. Secreted PRRs
mediate humoral innate immunity and include pentraxins (e.g., C-reactive
protein and pentraxin-3), ficolins and collectins (e.g., mannose-binding
lectin). These soluble PRR promote early pathogen recognition either
directly or indirectly via activation of the complement cascade, thereby
facilitating pathogen opsonization and phagocytosis9. Cytosolic receptors
Page 4
include the nucleotide binding domain and leucine-rich repeats containing
receptors (NLRs) and the retinoic acid-inducible gene I (RIG I)-like
receptors (RLRs). NLRs detect degradation products of peptidoglycans10
as well as non-microbial stressors11, whereas RLRs recognize ssRNA and
some dsRNA viruses12. Transmembrane PRRs include surface and
intracellular Toll-like receptors (TLRs) as well as surface C-type lectin
receptors (CLRs), including DC-specific ICAM-3-grabbing nonintegrin
(DC-SIGN), langerin, mannose receptor, dectin-1, and various scavenger
receptors. TLRs include at least ten distinct PRRs that recognize LPS,
peptidoglycan, lipoteichoic acids, lipoproteins, flagellin, dsRNA, ssRNA
and CpG DNA. In contrast, CLRs mostly recognize carbohydrates on
viruses, fungi, mycobacteria, bacteria and helminthes, including mannose,
fucose and glucan13.
In
addition
to
facilitating
microbial
sensing,
opsonization,
phagocytosis and killing, secreted, transmembrane and intracellular PRRs
deliver intracellular signals that stimulate the production of a vast array of
cytokines and chemokines. These soluble immune mediators amplify the
activation of both innate and adaptive arms of the immune system.
1.1.1. Antigen recognition by TLRs
TLRs were the first molecules identified among PRRs and remain the
most widely studied family of PRRs. Humans express 10 TLRs, whereas
mice express 13 TLRs14. These type-1 transmembrane proteins bind to a
wide variety of PAMPs through a leucine-rich repeat (LRR) ectodomain
and deliver intracellular signals through a cytosolic Toll/IL-1 receptor
(TIR) domain. TLRs can recognize different ligands as a result of
structural diversification of their ectodomains, which include variations
in length and insertions at the level of the LRR loop15.
TLRs use their intracellular TIR domain to recruit several signaling
adaptor proteins, including MyD88 (myeloid differentiation fator 88), Mal
Page 5
(MyD88-adaptor like; also called TIRAP), TRIF (TIR-domain containing
adaptor protein inducing IFNβ) and TRAM (TRIF-related adaptor
molecule). MyD88 is required for signaling downstream all TLRs, except
TLR3, which exclusively recruits TRIF. TLR4 is unique among TLRs in
that it signals via both MyD88-dependent and MyD88-independent
(TRIF-dependent) pathways. In some instances, MyD88 and TRIF do not
directly interact or signal with the TIR domain, but rather use Mal and
TRAM adaptor proteins. In particular, TRAM is required for the binding
of TRIF to TLR3 and TLR4, whereas Mal is required for the binding of
MyD88 to TLR2 and TLR4, but not TLR9 and TLR516, 17.
Individual TLRs recruit multiple signaling molecules downstream of
MyD88 and TRIF, including members of the IRAK (IL-1 receptorassociated kinase), TRAF (TNF receptor-associated factor) and IRF
(interferon responsive factor) families18. In general, MyD88 induces the
production of inflammatory cytokines by activating NF-κB and MAPK
kinases, whereas TRIF stimulates type-I IFN production via IRFs. In
general, engagement of individual TLRs results in the formation of
different signaling complexes that induce distinct cellular responses.
1.2. Innate immune response
Granulocytes
(including
neutrophils,
eosinophils
and
basophils),
monocytes, macrophages, DCs, natural killer (NK) cells and mast cells of
the innate immune system promote early protective responses after
recognizing microbes through PRRs2. Neutrophils are the first leukocytes
that migrate from the circulation to an infection site19. At this site,
neutrophils remove dead cells and cellular debris and phagocytose and kill
microbes. NK cells play a major role in the recognition and destruction of
cells that are either infected by viruses or transformed by a neoplastic
process20. Monocytes contribute to the induction of inflammation but also
differentiate to macrophages and DCs21,
Page 6
22
. Macrophages phagocytose
microbes, dead cells and cellular debris, kill engulfed pathogens and
induce inflammation23. Furthermore, macrophages positioned along the
subcapsular sinus of lymph nodes and marginal sinus of the spleen present
native antigen to B cells. In contrast, DCs internalize microbes to generate
antigenic peptides that are presented to T cells in the context of major
histocompatibility
complex
(MHC)
molecules,
also
defined
as
24
histocompatibility leukocyte antigen (HLA) in humans . DCs become
professional antigen-presenting cells (APCs) capable to initiate both T and
B cell responses after migrating from the infection/inflammation site to
draining lymph nodes. DCs also promote the recruitment, activation and
maturation of multiple cells of the innate and adaptive immune systems,
including T and B cells25. Of note, DCs include conventional or myeloid
DCs (mDCs), which mainly mediate antigen presentation, and lymphoid
or plasmacytoid DCs (pDCs), which predominantly mediate antiviral
responses26. Finally, mast cells elicit inflammation and cooperate with
eosinophils and basophils to induce the expulsion of parasites infesting
mucosal organs27. Remarkably, DCs as well as other cells of the innate
immune system play a fundamental role in the initiation, polarization and
amplification of adaptive immune responses, not only by presenting
antigen to T cells, but also by releasing cytokines and chemokines.
1.3. Adaptive immune response
The adaptive immune response includes both cellular and humoral
components that are mediated by T cells and B cell, respectively. T cells
include two major CD4+ and CD8+ subsets. While CD8+ T cells are
primarily responsible for the destruction of cells infected with intracellular
pathogens, CD4+ T cells help the activation of CD8+ T cells and B cells by
secreting cytokines. Several subtypes of T helper (Th) cells with specific
cytokine secretion patterns regulate the outcome of distinct immune
responses. The two earliest and most clearly defined Th cell subsets are
Page 7
known as Th1 and Th2 cells
28
. Th1 cells mediate protective responses
against intracellular pathogens by secreting large amounts of interferon-γ
(IFN-γ) and tumor necrosis factor-α (TNF-α), two cytokines that activate
macrophages and induce IgG2 production by B cells. In contrast, Th2
cells predominantly secrete IL-4, IL-5 and IL-13 to mediate immune
responses against extracellular pathogens, including helminths. Th2 cells
are also implicated in pathogenic allergic reactions to common antigens
referred to as allergens29. Both anti-helminthic and allergic Th2 responses
lead to IgG1 and IgE production by B cells. A third subset of Th cells,
known as T follicular helper (TFH) cells, is specialized in the activation of
B cells in the germinal center (GC) of secondary lymphoid organs,
including spleen and lymph nodes. These TFH cells appear essential to
initiate protective antibody responses and generate long-term humoral
immunity.
Unlike effector cells of the innate immune system, T and B cells
recognize specific antigens through somatically recombined TCRs and
BCRs, respectively30, 31. These structures emerge from a process of V(D)J
gene recombination that takes place in the bone marrow and thymus,
respectively, and generates lymphocytes that express a virtually unlimited
repertoire of highly specific antigen receptors. A side effect of V(D)J gene
recombination relates to the possibility of producing pathogenic TCRs and
BCRs that recognize self-antigens. However, T and B cell precursors in
primary lymphoid organs undergo appropriate negative selection
processes
that
usually
prevent
the
generation
of
autoreactive
lymphocytes32. Moreover, T cell precursors undergo an additional process
of positive selection to further ensure their ability to recognize foreign
molecules in the context of either MHC-I or MHC-II molecules33.
While TCRs recognize processed peptide-MHC complexes exposed
on the surface of APCs or infected cells, BCRs recognize native epitopes
associated with soluble or cell-bound antigens. In addition, BCRs can
Page 8
internalize native antigens and induce their processing by activated B cells
into surface peptide-MHC-II complexes that are recognized by CD4+ T
cells. Due to this dual activity, BCRs can mediate both T cell-dependent
(TD) and T cell-independent (TI) antibody responses. The former usually
target common protein antigens, whereas the latter usually target type-1 TI
(TI-1) antigens such as bacterial wall components and TI-2 antigens such
as carbohydrates with repetitive structure. In general, TI antibody
responses involve the rapid activation of B cells by microbial structures
capable to engage both BCRs and PRRs, including TLRs34. Thus, B cells
mediate adaptive humoral immunity not only by directly differentiating
into antibody-secreting cells in response to TI antigens, but also by
serving as professional APCs capable in response to TD antigens35.
2. B cells
B cells mediate humoral responses in the context of the adaptive immune
system. Produced in the bone marrow through an antigen-independent
process, B cells expressing highly specific BCRs migrate to the spleen and
other secondary lymphoid tissues, where they differentiate into antibodysecreting
plasma
cells
in
an
antigen-dependent
manner.
These
developmental processes are integrated by central and peripheral
“checkpoints” that promote the generation of protective antibodies
reactive against microbes but not autologous antigens36.
2.1. B cell development
B cell development includes two distinct antigen-independent and
antigen-dependent phases. The antigen-independent phase of B cell
development takes place in the bone marrow and generates a clonal
repertoire of B cells that express diverse BCRs through a process known
as immunoglobulin (Ig) V(D)J recombination. Transitional B cells
emerging from the bone marrow migrate to secondary lymphoid organs,
Page 9
including the spleen and lymph nodes. At these sites, transitional B cells
become mature B cells that undergo further Ig gene diversification
through two processes known as class switch recombination (CSR) and
somatic hypermutation (SHM).
Primary B cell development takes place in the yolk sac, fetal liver and
fetal bone marrow during before birth
37
. After birth, the generation of
mature B cells occurs in the bone marrow38,
39
. Primary B cell
development proceeds through several stages (Fig. 1), which can be
distinguished on the basis of B cell expression of various surface and
intracellular molecules and ordered patterns of Ig heavy (H) chain and Ig
light (L) chain gene rearrangement40.
Newly generated B cells carry a transmembrane Ig receptor (BCR)
that includes two identical IgH molecules and two identical IgL molecules
of the Igκ or Igλ type. Both IgH and IgL chains include an antigenbinding variable region encoded by recombined VHDJH and VLJL genes,
respectively. The variable (V), diversity (D) and joining (J) segments of
these genes are organized in multiple families within the IgH and IgL loci
and their assembly into in-frame VHDJH and VLJL exons requires an
antigen-independent
diversification
process
known
as
V(D)J
41
recombination (Fig. 2).
Common lymphoid progenitors committed to become B cells initially
differentiate into a pro-B cell, which join a D with a JH gene to form a DJH
segment that subsequently recombines with a VH gene to assemble a
complete VDJ exon encoding the antigen-binding VH region. These
recombination events randomly target individual members of V, D and J
gene families and require the induction of double-stranded DNA breaks in
specific recombination signal sequences of these genes by a heterodimeric
recombination activating gene (RAG) complex that includes RAG1 and
RAG2 proteins42. These recombinases are also required for the
rearrangement of TCR gene segments and thus their deficiency causes
Page 10
severe combined immunodeficiency, which is characterized by the lack of
both B and T cells43 44.
RAG1 and RAG2 recognize short recombination signal sequences
(RSS) adjacent to V, D and J gene segments. The initiation of V(D)J
recombination is regulated at three distinct levels. First, the RAG proteins
are expressed at high levels only during the early stages of lymphocyte
development, thereby ensuring that the reaction does not occur in other
tissues or cell types. Second, the ability of RAG to initiate V(D)J
recombination is dictated by the ‘accessibility’ of short RSSs within
chromatin45,
46
. And third, V(D)J recombination is regulated by the
position and three dimensional architecture of Ig gene loci in the nucleus,
chromosome looping and condensation having a vital role in allowing
recombination between widely spaced gene segments.
Productive VHDJH recombination inhibits RAG expression, leading to
the transcription of the VHDJH gene together with the heavy chain constant
gene µ (Cµ) gene to form a complete IgH chain. Subsequent assembly of
the IgH chain with a surrogate invariant IgL chain formed by V-preB and
λ5 proteins is followed by transient surface expression of a pre-B cell
receptor (pre-BCR) that also includes anchoring Igα and Igβ subunits with
signaling function. Signals emanating from the pre-BCR are a critical
checkpoint for B cell development, because they regulate the expansion of
pre-B cells and their further differentiation into immature B cells47
Immature B cells re-express RAG proteins to initiate the
rearrangement of VL and JL segments from the IgL locus to form a
complete VJ gene. RAG proteins target the Igλ locus if the Igκ locus fails
to generate an in-frame VLJL rearrangement. Assembly of the IgL chain
with the IgH chain is followed by the expression of a fully competent
BCR of the IgM type on the surface of immature B cells. At this important
checkpoint, immature B cells that express an autoreactive BCR undergo
receptor editing, which involves the replacement of the V segment of an
Page 11
autoreactive VLJL gene with an upstream VL segment through a RAGmediated reaction. An immature B cell unable to edit its autoreactive BCR
is eliminated by apoptosis through clonal deletion 36.
After progressing through this tolerance checkpoint, immature B cells
leave the bone marrow as transitional B cells that co-express IgM and IgD
through a process of alternative splicing of a long RNA containing VHDJH
as well as both Cµ and Cδ exons48. These transitional B cells become fully
mature B cells after colonizing peripheral lymphoid organs. Here, stromal
cells provide mandatory survival signals that support the maintenance of a
highly diversified and fully functional naïve B cell repertoire.
Figure 1. Pre-BCR and BCR on B cell precursors and mature B cells. Early B
cell development includes sequential VHDJH rearrangement of the Igµ heavy
chain (HC), followed by VLJL rearrangement of the Ig light chain (LC). The
pre-BCR includes Igµ, VpreB and λ5 surrogate IgL chain proteins, and the
signaling molecules Igα and Igβ. After successful VLJL recombination, a mature
BCR with both HC and LC is formed. The resulting immature B cell
differentiates to a mature B cell that expresses both surface IgM and IgD through
alternative mRNA splicing.
Page 12
Figure 2. V(D)J recombination. The Ig loci include multiple cassettes of V, D,
and J (IgH locus) and V and J (IgL loci, termed Igκ and Igλ) gene segments that
undergo random rearrangement during B-cell development in the bone marrow
through a process involving RAG proteins. In the IgL loci, a VL gene segment
rearranges with a JL gene segment to generate a VLJL exon. Transcription of VLJL
and subsequent splicing of VLJL mRNA to a Cκ or Cλ mRNA generates a VLJLCL mRNA that is polyadenylated and then translated into a mature IgL chain
protein. In the IgH locus, similar recombination and transcription events lead to
the formation of a VHDJH-CH (Cµ in the earliest stages of B cell differentiation)
mRNA that undergoes splicing and polyadenylation to generate a mature IgH
protein. In each Ig locus, V gene transcription initiates at the level of a leader (L)
sequence positionated upstream of each V segment. Ultimately, two identical IgH
and two identical IgL chain proteins are assembled to generate a membranebound heterotetrameric protein termed BCR.
2.1.1 CSR
Mature B cells expressing somatically recombined V(D)J genes further
diversify their antibody repertoire through class switching recombination
(CSR) (Fig. 3), a DNA-modifying process that occurs in secondary
lymphoid organs and requires a B cell-specific enzyme called activation-
Page 13
induced cytidine deaminase (AID)49. CSR modulates the effector
functions of an antibody without changing its antigen specificity by
replacing the Cµ gene encoding the CH region of the IgM molecule with
the Cγ, Cα or Cε gene encoding the CH region for IgG, IgA or IgE,
respectively. In humans, there also is a non-canonical CSR replacement of
Cµ with Cδ that results in selective IgD expression48.
In TD antibody responses, BCR-engaged B cells express AID in the
GC of secondary lymphoid follicles after receiving activation signals from
,
TFH cells expressing CD40 ligand (CD40L) and various cytokines50 51. In
TI antibody responses, BCR-engaged B cells express AID in
extrafollicular areas after receiving activation signals from TLR ligands
and CD40L-like molecules and cytokines produced by DCs, macrophages,
neutrophils and other antigen-capturing cells of the innate immune
system50.
CSR involves an AID-mediated recombinatorial event that targets
intronic DNA sequences called switch (S) regions, which are located
upstream of each CH gene. S regions guide CSR by recruiting AID after
undergoing germline transcription. In general, TD61, 62 and TI52, 53 signals
induce AID expression and germline transcription by activating the
transcription factor nuclear factor-κB (NF-κB). Germline transcription
requires additional signals from signal transducer and activation of
transcription (STAT) proteins, which are induced by IL-4, IL-10, IL-21
and IFN-γ, and from SMAD and RUNX transcription factors, which are
induced by transforming growth factor-β (TGF-β). Each of these
cytokines activates germline transcription by inducing promoters located
upstream of intervening (IH) exons, S regions and CH genes.
In the presence of appropriate stimuli, germline IH-S-CH transcription
proceeds through the S region and terminates downstream of the CH gene.
The resulting primary transcript physically associates with the template
strand of the DNA in the S region to form a stable DNA-RNA hybrid.
Page 14
This structure generates R loops in which the displaced non-template
strand exists as a G-rich single-stranded DNA. AID deaminates cytosine
residues on both strands of S region DNA, thereby generating multiple
DNA lesions that are ultimately processed into double-stranded DNA
breaks. By generating and repairing DNA breaks, the CSR machinery
rearranges the IgH locus, thereby yielding a deletional recombination
product known as switch circle. Fusion of double-stranded DNA breaks at
the two recombining S regions through the non-homologous end-joining
pathway induces looping-out deletion of the intervening DNA, thereby
juxtaposing VHDJH to a new CH gene54. Of note, the detection of AID,
secondary germline transcripts and switch circles in activated B cells
indicates the presence of ongoing CSR. Secondary germline transcripts
derive from the splicing of primary transcripts to remove the intronic S
region and join the IH exon with CH exons.
Page 15
Figure 3. CSR. The IgH locus contains a rearranged VHDJH exon encoding the
antigen-binding domain of an Ig. B cells produce intact IgM and IgD receptors
(BCRs) through a transcriptional process driven by a promoter (P) upstream of
VHDJH (blue arrow). Production of downstream IgG, IgA or IgE with identical
antigen specificity but different effector function occurs through CSR. The
diagram shows the mechanism of IgA CSR, but a similar mechanism also
underlies IgG and IgE CSR. Appropriate stimuli induce germline transcription of
the Cα gene from the promoter (Pα) of an Iα exon (black arrow) through a switch
α (Sα) region located between Iα and Cα. In addition to yielding a sterile Iα-Cα
mRNA, germline transcription renders the Cα gene substrate for AID. By
generating and repairing DNA breaks at Sµ and Sα, the CSR machinery
rearranges the IgH locus, thereby yielding a reciprocal deletional DNA
recombination product known as Sα-Sµ switch circle. This episomal DNA
transcribes a chimeric Iα-Cµ mRNA under the influence of signals that activate
Pα. Postswitch transcription of the IgH locus generates mRNA for both secreted
and membrane IgA proteins. Cα1-3, exons encoding Cα chain of IgA: S, 3’
portion of Cα3 encoding the tail piece of secreted IgA; M, exon encoding the
transmembrane and cytoplasmatic portions of membrane-bound IgA; αs,
polyadenylation site for secreted IgA mRNA; αm, polyadenylation site for
membrane-bound IgA mRNA.
Page 16
2.1.2. SHM
SHM is another AID-dependent Ig diversification process that occurs in
the GC of secondary lymphoid follicles55. SHM introduces point
mutations in the complementarity determining regions of V(D)J genes,
which form the antigen-binding pocket of an Ig molecule56. These
mutations arise at a rate of 10−3/basepair/generation, which is several
orders of magnitude above the rate of spontaneous mutation, and provide
the structural correlate for the selection of high-affinity B cells by antigen.
SHM includes an initial phase that requires the mutagenic activity of
AID, followed by a second phase that involves the error-prone repair of
AID-induced mutations57. Point mutations preferentially target specific
hotspots, including the DGYW motif, where D stands for G, A or T
nucleotides, Y for C or T nucleotides, and W for A of T nucleotides.
Error-prone DNA repair is performed by members of a family of lowfidelity translesional DNA polymerases that recognize DNA lesions and
bypass them by inserting bases opposite to the lesion.
Amino acid replacements brought about by SHM increase the affinity
and fine specificity of an antibody, but do not usually modify the
framework regions, which regulate the structural architecture of the
antigen-binding V region of an Ig molecule. Similarly, SHM does not
induce amino acid replacements in the promoter and intronic enhancer,
which regulate the transcriptional activity of the Ig locus.
SHM can have different effects: 1) the antibody does not change its
affinity for antigen; 2) the antibody loses affinity for antigen; or 3) the
antibody increases its affinity for antigen. This latter outcome results in
affinity maturation, which permits a more effective targeting and
clearance of a pathogen58. Despite predominantly targeting rearranged
V(D)J genes, SHM can also physiologically occur in non-Ig genes such as
BCL6, which encodes a protein essential for the GC reaction59,
Page 17
60
. The
physiological relevance of this process remains unclear. Finally,
illegitimate SHM can target and dysregulate various proto-oncogenes,
including MYC, which is involved in the pathogenesis of GC-derived B
cell tumors together with BCL661.
2.2. Antibodies
CSR and SHM are followed by the generation of plasma cells specialized
in the secretion of antibodies. Each antibody molecule consists of two
smaller IgL chains (Igκ or Igλ) and two larger IgH chains held together by
both covalent and non-covalent bonds. The antigen-binding fraction (Fab)
of an antibody includes both VH and VL regions, whereas the
crystallyzable fraction (Fc) encompasses the CH region. This segment can
be expressed as a Cµ, Cδ, Cγ, Cα or Cε, which mediate specific effector
functions by binding to FcγR (I, IIA, IIB, III) FcαRI or FcεR (I, II) on
phagocytes and NK cells of the innate immune system.
All antibodies share certain biologic functions, including the ability to
neutralize and opsonize microbes and block toxins. Additional functions
such as complement-mediated destruction of microbial, infected or
neoplastic cells, antibody-dependent cell-mediated cytotoxicity (ADCC),
translocation across mucosal epithelial cells, and histamine-mediated
expulsion of parasites are more specific to certain antibody classes. In
humans, there are five antibody classes or isotypes, named IgM, IgD, IgG,
IgA, and IgE62. Each class is associated with specific effector functions
that are mainly determined by the CH region. IgG and IgA further include
IgG1, IgG2, IgG3 and IgG4 as well as IgA1 and IgA2 subclasses,
respectively.
IgM is expressed by pre-B, immature, transitional and mature naïve B
cells and serves as surface BCR63. IgM is also released as a soluble
pentameric protein by plasmablasts and plasma cells. The IgM pentamer
is stabilized by a plasma cell-derived polypeptide called joining (J) chain.
Page 18
In mucosal surfaces, the interaction of the J chain with a polymeric Ig
receptor (pIgR) expressed on the basolateral surface of epithelial cells
mediates transepithelial translocation of pentameric IgM onto the mucosal
surface. In general, IgM has a rather low affinity but high avidity for
antigen. The main effector functions of IgM are neutralization,
opsonization and complement fixation. In addition, IgM binds to an Fcµ/α
receptor expressed by B cells, macrophages and mesangial cells. This
receptor also binds IgA and promotes the uptake of IgM/IgA-bound
antigens.
IgD is expressed by transitional and mature naïve B cells together
with IgM and mainly functions as a surface BCR. After activation by
antigen, most B cells down-regulate the expression of IgD through a
transcriptionally regulated mechanism. However, a subset of B cells from
the upper respiratory tract undergoes class switching from IgM to IgD and
differentiates tino IgD-secreting plasmablasts, which enter the circulation,
and release monomeric IgD. This antibody binds to an unknown receptor
on various innate immune cells, including basophils64. The effector
functions of secreted IgD may include neutralization and opsonization, but
not complement activation.
IgG is expressed by memory B cells as a surface BCR after the
induction of class switching, but is also released by class-switched plasma
cells, representing the most abundant antibody isotype in our circulation65.
IgG is also abundant in mucosal secretions from the respiratory and
urogenital tracts. In general, IgG1 and IgG3 have more Fab flexibility,
complement-fixing activity, and affinity for FcγRs than IgG2 and IgG4.
FcγRs include FcγRI, FcγRII, and FcγRIII receptors that functionally link
B cells with phagocytes and other effector cells of the innate immune
system. These FcγRs enhance the clearance of opsonized microbes and
promote NK-cell–mediated ADCC of infected or tumoral cells66 67.
IgA is expressed by memory B cells as a surface BCR after induction
Page 19
of class switching, but is also released by class-switched plasma cells in
both circulation and mucosal secretions68,
69
. In humans, IgA includes
70
IgA1 and IgA2 subclasses . Mucosal IgA encompasses dimeric IgA1 and
IgA2 molecules held together by a J chain that interacts with pIgR
expressed on the basolateral surface of epithelial cells. This interaction
permits IgA to transcytose across epithelial cells to reach mucosal
secretions. Circulating IgA is composed mostly of monomeric IgA1,
which binds FcαRI and less characterized Fcα/µ, asialoglycoprotein and
transferrin receptors expressed on granulocytes, monocytes, macrophages,
DCs, Kuppfer’s cells and mesangial cells. Collectively, these IgA
receptors may enable IgA to generate a second line of systemic defense
against microbes that breach the mucosal barrier71, 72.
IgE is expressed by memory B cells as a surface BCR after the
induction of class switching, but is also released by class-switched plasma
cells in both circulation and mucosal secretions73. IgE triggers
inflammatory reactions to airborne, dietary or blood-born allergens after
binding to a high-affinity FceRI receptor expressed by mast cells,
eosinophils and basophils74,
75
. Cross-linking of cell-bound IgE by
allergens triggers the discharge of pre-formed or newly formed
inflammatory and antimicrobial mediators, including histamine76. In
addition to mediating allergic reactions, IgE interaction with FcεRI
provides immune protection against parasites and indeed increased serum
IgE levels correlate with the presence of worm infections77. IgE is also
produced under homeostatic conditions, possibly to enhance the survival
and optimize the protective function of mast cells, eosinophils, and
basophils that populate mucosal surfaces78. Consistent with this
possibility, binding of IgE to FcεRI is thought to deliver survival signals
to mucosal mast cells in the absence of antigen79. Binding of IgE by lowaffinity ligands may induce basophil and mast cell secretion of protective
cytokines without eliciting degranulation80. IgE further interacts with a
Page 20
low-affinity FcεRII, which modulates the activation of B cells and
mediates IgE translocation across mucosal epithelial cells81.
2.3. B cell activation
A critical step in the initiation of antibody production is the activation of
B cells by antigen. This process can occur in the following ways: 1) B
cells bind soluble antigen that penetrates lymphoid follicles82; 2) B cells
capture particulate antigen from DCs lodged in the paracortical area of
lymph nodes83; 3) B cells interact with antigen-containing immune
complexes on follicular dendritic cells (FDCs)84; 4) B cells capture
particulate antigen from subcapsular macrophages lining the subcapsular
sinus of lymph nodes or from MZ macrophages lining the marginal sinus
of the splenic MZ85.
In the spleen, MZ B cells can transport opsonized antigens to the
follicle by using both complement receptors85, 86 and BCRs87. B cells can
also encounter antigen outside secondary lymphoid organs, but
subsequently transport it to either lymph nodes or spleen 88. Regardless of
the modalities of antigen encounter, antigen-BCR interaction trigger
signaling cascades that cause B cell proliferation as well as processing of
internalized antigen into peptide-MHC-II complexes that are exposed on
the surface of B cells89.
Antigen-loaded B cells migrate to the border between the B cell
follicle and the T cell zone (T-B border), where they establish cognate
interactions with TFH cells90, 91. These professional B cell-helper CD4+ T
cells provide critical signals that optimize the activation of antigenengaged B cells. Upon B-T cell interaction, B cells may either clonally
expand and differentiate into short-lived IgM-secreting plasma cells
outside the follicle92,93 or enter the follicle to initiate the GC reaction. This
process involves clonal expansion of GC B cells, SHM, CSR from IgM to
IgG, IgA or IgE, and differentiation of high-affinity GC B cells into long-
Page 21
lived memory B cells or plasma cells.
2.3.1. TD antibody responses
The GC reaction is central to TD antibody responses against protein
antigens. Indeed, the microenvironment of the GC fosters antigen-driven
processes of positive and negative B cell selection that promote the
production of protective antibodies with high affinity for antigen. In
addition, B cell selection minimizes the production of potentially harmful
autoreactive antibodies with low affinity for self-antigens.
After receiving activation signals from the BCR, mature B cells
migrate to the T-B cell border94, where they present processed antigens to
TFH cells. The development of TFH cells involves poorly defined signals
from DCs and requires the expression of the transcriptional repressor Bcl6, which induces up-regulation of CXCR5 and down-regulation of CCR7
chemokine receptors95, 96. Stable interactions between TFH cells and B cells
promote their migration to the center of the follicle97, where TFH cells
activate B cells through a process involving CD40L. This TNF family
member promotes B cell proliferation, CSR, SHM and differentiation in
cooperation with cytokines such as IL-21, IL-4 and IFN-γ from TFH cells.
GC B cells include proliferating centroblasts located in the dark zone
of the GC and non-cycling centrocytes positioned in light zone of the GC.
This latter contains abundant FDCs that capture antigen-containing
immunocomplexes through CD21 and CD35 complement receptors as
well as FcγRII (or CD32). Together with TFH cells, antigen on FDCs is
critical to select B cells expressing high-affinity BCRs98 (Fig. 4).
According to recent models, GC B cells undergo clonal expansion and
SHM in the dark zone of the GC and then migrate to the light zone of the
GC to complete CSR and affinity maturation. In the light zone,
centrocytes expressing low-affinity BCRs die by apoptosis, whereas
centrocytes expressing high-affinity BCRs either re-enter the dark zone to
Page 22
undergo additional rounds of SHM or further differentiate into long-lived
circulating memory B cells or antibody-secreting plasma cells.
Figure 4. TD antibody response by follicular B cells. Follicular B cells capture
native antigen from subcapsular sinus macrophages and paracortical DCs through
the BCR (both IgM and IgD molecules) and subsequently establish a cognate
interaction with TFH cells located at the boundary between the follicle and the
extrafollicular area. After activation by TFH cells via CD40L and cytokines such
as IL-21, B cells enter either an extrafollicular pathway to become short-lived
IgM-secreting plasmablasts or a follicular pathway to become GC centroblasts.
GC cells in the dark zone (DZ) proliferate and activate the SHM machinery,
which includes AID. After one (or potentially more) cycles of division/mutation,
surviving centroblasts migrate toward the light zone. Centroblasts become
centrocytes and interact with antigen contained in immune complexes on the
surface of FDCs. Centrocytes with very low or no affinity for antigen undergo
apoptosis, whereas centrocytes with high affinity for antigen differentiate to longlived memory B cells or plasma cells.
Page 23
2.3.2. Plasma cell and memory B cell differentiation
The differentiation of GC B cells into antibody-secreting plasma cells
involves a complex network of transcriptional regulators that include Bcl6, Pax5 and B lymphocyte–induced maturation protein-1 (Blimp-1)99, 100.
Bcl-6 was initially identified in B cell lymphomas101 and is required for
the establishment and maintenance of the GC102,
103
, whereas Pax5 is
essential for the development and function of naïve, GC and memory B
cells. In addition to activating a number of genes required for the GC
reaction, Bcl-6 and Pax5 suppress the plasma cell–inducing transcription
factor Blimp-199.
Up-regulation of Blimp-1 by a subset of GC B cells initiates plasma
cell differentiation through a mechanism involving suppression of both
Bcl-6 and Pax5 expression104. In particular, Blimp-1 up-regulates the
expression of X-box–binding protein (XBP)-1 and IRF-4, two proteins
required for plasma cell differentiation100. Blimp-1-expressing plasma
cells emerging from the GC up-regulate the chemokine receptor CXCR4
and migrate to the bone marrow, which express the CXCR4 ligand
CXCL12. At this anatomical site, plasma cells establish long-lived
secretory memory with the help of survival signals from eosinophils and
stromal cells105.
Memory B cells are critical to mount quick secondary humoral
responses to recall antigens. In addition to entering the circulation,
memory B cells form IgG-expressing extrafollicular aggregates and IgMexpressing follicle-like structures in draining lymph nodes106, 107. After a
secondary exposure to antigen, IgG-expressing memory B cells rapidly
generate
antibody-secreting
plasmablasts,
whereas
IgM-expressing
memory B cells initiate a secondary GC reaction. These anamnestic
responses are characterized by rapid B cell activation, proliferation and
differentiation and by massive secretion of high-affinity antibodies108. The
Page 24
signals involved in the long-term survival of memory B cells remain
unclear, but some studies point to an important role of non-antigenspecific signals provided by TLR ligands109.
2.3.3. TI antibody responses
TD antibody responses to protein antigens require 5 to 7 days, which is
too much of a delay to control fast-replicating pathogens. To compensate
for this limitation, invariant natural killer T cells (iNKT) generate earlier
waves of IgM and IgG responses to glycolipid antigens by interacting with
follicular B cells through a TD pathway that resembles that orchestrated
by TFH cells110. This pathway does not usually generate immunological
memory and high-affinity antibodies. Additional early antibody-inducing
pathways involve the activation of extrafollicular B cells by macrophages,
DCs, innate lymphoid cells (ILCs) and neutrophils without any help from
T cells and iNKT cells. These TI antibody responses typically generate
IgM as well as IgG and IgA to carbohydrates and lipids111-113 93, 114, 115 and
involve B-1 and MZ B cells that neither undergo affinity maturation nor
generate immunological memory111, 112.
B-1 cells constitute a distinct lineage of self-renewing B cells that
occupy serosal cavities, spleen and intestine112. In mice, B-1 cells generate
“natural” (or pre-immune) immunity by spontaneously releasing
polyspecific and largely unmutated IgM but also class-switched IgA and
IgG3 that provide a first line of defense against infections. Recent work
has identified B-1 cells in the circulation of humans116, but further studies
are needed to define the frequency and function of these cells. Similar to
B-1 cells, MZ B cells express polyspecific and largely unmutated
antibodies that recognize TI antigens with low affinity, at least in mice114.
In humans, MZ B cells can also produce monospecific and mutated
,
antibodies that recognize TI antigens with high affinity117 111.
TI antigens can be divided in two distinct categories. TI-1 antigens
Page 25
include highly conserved microbial structures such as LPS and CpG DNA,
which activate B cells by engaging TLRs only or TLRs and BCRs118. In
contrast, TI-2 antigens include repetitive structures such as capsular
polysaccharides, which activate B cells by engaging BCRs with or without
help from CLRs and possibly other poorly understood PRRs. In general,
TI-2 antigens are large molecules with periodic epitopes that favors the
cross-linking of multiple BCRs, but cannot be uploaded onto MHC-II
molecules119. Irrespective of their mechanism, TI-1 and TI-2 antigens
rapidly induce the differentiation of B-1, MZ and some B-2 cells into
short-lived plasma cells that secrete low-affinity antibodies. This TI
response bridges the temporal gap required for the induction of highaffinity antibodies by follicular B cells.
In addition to presenting TI antigens to MZ and B-1 cells,
macrophages, monocytes, DCs and neutrophils release CD40L-related B
cell-helper cytokines such as B cell-activating factor of the TNF family
(BAFF) and its homologue a proliferation-inducing ligand (APRIL).
These TNF family members also originate from mucosal epithelial cells,
mucosal and splenic stromal cells as well as splenic sinus-lining cells. In
addition to providing B cell and plasma cell survival signals, BAFF and
APRIL deliver CSR-inducing and antibody-inducing signals. Of note,
BAFF and APRIL bind TACI (transmembrane activator and caliummodulating cyclophilin ligand interactor), which extensively cooperates
with BCR ligands, TLR ligands, conventional cytokines (IL-6, IL-10, IL21, TGF-β) and chemokines (CXCL10) to rapidly induce extrafollicular
plasma cell differentiation and antibody production (Fig. 5).
Despite being specialized in TI antibody responses, MZ B cells can
also participate in TD antibody responses owing to their ability to capture
antigen and shuttle from the MZ to the follicle. At this site, MZ B cells
can either deposit antigen on FDCs or present immunogenic peptides to
TFH cells120,
121
. This functional flexibility may explain why MZ B cells
Page 26
have heterogeneous features in humans, including production of
hypermutated antibodies.
Figure 5. TI antibody response by MZ B cells. Tl antigens are thought to enter
the human marginal zone (MZ) through capillaries emanating from the centrale
arteriole and draining into the perifollicular zone. Antigen capture may involve B
cell-helper neutrophils (NBH cells), macrophages, sinus-lining cells and DCs. In
addition to making TI antigens available to MZ B cells as BCR and TLR ligands,
antigen-capturing cells of the innate immune system release BAFF and APRIL,
which engage the receptor TACI on MZ B cells. The generation of plasmablasts
secreting IgM or class switched IgG and IgA involves the production of IL-6, IL10, IL-21 and chemokines such as CXCL10 by antigen-capturing cells. PALS:
periarteriolar sheath containing T cells.
Page 27
2.4. MZ B cell responses
MZ B cells are innate-like lymphocytes strategically located at the
interface between the immune system and the circulation122. In mice, the
marginal sinus receives capillaries from the central arteriole and uses
fenestrated spaces to directly drain arterial blood into the MZ. In humans,
there is no marginal sinus, but the perifollicular zone may represent its
functional equivalent. Indeed, the perifollicular zone consists of an open
circulatory system of blood-filled spaces that directly communicate with
capillaries from the central arteriole and sinusoidal vessels from the red
pulp123, 124 (Fig. 6).
Given their unique position and functional features, MZ B cells are
poised to rapidly and effectively respond to any commensal, postapoptotic or pathogenic antigen present in the general circulation. In
particular, MZ B cells mount rapid antibody responses against
encapsulated bacteria. Consistent with this function, splenectomy results
in increased susceptibility to invasive infections with encapsulated
bacteria such as Streptococcus pneumoniae, Neisseria meningitides, or
Hemophilus influenzae125, 126. These infections are also more frequent in
the first two-five years of life due to an anatomical and functional
immaturity of the MZ127, 128.
There appear to be two major factors that drive the development of
MZ B cells. The first factor is the intensity of signals from the BCR,
which determine whether a transitional T2-MZ precursor differentiates
into either a follicular or a MZ B cell. The second factor is the expression
of NOTCH2, which delivers MZ differentiation signals to T2-MZ
precursor cells engaged by Delta-like 1 (DLL1)129,
130
. Of note, signals
from TLRs may also contribute to the development of MZ B cells and
indeed patients with defective TLR signaling have reduced numbers of
MZ B cells131.
In humans, MZ-like B cells are located in the inner wall of the
Page 28
subcapsular sinus of lymph nodes, in the epithelium of tonsillar crypts and
in the subepithelial area of mucosa-associated lymphoid tissues, including
the subepithelial dome of intestinal Peyer’s patches117,
132-134
. These
MZ-equivalent areas are poorly understood, but may provide alternative
functional niches for MZ B cells. This could explain why splenectomized
individuals recover TI antibody responses against encapsulated bacteria a
few years after splenectomy111. In humans, MZ-like B cells are also
present in the peripheral blood, which may explain how can newly formed
MZ B cells reach multiple extrafollicular sites52.
Although primarily defined by their anatomical localization, MZ B
cells are also characterized by a unique surface phenotype that includes
large amounts of IgM, small amounts of IgD, expression of MHC-like
molecules such as CD1c and CD1d, and large amounts of the complement
receptor CD21 and CD35. In addition, MZ B cells express large amounts
of non-clonally distributed and germline-encoded TLRs, which cooperate
with BCRs and complement receptors to rapidly mount antibody
responses against TI antigens124. From a functional standpoint, MZ B cells
are characterized by a pre-activation state and respond more rapidly and
efficiently to antigen and polyclonal mitogens than follicular B cells.
Regarding BCRs, these molecules are encoded by moderately mutated
V(D)J genes in human but not mouse MZ B cells.
In mice, MZ B cells acquire large TI antigens from metallophilic
macrophages strategically positioned along the marginal sinus or MZ
macrophages
scattered
throughout
the
MZ.
These
professional
macrophages capture antigens through various PRRs of the scavenger
receptor and CLR families. Particulate TI antigens are also conveyed to
mouse MZ B cells by circulating DCs that weakly express CD11c and
therefore may correspond to pDCs. In humans, DCs and perhaps
neutrophils and sinus-lining cells may compensate for the lack of specific
macrophages in the MZ113, 117.
Page 29
After interacting with antigen, MZ B cells rapidly differentiate into
plasmablasts that produce large amounts of IgM117, 135, 136. In addition, MZ
B cells produce IgG and some IgA via CSR117, 93. In humans, MZ B cells
also undergo SHM111, which contribute along CSR to MZ B cell responses
to pathogens and commensal antigens. Remarkably, a fraction of mouse
and human MZ B cells produce class-switched antibodies under steadystate conditions, possibly in response to TI antigens that could come from
mucosal surfaces, including the intestine 117, 137, 138. In humans, this process
is associated with the induction of CSR by a unique subset of neutrophils
that form extracellular trap (NET)-like structures117. By capturing
antigens, NETs may provide BCR and TLR ligands to MZ B cells117.
NETs may further stimulate MZ B cells by delivering endogenous TLR
ligands, including CpG DNA139,
140,117
. Another subset of splenic innate
immune cells, ILCs, helps the survival and activation of neutrophils by
releasing granulocyte macrophage colony-stimulating factor (GM-CSF).
ILCs also deliver autonomous activation signals to both MZ B cells and
plasma cells via BAFF, APRIL, CD40L (in humans) and DLL1141.
In addition to TLRs, MZ B cells strongly express TACI, a receptor
that binds both BAFF and APRIL. Of note, TACI requires signals from
microbial TLR ligands for its high expression and thus functionally
cooperates with TLRs to induce CSR and antibody production in MZ B
cells. In general, currently available data indicate that MZ B cells initiate
rapid antibody responses to TI antigens by integrating adaptive signals
from BCR ligands with innate signals from TLR ligands and TNF-related
cytokines, including BAFF, APRIL and CD40L. This latter may play a
crucial role when MZ B cells respond to TD antigens.
The composition of the immunizing antigen is likely crucial in
determining whether MZ B cells enter TI or TD pathway of
differentiation142. In general, blood-borne bacteria express TI antigens
such as TLR ligands and conventional polysaccharides as well as TD
Page 30
antigens
such
polysaccharides
as
outer-membrane
143, 50, 144, 145
proteins
and
zwitterionic
. The latter are processed into peptides and
low-molecular-weight carbohydrates, respectively, and both are presented
to CD4+ T cells through the MHC-II endocytic pathway146,
147
. In this
regard, MZ B cells express more MHC-II, CD80 (B7.1) and CD86 (B7.2)
molecules than follicular B cells and thus display a more robust APC
activity148.
Figure 6. Structure of the spleen. A: Diagram of the spleen with trabeculae that
form lobular compartments after emanating from a fibrous capsule. The splenic
artery branches into arterioles that terminate in the red pulp. The white pulp
includes lymphoid structures called periarteriolar lymphoid sheath (PALS), which
are composed of T cells organized around a central arteriole. The white pulp also
includes primary follicles with no germinal center and secondary follicles with a
germinal center. Each follicle is surrounded by a large MZ that is in direct contact
with the open circulation of the red pulp. Sinusoidal vessels drain blood from the
red pulp into the venous system. B: Light micrographs of spleen sections stained
with hematoxylin and eosin. The red pulp (RP) is filled with erythrocytes from
circulating blood, whereas the white pulp contains numerous lymphoid follicles
with or without a germinal center (GC), each surrounded by the MZ. This area
contains constitutively activated B cells that are larger than the small naïve B
cells lodged in the follicular mantle. Therefore, the MZ stains paler than the
follicular mantle. Original magnification, ×2 (left image) and ×20 (right image).
Page 31
3. BAFF and APRIL in B cell responses
MZ B cells are highly responsive to BAFF (also known as BLyS) and
APRIL (also known as TALL-1), two CD40L-like proteins belonging to
the TNF family. Full-length transmembrane BAFF and APRIL yield
shorter soluble isoforms after undergoing proteolytical processing by
furin-like convertases149. In the presence of IgG-containing immune
complexes, myeloid cells increase the enzymatic processing of
transmembrane BAFF through a process involving activation signals from
FcγRI150. The resulting soluble BAFF adopts either a trimeric
conformation, which predominantly stimulates B cell survival, or further
assembles into a capsid-like sixtymeric structure, which additionally
stimulates CSR, plasma cell differentiation and antibody production151. Of
note, heteromers composed of both BAFF and APRIL have also been
described149.
BAFF and APRIL share two receptors on B cells known as TACI and
B-cell maturation antigen (BCMA)152. BAFF binds TACI with higher
affinity than BCMA, whereas APRIL binds BCMA with higher affinity
than TACI149. In addition to sharing TACI and BCMA with APRIL,
BAFF has private receptor known as BAFF receptor (BAFF-R), also
known as BR3153. APRIL also has a private receptor expressed on both B
cells and non-B cells. This receptor has been identified as heparan-sulfate
proteoglycans (HSPGs), which bind basic amino acid residues on APRIL
through sulfated glycosaminoglycan side chains154.
BAFF and APRIL mainly originate from epithelial cells, stromal cells
and cells of the innate immune system, including neutrophils,
macrophages, monocytes, DCs and FDCs152. These cells increase BAFF
and APRIL expression in response to IFN-α, IFN-γ, IL-10, granulocyte
colony-stimulating factor (G-CSF) and/or TLR ligands152,155. The
receptors for BAFF and APRIL are mainly expressed by B cells and
Page 32
plasma cells156. While BAFF-R is widely expressed by all B cells except
plasma cells156, TACI is mostly expressed by MZ and memory B cells and
by some plasma cells156, 157. Plasma cells also express BCMA along with
HSPGs, particularly in the bone marrow154,156.
Studies in BAFF–/– and BAFF-R–/– mice show that BAFF is essential
for the survival of follicular and MZ B cells and for the maturation of
newly formed T1 cells into transitional T2 cells152. However, B-1 and
memory B cells do not require survival signals from BAFF152, 158, 159. In
contrast, APRIL–/– mice show a conserved B cell maturation149, but
impaired IgA production, particularly in the gut. Consistent with this
finding, APRIL promotes IgA CSR and production as well as survival of
IgA-secreting plasma cells.
The important role of BAFF and APRIL in CSR and antibody
production is further indicated by the phenotype of TACI–/– mice, which
show impaired IgM, IgG3 and IgA responses by MZ and B-1 cells to TI
antigens. Of note, TACI also regulates the lifespan of MZ B cell-derived
plasma cells by up-regulating the expression of the death-inducing
molecule FasL and that of its cognate receptor Fas on MZ B cells. This
negative regulatory function may explain why TACI–/– mice progressively
accumulate B cells as they age. Finally, BCMA–/– mice fail to generate
long-lived bone marrow plasma cells after immunization with TD
antigens. It remains unclear whether BCMA also plays a role in the
survival of plasmablasts emerging from TI responses.
3.1. BAFF and APRIL signaling in B cells
Similar to other TNF receptor (TNFR) family members, BCMA, TACI
and BAFF-R have cytoplasmic domains with no intrinsic enzymatic
activity and thus need to recruit various adaptor molecules to initiate
ligation-dependent signaling events. TNFR-associated factors (TRAFs)
are intracellular proteins that bind TRAF-binding sequences associated
Page 33
with TNFR family members. In the steady state, TRAFs have low affinity
for their cognate binding sequences on TNFRs. When these receptors
undergo trimerization in response to a cognate ligand, TRAF complexes
bind to TNFRs with higher affinity, thereby initiating a signaling cascade
usually centered on the activation of the transcription factor NF-κB.
Engagement of BAFF-R by BAFF elicits the recruitment of TRAF3,
which is followed by the degradation of TRAF3 through a mechanism
involving TRAF2, cellular inhibitor of apoptosis protein (c-IAP), and
MALT1160, 161. TRAF3 degradation causes activation of the enzyme NFκB-inducing kinase (NIK), which initiates an alternative NF-κB pathway
involving IKKα-dependent processing of the p100 subunit of NF-κB into
p52. Together with RelB, p52 up-regulates the expression of intracellular
anti-apoptotic proteins such as Bcl-2, Bcl-xL and Mcl-1162 (Fig. 7).
BAFF-R also triggers down-regulation of intracellular pro-apoptotic
proteins such as Bax, Bid and Bad, thereby supporting the survival of
mature B cells, including follicular and MZ B cells.
Page 34
Figure 7. Signaling pathways emerging from TACI and BAFF-R.
Engagement of BAFF-R by BAFF is followed by the recruitment of TRAF2 and
TRAF3. After degradation of TRAF3, NIK becomes activated and initiates an
alternative NF-κB pathway involving IKKα-dependent processing of the p100
subunit of into p52. Together with RelB, p52 transactivates various pro-survival
factors of the Bcl2 family. Engagement of TACI by BAFF or APRIL induces
recruitment of TRAF2, TRAF5 and TRAF6, which activate an IKK complex
formed by IKKα, IKKβ and IKKγ (also known as NEMO). TACI also recruits
MyD88, which further activates IKK by triggering a pathway involving IRAK-1,
IRAK-4, TRAF6 and the TAK1-TAB1-TAB2 complex. By facilitating
proteasome-dependent degradation of the NF-κB inhibitor IκBα, IKK induces
nuclear translocation of p50 and p65 subunits of NF-κB, which initiate CSR and
antibody production by transactivating germline CH genes and the gene encoding
AID.
Page 35
Engagement of BCMA by BAFF or APRIL leads to the recruitment of
TRAF1, TRAF2 and TRAF3 and possibly TRAF5 and TRAF6. The
resulting signaling complex leads to the activation of a classical NF-κB
pathway that requires an IκB-inducing kinase (IKK) complex formed by
IKKα, IKKβ and IKKγ (also known as NEMO). By facilitating
proteasome-dependent degradation of the NF-κB inhibitor IκBα, IKK
induces nuclear translocation of p50 and p65 subunits of NF-κB. These
transcription factors may facilitate the expression of pro-survival genes in
plasma cells lodged in the bone marrow and possibly plasmablasts
originating from memory B cells.
Engagement of TACI by BAFF or APRIL causes the interaction of
TACI with TRAF2, TRAF5 and TRAF6, which leads to the activation of
the classical NF-κB pathway. Of note, optimal TACI signaling requires
the recruitment of at least two TRAF trimers to six TACI cytoplasmic
tails. In addition to recruiting TRAFs, TACI interacts with MyD88, an
adaptor protein that usually interacts with the TIR domain of TLRs (Fig.
8). Similar to TLRs, TACI causes activation of IL-1 receptor-associated
kinase 1 (IRAK1) and IRAK4 downstream of MyD88, which form a
complex with TRAF6. This TRAF6-containing signaling complex
functions as an E3 ligase that activates transforming growth factor-βactivated kinase-1 (TAK1) after inducing TRAF6 polyubiquitination. By
forming an active IKK kinase complex with TAB1 and TAB2, TAK1
triggers activation of IKK and nuclear translocation of NF-κB.
Canonical NF-κB signals from TACI mostly induce B cell activation,
including CSR, plasma cell differentiation and antibody production. Of
note, TACI enhances these effects by cooperating with TLRs through a
shared MyD88 pathway. This cooperation further entails the interaction of
TACI with cleaved signaling-competent forms of TLRs (namely TLR7
and TLR9) along with the ability of TLRs to up-regulate BAFF and
Page 36
APRIL release from myeloid cells as well as TACI expression on B cells.
Ultimately, cooperative TACI and TLR signals converge on the classical
NF-κB pathway, which is required to induce germline CH gene
transcription,
AID
expression,
CSR
and
antibody
production.
Accordingly, B cells lacking MyD88 or IRAK-4 are hyporesponsive to
TACI ligation65.
Figure 8. Structure of TACI protein. TACI includes an extracellular domain
(ED) that contains two tandemly arrayed CRD1 and CRD2 cysteine-rich domains
involved in the binding of BAFF or APRIL. A transmembrane domain (TD) is
followed by cytoplasmic domain (CD) that contains binding sites for the adaptor
proteins CAML (an NF-AT inducer with unknown function in B cells), TRAFs
and MyD88.
In addition to cross-talking with TLRs, TACI cooperates with the BCR
pathway, which regulates the negative selection of autoreactive B cells in
the bone marrow. This may explain why immunodeficient patients with
deleterious TACI substitutions develop a primary antibody deficiency
along with autoimmunity due to impaired removal of autoreactive B
cells163.
4. BAFF and mTOR
In addition to enhancing B cell survival, engagement of BAFF-R by
BAFF promotes glycolysis, protein synthesis and growth through a
pathway involving mammalian target of rapamycin (mTOR)164,
165
. This
protein is a broadly expressed serine/threonine kinase that was first
identified during a screening of yeast mutants capable of growing in the
presence of the immunosuppressive agent rapamycin166,167,
Page 37
168
. mTOR
integrates environmental cues to optimize cell metabolism, cell growth
and survival169,170,171.
4.1. Composition of mTOR-containing complexes
There are two distinct mTOR complexes termed mTORC1 and
mTORC2172 (Fig. 9). mTORC1 includes mTOR (RAPTOR regulatory
associated protein of mTOR), DEPTOR (DEP domain containing mTORinteracting protein), Rheb (a small GTPase) mLST8 (mammalian lethal
with sec-13 protein 8, also known as GβL), PRAS40 (proline-rich Akt
substrate 40 kDa), and the Tti1/Tel2 complex. In mTORC1, RAPTOR
serves as a scaffolding protein essential for TORC1 signaling. The
downstream substrates of TORC1 are not completely understood, but
include S6K1 (ribosomal S6 kinase) and 4E-BP1, a repressor of protein
translation. mTORC2 is comprised of mTOR, RICTOR (rapamycininsensitive companion of TOR), DECTOR, PROTOR1/2 (protein
observed with RICTOR1/2), mLST8, mSin1 (mammalian stress-activated
map kinase-interacting protein 1), and the Tti1/Tel2 complex172,173. In
mTORC2, RICTOR serves as a scaffolding protein essential for TORC2
signaling. mTORC2 directly activates Akt by phosphorylating a
hydrophobic motif corresponding to the serine 473 residue174, 175,176. Akt
is a kinase positioned both upstream and downstream of the mTOR
pathway.
Page 38
Figure 9. Structure of mTOR. mTOR contains an amino-terminal cluster of
HEAT (huntingtin, elongation factor 3, a subunit of protein phosphatase 2A and
TOR1) repeats required for mTOR binding to RAPTOR. In addition, mTOR
contains a FAT (FRAP, ATM and TRRAP) domain that binds the regulatory
protein DEPTOR, a FKBP12-rapamycin binding (FRB) domain that binds
rapamycin, a kinase domain, and a carboxy-terminal FATC domain.
4.2. Biology of mTORC1 and mTORC2
mTORC1 integrates signals generated by growth factors, energy stress,
oxygen levels and amino acid intake to regulate many processes required
for cell growth. One of the most important sensors involved in the
regulation of mTORC1 is the tuberous sclerosis complex (TSC), which
includes TSC1 (also known as hamartin) and TSC2 (also known as
tuberin) (Fig. 10). Activation of Akt by phosphatidylinositol 3-kinase
(PI3K) via phosphorylation at threonine 308 facilitates mTOR activation
by inhibiting the TSC1-TSC2 complex177. In contrast, activation of TSC2
by the kinase AMPK causes suppression of mTOR during energy
stress
178
. Of note, the carboxy-terminus of TSC2 contains a conserved
GTPase-activating protein (GAP) domain that acts on the small GTPase
Rheb179. When the TSC1-TSC2 complex is activated, Rheb becomes
inactive and mTOR signaling is inhibited. In this manner, growth factors
Page 39
block TSC1–TSC2 activity and activate mTORC1, whereas genotoxic
stress, energy deficit, and oxygen deprivation promote TSC1–TSC2
activation and inhibit mTORC1.
mTORC2 is activated by growth factors through a mechanism that is
not well understood. The early lethality of mice lacking essential
components of mTORC2 as well as the absence of specific mTORC2
inhibitors have limited the study of this protein complex. However,
various genetic approaches have demonstrated that mTORC2 plays
important
roles
in
cell
cytoskeleton organization
survival,
180-182
metabolism,
proliferation
and
. Importantly, compared to mTORC1,
mTORC2 shows little or no sensitivity to the inhibitory activity of
rapamycin183,184. This agent binds to FK506-binding protein (FKBP12)185
and the resulting complex interacts with mTOR167. In mTORC1,
rapamycin-FKBP12-mTOR interaction inhibits the kinase activity of
mTOR by preventing its binding to RAPTOR186.
Page 40
Figure 10. Signals emanating from TORC1. The TORC1 pathway integrates
signals from growth factors, stress, energy status, oxygen and aminoacid supply
to control protein and lipid synthesis. Active GTP-Rheb directly interacts with
TORC1 and strongly stimulates its kinase activity. TSC1 and TSC2 form a
complex that inhibits TORC1 by activating a Rheb GTPase that converts active
GTP-Rheb into inactive GDP-Rheb. Of note, the TSC1-TSC2 complex transmits
many of the upstream signals that impinge on TORC1 function, including signals
from PI3K and Akt. Phosphorylation by Akt inhibits TSC1-TSC2, thereby
causing activation of mTOR, followed by phosphorylation of 4E-BP1 and S6K,
which promote protein synthesis.
4.3. Downstream targets of mTOR
There are two well-characterized downstream targets of mTOR: p70S6K
and 4E-BP1 (eukaryotic initiation factor-4E binding protein 1). The kinase
Page 41
activity of p70S6K is strongly enhanced by growth factors such as
insulin187 and nutrients such as amino acids. p70S6K requires pyruvate
dehydrogenase kinase 1 (PDK1) for its activation in addition to Akt and
mTOR188. Activated p70S6K phosphorylates several targets crucial for
protein translation and RNA splicing, including CBP80 (40S ribosomal S6
protein and cap-binding complex 80)189. Of note, eukaryotic initiation
factor 3 (eIF3) from the pre-initiation complex functions as a scaffold
protein for the dynamic interaction of p70S6K with its substrates IF4B
and S6, a 40S ribosomal protein190. Indeed, p70S6K binds to eIF3 under
basal conditions, but dissociates from eIF3 following the recruitment of
mTOR-RAPTOR as induced by the activation of mTORC1. This
dissociation permits p70S6K to phosphorylate its downstream substrates.
4.4. mTOR in BAFF signaling
BAFF activates TORC1 through a BAFF-R-dependent pathway involving
the initial activation of Akt by PDK1 and PKCβ, followed by the
activation of PI3K by Akt. The resulting phosphorylation of S6K1 and
4E-BP1 increases both mRNA translation rate and protein synthesis.
BAFF-R further induces 4E-BP1 via PIM2, a kinase associated with the
alternative NF-κB pathway. Together with Mcl-1, a pro-survival protein
induced by the alternative NF-κB pathway, the mTOR-PIM2 axis
promotes the survival, growth and metabolic fitness of B cells exposed to
BAFF.
The profound impact of mTOR on BAFF signaling is consistent with
growing evidence that mTOR regulates not only metabolism and growth,
but also immunity, including T cell and B cell responses191-194.
Accordingly, rapamycin is widely used as an immunosuppressive drug to
prevent allograft rejection and is also being evaluated for clinical use in
the treatment of a variety of other immune-mediated diseases.
Page 42
Nevertheless, whether and how rapamycin regulates B cell responses
remains poorly understood.
Recent data indicate that mTOR enhances the release of IFN-α from
pDCs by up-regulating TLR signaling via MyD88195. In particular,
inhibition of mTOR by rapamycin blocks the interaction of TLR9 (a
receptor for microbial CpG DNA) with MyD88 and thereby inhibits the
activation of interferon regulatory factor 7 (IRF7), a transcription factor
required for the induction of IFN-α195. Consistent with this, targeting
pDCs with rapamycin-containing microparticles diminishes IFN-α
production in response to CpG DNA or yellow fever virus195. Similar to
TLRs, TACI uses MyD88 to activate B cells. Thus, it is conceivable that
mTOR regulates B cell responses to both BAFF and APRIL in addition to
pDC responses to CpG DNA.
4.5. mTOR in antibody responses
In addition to promoting metabolic fitness in B cells exposed to BAFF,
mTOR facilitates the proliferation and plasma cell differentiation of B
cells exposed to BCR or TLR agonists. Recently, two mouse models with
altered mTOR activity have been used to study the role of mTOR in
antibody production196. In mice expressing a hypomorphic mTOR, B cells
have impaired mTOR signaling and show reduced post-immune antibody
production due to decreased plasma cell differentiation. In mice with B
cell-conditional deletion of TSC-1, B cells have enhanced mTOR
signaling, but show decreased plasma cell differentiation and impaired
post-immune antibody production197. The reason behind the discrepant
behavior of these two mouse models remains unclear, but could relate to
different alterations of B cell development.
Additional studies show that administration of rapamycin during
primary infection with influenza virus subtype H3N2 enhances protection
against a lethal secondary infection with H5N1, H7N9 or H1N1.
Page 43
Rapamycin
treatment
decreases
the
dominant
IgG
response
to
hemagglutinin (HA) from the primary immunizing strain, but enhances
the formation of IgM and IgG antibodies to more conserved epitopes
shared by heterosubtypic viruses. These data suggest that rapamycin
enhances protection against a lethal heterosubtypic infection by changing
the isotype profile and reactivity of the antibody repertoire induced by the
primary viral strain198.
Finally, some evidence indicates that distinct B cell subsets are
differentially controlled by mTOR. For example, MZ B cells maintain
high levels of mTOR activity in response to nutrients in the absence of
mitogens. Conversely, follicular B cells display lower basal levels of
mTOR activity and are less sensitive to inhibition by rapamycin199. In
summary, these findings show that mTOR plays an important role in
antibody production, but also emphasize that more studies are needed to
elucidate the mechanism by which mTOR regulates CSR, plasma cell
differentiation and antibody production in B cells responding to TD or TI
antigens.
Page 44
CHAPTER 2
AIMS
Page 45
Page 46
Aims
This project has been developed to elucidate the mechanism by which the
TACI receptor activates CSR and antibody production in human splenic
MZ B cells. The main objectives of this study were:
AIM 1: To determine the molecular requirements underlying the
recruitment of mTOR to the cytoplasmic domain of TACI in MZ B cells
AIM 2: To elucidate the mechanism by which mTOR enhances TACI
signaling through the transcription factor NF-κB in MZ B cells
AIM 3: To dissect the involvement of mTOR in the induction of CSR and
antibody production in MZ B cells activated through TACI
Page 47
Page 48
CHAPTER 3
MATERIALS AND METHODS
Page 49
Page 50
MATERIALS AND METHODS
Cells
Human B cells were isolated from buffy coats purchased from the Banc de
Sang and Teixit of Barcelona or from histologically normal spleens from
deceased organ donors or splenectomized trauma patients without clinical
signs of infection or inflammation. The use of blood and tissues was
approved by the Ethical Committee for clinical investigation of Institut
Hospital del Mar d'Investigacions Mèdiques (CEIC-IMIM 2011/4494/I).
Tissue samples were collected by the department of pathology of Hospital
del Mar. Prior to collection, signed informed consent was obtained from
the patient or his/her parent or guardians. All the blood and tissue samples
were coded and relevant clinical information remained anonymous.
PBMCs (peripheral blood mononuclear cells) or SMCs (splenic
mononuclear cells) were isolated by ficoll technique.
IgD+ B cells were obtained by magnetic separation as specified by the
manufacturer (Miltenyi Biotech). Briefly, PBMCs or SMCs were
resuspended in an appropriate amount 1(07 cells/ 50 µL) of PBS + 2%
FBS (fetal bovine serum). FcR blocking reagent (107 cells / 20 µL) were
added to the cells. The PBMCs were labeled (107 cell/ 5 µg) with a
biotinylated monoclonal antibody to IgD (Southern biotechnology) for 10
min at 4 oC. After washing with PBS, the cells were incubated for 15 min
at 4 oC with anti-biotin MicroBeads (20 µL per 107 cells). The cells were
washed again, resuspended (up to 108 cells in 500 µL) in MACS buffer
(PBS 0,5% FBS 2mM EDTA) and applied onto the column. The column
was washed for three times with 3mL of MACS buffer. Finally, the
column was removed from the separator and the cells were collected by
pipetting 5mL of MACS buffer onto the column and flushing out the
magnetically labeled cells by firmly pushing the punger into the column.
51
1
2
MZ and follicular B cells were obtained by FACSorting. Cells were
stained with specific antibody cocktail (CD19-PECy7, CD27-PE, IgDFITC) and discrete subsets purified with a FACSAria III BSL2 cell sorter
(Becton Dickinson) after exclusion of dead cells through 4',6-diamidin-2fenilindolo (DAPI) staining. The purity of sorted cells was consistently
above 98%. Cells were sorted using the following gating strategy:
Singlet SMCs
Live SMCs
FSC-H
SSC-A
DAPI
Total SMCs
FSC-A
Total B cells
FSC-A
FSC-A
MZ (1) and Fo (2) B cells
CD19-PECy7
CD27-PE
Surface Markers
MZ B cell (1)
1
CD19+ IgD lowCD27+
Fo B cells (2)
2
FSC-A
CD19+ IgD+ CD27-
IgD-FITC
Cultures and reagents
Peripheral and splenic IgD+ B cells, MZ and Fo sorted B cells were
cultured in RPMI 1640 medium supplemented with 10% FBS.
2E2 B cells line were cultured in RPMI 1640 medium supplemented with
5% FBS. 293T cells were cultured in DMEM supplemented with 10%
FBS until reaching 70-80% confluence.
Page 52
The cells were seeded in multiwell plates and were maintained under
standard culture conditions (21% O2, 5% CO2, 95% humidity).
MZ, Fo and IgD+ B cells were incubated with 500 ng/ml APRIL
MegaLigand (Alexis), 0,1 ug/mL CpG (invitrogen). 10 nM of Rapamycin
or Torin 1 (Cell Signaling) or 25 µM Ly2940002 (Calbiochem) were
added 30 min before of the treatments.
Flow cytometry
Cells were first incubated with an Fc-blocking reagent (Miltenyi Biotech)
and then stained with specific antibody cocktail (CD19-PECy7, CD27PercPCy5.5, IgD-FITC, TACI-PE). DAPI was used to exclude dead cells
from the analysis as indicated by the manufacturer (BD Pharmingen). All
gates and quadrants were drawn to give ≤ 1% total positive cells in the
sample stained with control Abs. Cells were acquired using a BD
LSRFortessa Cell Analyzer (BD Biosciences) and data were analyzed
with the FlowJo software (Tree Star).
Viability and proliferation assays
Cell survival was measured using the Annexin-V Apoptosis Detection Kit
II (BD Pharmingen). Gates and quadrants were drawn to give ≤ 1% total
positive cells in samples incubated with isotype control mAbs. Cell
proliferation was assessed by CFSE ((5-(and-6)-Carboxyfluorescein
Diacetate, Succinimidyl Ester) staining using the CellTrace CFSE Cell
Proliferation Kit (Invitrogen).
Enzyme linked immunosorbent assays
In order to measure the level of Igs (IgM, IgG and IgA), enzyme linked
immunosorbent
assays
(ELISAs)
were
perfomed.
Plates
were
coatedovernight at 4°C with unlabeled goat anti human IgA, IgG and IgA
(Southern Biotechnology, 1µg/mL in coating buffer). After washing the
Page 53
plates with PBS, the wells were filled with 200 µL of blocking solution
(PBS 1% BSA) for 2 h at room temperature. After two washing with PBS,
50 µL of properly diluted (dilution buffer, PBS 1% BSA 0,05% Tween)
supernatant from B cell culture were added. Plates were incubated O/N at
4 oC. After washing for five times with 0,05% Tween in PBS 50 µL of the
labeled secondary antibody were added. In the detail, 0,2 µg/mL goat antihuman IgM-HRP, 0,4 µg/mL goat anti- human IgG-HRP and 0,25 µg/mL
goat anti human IgA-HRP were added. Plates were incubated for 2 h at
room temperature in a humid atmosphere. After washing the plates with
PBS 0,05% Tween, the substrate (TMB) was added as indicated by
manufacturer (BD bioscience). The reaction was blocked by adding stop
solution (H2SO4) and optical density at 450 nm was measured with an
ELISA plate reader.
Immunofluorescence
Sorted MZ B cells were resuspended in Cell Adhesive Solution as
instructed by the manufacturer (Crystalgen), applied into slides (Gold Seal
Products), fixed with 1% paraformaldehyde, and permeabilized with 0.2%
Triton-100 in phosphate buffer solution. Stainings were performed with
unconjugated or biotin-conjugated primary antibodies to human p65, p50
and p52 (SantaCruz). Isotype antibodies were used as negative controls
(Santa Cruz Biotechnologies). Slides were incubated with the following
secondary reagents: Alexa Fluor 488-conjugated polyclonal antigoat,
Alexa Fluor 647-conjugated polyclonal anti-rabbit and cyanine 5conjugated streptavidin. streptavidin. Nuclei were visualized with 4′,6diamidine-2′-phenylindole
dihydrochloride
Mannheim).
coverslipped
Slides
were
(DAPI)
with
(Boehringer
FluorSave
reagent
(Calbiochem). Fluorescence images were generated with a Leica
microscope.
Page 54
Quantitative PCR analysis and Southern blotting
To quantify human gene products, RNA was obtained by High Pure RNA
Isolation kit as specified by the manufacturer (Roche) and the cDNA was
synthetized as indicated by manufacturer (Invitrogen). qRT-PCRs were
performed using SIBR®-green methods as indicated by the manufacturer
(applied biosystems). Specific primers were utilized for the amplification
of the different genes (Table 1). Gene expression profile analysis was
performed using the SDS 2.0 software (Appied Biosystems).
Southern blots
To detect human germline and circle transcripts, total RNA was extracted
(Roche) and cDNA was synthesized as indicated by manufacturer
(Roche). Transcripts were amplified by standard RT-PCR and hybridized
with appropriate radiolabeled probes through Southern blotting assay. The
amplicons were transferred from the gel to a porous membrane by
capillary action using absorbent paper to soak solution through the gel and
the membrane. Specific sequences were detected in the membrane by
molecular hybridization with labeled nucleic acid probes.
Western blotting and phospho-kinase array
Total, cytoplasmic and nuclear proteins were obtained by lysing the cells
in presence of proteases inhibitors. Equal amounts of proteins were
fractionated onto a 10% SDS-PAGE and transferred onto PVDF
membranes (BioRad). After blocking, membranes were probed with Abs
to specific proteins (Table 2), washed and incubated with appropriate
secondary
Abs.
Proteins
were
detected
with
an
enhanced
chemiluminescence detection system (Amersham).
The phosphorylation of AKT, p70S6K, p38, Src, CREB and STAT5
was analyzed using a Proteome Profiler Human Phospho-Kinase Array kit
according to the manufacturer's instructions (R&D Systems). In these
Page 55
assays, the following lysis buffer was used: 50 mM Tris, 150 mM NaCl,
1% NP40, proteases inhibitors of (1 mM DTT, 1 mM Vanadate, 1 mM
PMSF, and 1X inhibitor cocktail (Roche), pH 7.5-8. A transmission-mode
scanner (Epson) and ImageJ analysis software was used to perform a
comparative densitometric analysis of immunoreactions.
Kinase assays
The kinase assays were performed using 2E2 B cell line as indicated by
manufacturer (Millipore). 2E2 cells (20 x 106cells per condition) were
treated with 500 ng/ml APRIL for 15 min in presence or absence of 10nM
of rapamycin. Anti-phospho IRAK1/IRAK4 or control antibody (Ctrl)
immunoprecipitation of lysates was carried out. The phosphorylated
substrate was then analyzed by immunoblot analysis, using a monoclonal
antibody to phosphorylated myelin basic protein (MBP).
Co-immunoprecipitation and Western blots
Co-immunoprecipitation (co-IP) assays were performed using splenic
IgD+ cells, 2E2 B cell line and transfected 293T cells. For each condition
20 x 106 IgD+ cells (or 2E2 B cell line) or 5 x 106 293 cells were used.
The assay was performed as indicated by the manufacturer (Roche) with
minor modifications. Briefly, after washing with ice cold PBS, cell pellets
were resuspended in 1mL of lysis buffer (cooled 4oC) and homogenized in
a Dounce homogenizer using a type B pestle by repeated strokes (approx
10) and incubated for 20 min at 4oC. The homogenized suspension was
centrifugated at 12 000 x g for 20 min at 4oC in a table-top microfuge and
the debris was removed. By adding 50 µL of streptavidin sepharose beads
or protein A/G sepharose beads for 3 hours (or overnight) at 4 oC on a
rocking platform a preclearing step was performed. The beads were
pelleted by centrifugation (12 000 x g for 20 s) and 5 µg of specific
antibody (or 5 µg of biotinylated IgG or IgG as negative control, see table
Page 56
2) were added to the supernatant for 3 hours. Then 50 µL of streptavidn
sepharose or protein A/G sepharose (previously washed with lysis buffer)
were added. After an O/N incubation at 4 oC, the protein complexes were
collected by centrifugation at 12 000 x g for 20 s. The supernatants were
removed and sequential washings were performed using 1 mL of wash
buffer 1 and wash buffer 2. The complexes were incubated 20 min with
the buffer 1 and 10 min with the buffer 2. Then the complexes were
collected by centrifugation and 60 uL of gel-loading buffer were added to
the agarose pellet (2X). The proteins were denaturated at 100 oC for 5
min. Finally, the beads were removed by centrifugation at 12 000 g for 20
s and the proteins were analyzed by western blot. In these experiments,
the following buffer were used. Lysis Buffer: 50 mM TRIS HCl ph7,5,
150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 0,5% TRITON, 0,2 mg/mL
BSA, Inhibitor proteases (1 mM Vanadate, 1 mM PMSF, cocktail
inhibidors 1X, Roche). Wash Buffer 1: 50 mM Tris-HCl pH 7.5, 500 mM
NaCl, 0.1% Triton. Wash Buffer 2: 10 mM Tris-HCl pH 7.5, 0.1% Triton.
Electrophoretic mobility shift assays
Oligonucleotides encompassing commercially available consensus NFκB-binding (Santa Cruz) were labeled with [α-32P] ATP and used at
approximately 50,000 c.p.m. in each reaction. Reaction samples were
prepared
and
electrophoresed
through
a
5%
non-denaturing
polyacrylamide gel. The composition of DNA-bound protein complexes
was determined by incubation of the reaction mixture with 1ug polyclonal
antibody to p65 (c-20), c-Rel (B-6) or p50 (C-19; Santa Cruz) before the
addition of radiolabeled probe.
Luciferase reporter assays
2E2 B cell line was nucleofected with 500 ng commercial minimal κB
promoter reporter plasmid expressing firefly luciferase (Promega)
Page 57
together with a 1 µg TACI expressing vector and with 200 ng pRL-TK
reporter plasmid expressing renilla luciferase under the control of the
thymidine kinase promoter (Promega). The nucleofection was performed
by using the Pulse controller Plus. After washing, the cells were
resuspended in 500 µl of RPMI without serum and in presence of plasmid
DNA. The cells were transferred to an electroporation cuvette, incubated
on ice for 5 min and electroporated for 10 s using the following setting:
low range 200, high range 500, Volts (kV) .210, and High Cap (µF) 0,75.
Then the cells were transfered into T75 flasks containing RPMI with 10%
FBS. After 8 hours at 37 oC 5% CO2 the cells were treated with 10nM of
rapamycin. Finally, the luciferase activity was measured by Dual
Luciferase Assay System (Promega). The results were normalized
considering the renilla signal.
293T cells were transfected using Superfect transfection reagent
(Qiagen) with 500 ng commercial minimal κB promoter reporter plasmid
expressing firefly luciferase (Promega) together with a 500 ng of protein
expressing vector (TACI, MyD88, mTOR, native or deletion mutants, see
Table 3) and with 200 ng pRL-TK reporter plasmid expressing renilla
luciferase under the control of the thymidine kinase promoter (Promega).
The transfection was performed as indicated by the manufacturer
(Qiagen).
Statistical analysis
The data were analyzed by two-tailed Student's test. Differences were
considered significant at a probability of error below 5% versus control.
Page 58
Table 1. Primers
PRIMER
b-Actins
b-Actintas
AICDs
AICDas
MyD88s
MyD88as
TACIs
TACIas
TLR9s
TLR9as
Blimp1s
Blimp1as
XBP1
XBP1
Pax5s
Pax5as
Deptors
Deptoras
Rictors
Rictoras
Raptors
Raptoras
mTORs
mTORas
Akts
Aktas
Iα1/2s
Cα1as
Cα2as
IγG1/2s
IγG3s
IγG4s
Cγ1as
Cγ2as
Cγ3as
Cγ4as
SEQUENCE
GGATGCAGAAGGAGATCACT
CGATCCACACGGAGTACTTG
AGA GGC GTG ACA GTG CTA CA
TGT AGC GGA GGA AGA GCA AT
GAGCGTTTCGATGCCTTCAT
CGGATCATCTCCTGCACAAA
CAGACAACTCGGGAAGGTACC
GCCACCTGATCTGCACTCAGCTTC
ACAACAACATCCACAGCCAAGTGTC
AAGGCCAGGTAATTGTCACGGAG
GTGGTATTGTCGGGACTTTGCAG
TCGGTTGCTTTAGACTGCTCTGTG
AGGAGTTAAGACAGCGCTTGG
AGAGGTGCACGTAGTCTGAGTGCTG
TTGCTCATCAAGGTGTCAGG
CTGATCTCCCAGGCAAACAT
CACCATGTGTGTGATGAGCA
TGAAGGTGCGCTCATACTTG
GGAAGCCTGTTGATGGTGAT
GGCAGCCTGTTTTATGGTGT
ACTGATGGAGTCCGAAATGC
TCATCCGATCCTTCATCCTC
TTGCTTGAGGTGCTACTG
CTGACTTGACTTGGATTCTG
TCTATGGCGCTGAGATTGTG
CTTAATGTGCCCGTCCTTGT
CAGCAGCCCTCTTGGCAGGCAGCCAG
GGGTGGCGGTTAGCGGGGTCTTGG
TGTTGGCGGTTAGTGGGGTCTTCA
GGGCTTCCAAGCCAACAGGGCAGGACA
AGGTGGGCAGCCTTCAGGCACCGAT
TTGTCCAGGCCGGCAGCATCACCAGA
GTTTTGTCACAAGATTTGGGCTC
GTGGGCACTCGACACAACATTTGCG
TTGTGTCACCAAGTGGGGTTTTGAGC
ATGGGCATGGGGGACCATATTTGGA
qPCR, quantitative PCR
South, Southern blot
Page 59
USE
qPCR
qPCR
qPCR
qPCR
qPCR
qPCR
qPCR
qPCR
qPCR
qPCR
qPCR
qPCR
qPCR
qPCR
qPCR
qPCR
qPCR
qPCR
qPCR
qPCR
qPCR
qPCR
qPCR
qPCR
qPCR
qPCR
South
South
South
South
South
South
South
South
South
South
Table 2. Antibodies
Antigen
Manufacturer
Use
TACI
MyD88
TRAF2
p-IRAK1 (T387)
IRAK1
p-IRAK4 (T345)
IRAK4
p-mTOR (S2448)
mTOR
p-p70S6K (T389)
p70S6K
p-S6K (S235/236)
S6K
p-4E-BP1 (T37/46)
4E-BP1
p-IKKα/β (S176/180)
IKKα/β
p-IκBα (S32/36)
IκBα
p65
p50
p52
His
MYC
FLAG
HA
Abcam
Abcam
Abcam
Cell Signaling
Cell Signaling
Cell Signaling
Cell Signalling
Cell Signaling
Cell Signaling
Cell Signaling
Cell Signalling
Cell Signaling
Cell Signalling
Cell Signalling
Cell Signaling
Cell Signalling
Cell Signalling
Cell Signalling
Cell Signalling
SantaCruz
SantaCruz
SantaCruz
SantaCruz
SantaCruz
SantaCruz
SantaCruz
WB/IP
WB
WB
WB/IP
WB
WB/IP
WB
WB
WB
WB
WB
WB
WB
WB
WB
WB
WB
WB
WB
WB/EMSA/IF
WB/EMSA/IF
WB/EMSA/IF
WB/IP
WB
WB/IP
WB/IP
WB, Western blotting
IP, immunoprecipatation
EMSA, Electrophoretic mobility shift assays
IF, immunofluorescence
Page 60
Table 3. Vectors
Vectors
TACI WT
TACI D1
TACI D2
MyD88 WT
MyD88 WT
MyD88 D1
MyD88 D2
MyD88 D3
MyD88 D4
mTOR WT
mTOR D1
mTOR D2
mTOR D3
TSC1
TSC2
Manufacturer
Cerutti laboratory
Cerutti laboratory
Cerutti laboratory
Cerutti laboratory
Cerutti laboratory
Cerutti laboratory
Cerutti laboratory
Cerutti laboratory
Cerutti laboratory
Addgene
Addgene
Addgene
Addgene
Addgene
Addgene
Page 61
Tag
Histidine
Histidine
Histidine
HA
FLAG
FLAG
FLAG
FLAG
FLAG
MYC
MYC
MYC
MYC
-
Expressed
Region (aa)
1-293
1-226
1-216
1-296
1-296
1-109
1-160
109-296
160-296
1-2549
1-1482
1271-2000
1750-2549
WB
WB
Page 62
CHAPTER 4
RESULTS
Page 63
Page 64
RESULTS
TACI activates mTOR through a mechanism involving MyD88
We recently found that TACI recruits the adaptor protein MyD88 to
activate a TLR-like pathway that enhances CSR and antibody production
in B cells exposed to BAFF or APRIL65. Given that TACI collaborates
with TLRs in B cells163
143, 200, 201
and considering that some TLRs recruit
both MyD88 and mTOR in pDCs195, we hypothesized that mTOR plays
an important role in the stimulation of B cells by TACI.
To determine the involvement of mTOR in TACI signaling, we
performed immunoblotting (IB) assays to measure the phosphorylation
profile of mTOR and downstream mTOR substrates in human splenic
IgD+ B cells exposed to APRIL in the presence or absence of rapamycin, a
selective inhibitor of mTORC1 (Fig. 1). These and subsequent signaling
studies could not be performed with isolated IgDlowCD27+ MZ B cells due
to limitations in the amount of cells available after FACSorting.
Nonetheless, total splenic IgD+ B cells included a large fraction (ranging
from 25% to 40%) of MZ B cells. In addition, total splenic IgD+ B cells
expressed TACI and BAFF-R but not BCMA (not shown), which allowed
the use of APRIL to selectively engage TACI.
Engagement of TACI by APRIL induced the phosphorylation of
mTOR and some of its downstream targets, including p70S6 kinase, 4EBP1 and S6. Interestingly, both mTOR activation and downstream
signaling were strongly inhibited by exposing B cells to rapamycin. Thus,
in the presence of TACI ligation by APRIL, B cells activate mTOR
through a rapamycin-sensitive pathway that involves mTORC1.
Page 65
Figure 1. TACI engagement by APRIL activates mTOR and its canonical
downstream substrates through a rapamycin-sensitive pathway. IgD+ B cells
were cultured in the medium only (Ctrl) and treated with 500 ng/mL of APRIL
for 5, 10, 15 and 30 min. in presence or absence of 10 nM of rapamycin (rapa).
Cellular extracts were analyzed by Western blot. Representative immunoblots of
phospho (p)-mTOR, mTOR, p-4E-BP1, 4EBP1, p-p70S6K, p70S6K, p-S6 and
S6. Red numbers indicate band intensity relative to total protein. Arrowhead
indicates specific band. Data are from one of three experiments giving similar
results.
To further confirm the activation of mTORC1 by TACI, we activated
splenic IgD+ B cells with APRIL in the presence of Ly294002. This
compound specifically inhibits PI3K, an enzyme that functionally links
the mTORC1 complex with growth signals from multiple receptors202. In
these experiments we also used Torin 1, a compound that inhibits
mTORC1 more efficiently than rapamycin203. IB assays showed that both
Ly294002 and Torin 1 prevented S6 phosphorylation in splenic IgD+ B
cells exposed to APRIL (Fig. 2).
Page 66
Figure 2. TACI engagement by APRIL activates mTORC1 through PI3K.
IgD+ B cells were cultured in the medium only (Ctrl) and treated with 500 ng/mL
of APRIL for 15 min. in the presence or absence of 25 µM Ly294002 (Ly) and 10
nM Torin1, followed by immunoblotting of p-S6 and S6. Red numbers indicate
band intensity relative to S6 protein (loading control). Arrowhead indicates
specific band. Data are from one of three experiments giving similar results.
Given that APRIL induces MyD88 recruitment to TACI in B cells65 and
that MyD88 associates with mTOR in pDCs195, we wondered whether
TACI ligation leads to the recruitment of mTOR via MyD88. To address
this question, we performed co-immunoprecipitation (co-IP) followed by
IB assays. These experiments showed that TACI associated with TRAF2
(a canonical TACI-interacting adaptor protein), mTOR, MyD88 as well as
IRAK-1 and IRAK-4 (two kinases downstream of MyD88) in splenic
IgD+ B cells incubated with APRIL (Fig. 3). Of note, rapamycin impaired
the association of TACI with MyD88, mTOR and TRAF2, but did not
affect the interaction of TACI with IRAK-1 and IRAK-4 (Fig. 3).
Page 67
Figure 3. TACI recruits mTOR, MyD88, TRAF2, IRAK-1 and IRAK-4 in
response to APRIL. Protein lysates from human IgD+ B cells cultured in the
medium (Ctrl) and treated for 15 min. with 500 ng/mL of APRIL in the presence
or absence of 10 nM rapamycin (rapa) were used in co-IP assays with anti-TACI
or control (IgG) antibodies. Co-IP was followed by immunoblotting (IB) using
antibodies to TACI, mTOR, MyD88, TRAF-2, IRAK-4, IRAK-1 and TACI. Red
numbers indicate band intensity relative to TACI protein (loading control).
Arrowhead indicates specific band. Data are from one of three experiments giving
similar results.
We next investigated the molecular requirements for the interaction of the
intracellular domain of TACI with mTOR by transfecting 293 cells with
expression plasmids encoding histidine (His)-tagged wild type (WT)
TACI or His-tagged TACI deletion mutants (Fig. 4A). The cytoplasmic
domain of WT TACI contains a highly conserved THC motif that spans
amino acids 217-239 and functions as MyD88-binding site65. This site is
different from the canonical TIR domain of TLRs and is positioned
immediately upstream of a canonical TRAF2-binding site65. TACI
deletion mutant 1 (D1) and D2 span amino acids 1-226 and 1-216,
Page 68
respectively, and thus lack both MyD88-binding and TRAF2-binding
sites. Compared to TACI D1, TACI D2 also lacks a segment of the
cytoplasmic domain of TACI involved in the recruitment of TRAF5 and
TRAF665. Co-IP followed by IB showed that WT TACI interacted with
both mTOR and MyD88, whereas TACI D1 and D2 did not (Fig. 4B).
Thus, TACI requires its MyD88-binding THC site to recruit mTOR.
A
B
Figure 4. TACI requires its MyD88-binding site to interact with mTOR. (A)
Structure of WT, D1 and D2 TACI-His proteins. Left and right numbers indicate
N-terminal and C-terminal residues, respectively. ED, extracellular domain; TD,
transmembrane domain; CD, cytoplasmic domain. (B) His-specific and control
(IgG) antibodies were used in co-IP assays involving total lysates from 293 cells
transfected with WT, D1 and D2 TACI-His expression plasmids. Co-IP was
followed by IBs with antibodies to mTOR, MyD88 or His. Arrowhead indicates
specific band. Data are from one of three experiments giving similar results.
In subsequent experiments, we mapped the region of MyD88 required for
the interaction with mTOR by co-transfecting 293 cells with expression
plasmids encoding Myc-tagged mTOR and FLAG-tagged WT MyD88 or
FLAG-tagged MyD88 deletion mutants (Fig. 5A). WT MyD88
encompassed th N-terminal death domain (DD) required for the
Page 69
recruitment of IRAK kinases, the intermediary domain (ID) required for
the binding to TACI, and the TIR domain required for the binding to
TLRs65. MyD88 D1 spun amino acids 1-109 and contained the DD, but
neither ID nor TIR domains. MyD88 D2 encompassed amino acids 1-160
and contained the DD and ID domains, but not the TIR domain. MyD88
D3 spun amino acids 1-160, contained the ID and TIR domains, but
lacked the DD domain. Finally, MyD88 deletion mutant D4 encompassed
amino acids 160-296 and included the TIR domain but not the DD and ID
domains. Co-IP and IB assays demonstrated that WT, D3 and D4 MyD88
proteins interacted with mTOR, whereas D1 and D2 showed little or no
interaction with MyD88 (Fig. 5B). These data indicate that MyD88 uses
its TIR domain to interact with mTOR.
A
B
Page 70
Figure 5. MyD88 requires its TIR domain to interact with mTOR. (A)
Structure of WT, D1, D2, D3 and D4 MyD88-FLAG proteins. Left and right
numbers indicate N-terminal and C-terminal residues, respectively. (B) FLAGspecific and control (IgG) antibodies were used in co-IP assays involving total
lysates from 293 cells co-transfected with mTOR-MYC and WT, D1, D2, D3 or
D4 MyD88-FLAG expression plasmids. Co-IP was followed by IBs with
antibodies to MYC or FLAG. Arrowhead indicates specific band. Data are from
one of three experiments giving similar results.
Finally, we mapped the region of mTOR required for the interaction with
MyD88 by co-transfecting 293 cells with expression plasmids encoding
hemagglutinin (HA)-tagged MyD88 and MYC-tagged WT mTOR or
MYC-tagged mTOR deletion mutants (Fig. 6A). WT mTOR included the
N-terminal HEAT (Huntington, elongation factor 3, protein phosphatase
2A, and TOR1) region (HR), which interacts with RAPTOR, the central
region encompassing the FAT (FRAP, ATM, TRRAP) domain, which
binds DEPTOR204, and the C-terminal region encompassing the kinase
domain (KD), which accounts for the enzymatic activity of the protein.
D1 mTOR spun amino acids 1-11482 and included HR, but not FAT and
KD domains. D2 mTOR spun amino acids 1271-2000 and encompassed
the central region, including most of the FAD domain. D3 mTOR spun
amino acids 1750-2549 and encompassed the C-terminal region, including
part of the FAT domain and the KD. Co-IP and IB assays showed that
WT, D2 and D3 mTOR proteins interacted with MyD88, whereas D1
mTOR showed little or no binding to MyD88 (Fig. 6B). These data
indicate that mTOR uses its central region, including the FAT domain, to
interact with mTOR.
Page 71
A
B
Figure 6. mTOR uses its central-terminal region to interact with MyD88. (A)
Structure of WT, D1, D2, D3 and D4 mTOR-MYC proteins. Left and right
numbers indicate N-terminal and C-terminal residues, respectively. (B) MYCspecific and control (IgG) antibodies were used in co-IP assays involving total
lysates from 293 cells co-transfected with MyD88-HA and WT, D1, D2 or D3
mTOR-MYC expression plasmids. Co-IP was followed by IBs with antibodies to
MYC or HA. Arrowhead indicates specific band. Data are from one of three
experiments yielding similar results.
Overall, this molecular evidence demonstrates that TACI engagement by
APRIL induces the recruitment of mTOR to the cytoplasmic domain of
TACI through a mechanism involving the THC, IR and FAT motifs of
TACI, MyD88 and mTOR, respectively. The recruitment of mTOR to
TACI occurs in the context of TACI interaction with MyD88, TRAF2,
IRAK-1 and IRAK-4 and causes PI3K-dependent activation of mTORC1.
TACI enhances IRAK, IKK and NF-κB activation through mTOR
Given its kinase activity, mTOR may modify the activation of kinases
positioned downstream of TACI, TRAF2 and MyD88, including IRAK-1,
IRAK-4 and IKK65. These kinases cause activation of NF-κB, a
Page 72
transcription factor essential for the induction of CSR and antibody
production in B cells. To verify whether TACI activates IRAK-1 and
IRAK-4 via mTOR, we performed ad hoc kinase assays by
immunoprecipitating the phosphorylated (i.e., active) form of IRAK-1 or
IRAK-4 from an IgD+ 2E2 B cell line stimulated with APRIL in the
presence or absence of rapamycin. Myelin basic protein (MBP) was added
to immunoprecipitated proteins to measure the kinase activity of IRAK-1
and IRAK-4. IP assays followed by IB showed that splenic IgD+ B cells
exposed to APRIL increased the kinase activity of both IRAK-1 and
IRAK-4 (Fig. 7). This effect was reduced in B cells exposed to
rapamycin. Thus, TACI recruits mTOR through a MyD88-dependent
rapamycin-sensitive pathway to enhance the activation of NF-κBinducing kinases positioned downstream of MyD88, including IRAK-1
and IRAK-4.
Figure 7. TACI enhances IRAK1 and IRAK4 activation through mTOR.
IgD+ 2E2 B cells were cultured in the medium only (Ctrl) and treated with or
without 500 ng/mL APRIL for 15 min in the presence or absence of 10 nM
rapamycin (rapa). IP of whole cell lysates with antibodies to p-IRAK-1 or pIRAK-4 or a control (IgG) antibody was followed by incubation with MBP and
Page 73
by IB with an antibody to p-MBP. Red numbers indicate band intensity relative to
total IRAK-1 or IRAK-4. Arrowhead indicates specific band. Data are from one
of three experiments giving similar results.
We next verified the role of mTOR in the activation of the IKK complex
by TACI. Active IKK causes cytoplasmic-nuclear translocation of
canonical NF-κB dimers such as p65-p50 and p50-c-Rel by inducing
phosphorylation-dependent degradation of IκBα, an inhibitor of NF-κB
that retains p65-p50 and p50-c-Rel dimers in an inactive cytoplasmic
form. IB assays demonstrated that, in the presence of APRIL, splenic IgD+
B cells showed increased IKKα/β and IκBα phosphorylation as well as
increased IκBα degradation (Fig. 8). However, in the presence of
rapamycin, APRIL induced little or no IKKα/β phosphorylation, IκBα
phosphorylation and IκBα degradation. These data indicate that TACI
enhances IKK activation via mTOR.
Figure 8. TACI enhances IKK activation through mTOR. Splenic IgD+ B
cells were cultured in the medium only (Ctrl) and treated with 500 ng/mL APRIL
for 5, 10, 15 and 30 min in the presence or absence of 10 nM rapamycin (rapa).
IBs were performed with antibodies to p-IKKα/β, IKKα/β, p-IκBα or IκBα. Red
numbers indicate band intensity relative to total IKKα/β or IκBα. Arrowhead
indicates specific band. Data are from one of three experiments giving similar
results.
Page 74
Having shown that TACI activates a PI3K-dependent mTORC1 complex,
we verified whether selective inhibitors of PI3K activity and mTORRAPTOR interaction could attenuate the activation of IKK by APRIL.
Consistent with this possibility, IB assays showed that Ly294002 or Torin
1 inhibited the induction of IKKα/β phosphorylation in splenic IgD+ B
cells exposed to APRIL (Fig. 9).
Figure 9. TACI enhances IKK activation via PI3K-dependent activation of
the mTORC1 complex. Splenic IgD+ B cells were cultured in the medium only
(Ctrl) and treated with 500 ng/mL APRIL for 15 min in the presence or absence
of 25 µM Ly294002 or 10 nM Torin 1. IBs were performed with antibodies to pIKKα/β or IKKα/β. Red numbers indicate band intensity relative to total IKKα/β
or IκBα. Arrowhead indicates specific band. Data are from one of three
experiments giving similar results.
To determine whether mTOR influences the interaction of TACI-induced
NF-κB to DNA, we performed electrophoretic mobility shift assay
(EMSA) and NF-κB-specific supershift assays using a radidolabeled NFκB-binding DNA sequence and nuclear protein extracts from splenic IgD+
B cells exposed to APRIL in the presence or absence of rapamycin. We
found increased binding of p50 and p65 but not p52 and (not shown) cRel proteins to DNA in B cells exposed to APRIL (Fig. 10). In the
presence of rapamycin, both constitutive and APRIL-induced binding of
p50 and p65 to DNA decreased. Thus, TACI recruits and activates mTOR
to enhance the activation of IRAK-1, IRAK-4 and IKK, three kinases
functionally linked to NF-κB. Activation of NF-κB by TACI-induced
mTORC1 increases the nuclear translocation of p50-p65 dimers and their
Page 75
binding to target gene sequences.
Figure 10. TACI enhances NF-κB binding to DNA through mTOR. Splenic
IgD+ B cells were treated for 60 min with 500 ng/mL APRIL in the presence or
absence of 10 nM rapamycin (rapa). EMSA and supershift assays involved the
incubation of nuclear protein extracts with a radioactive probe encompassing a
conserved NF-κB-binding sequence in the presence or absence of antibodies to
p65, p50 or p52 subunits of NF-κB. Increasing concentrations of unlabeled (cold)
probe were used to test the specificity of the reaction. Data are from one of two
experiments giving similar results.
TACI enhances NF-κB-dependent gene transcription through mTOR
Having shown that TACI recruits mTOR to enhance nuclear translocation
and DNA binding of NF-κB, we determined whether mTOR also
influences the induction of NF-κB-dependent gene transcription by TACI.
To verify this possibility, we co-transfected the IgD+ B cell line 2E2 with
a TACI expression vector and a minimal NF-κB-responsive luciferase
reporter vector driven by two κB sites. Transfection was followed by
incubation of 2E2 B with APRIL in the presence or absence of rapamycin.
We found that TACI induced NF-κB-dependent gene transcription
through a pathway that was strongly inhibited by rapamycin (Fig. 11).
Page 76
*
Figure 11. TACI enhances NF-κB-dependent gene transcription through
mTOR. IgD+ 2E2 B cells co-transfected with a TACI expression vector and a
minimal NF-κB-responsive luciferase reporter vector were cultured with 500
ng/mL APRIL in the presence or absence of 10 nM rapamycin (rapa). Ctrl,
control empty vector. Data summarize three experiments. Error bars, SEM. *P <
0.05 (two-tailed unpaired Student's t-test).
Similar transient transfection and luciferase reporter assays were used in
293 cells to elucidate the molecular requirements underlying the
enhancement of TACI-induced NF-κB-dependent gene transcription by
mTOR. Initial assays determined the role of TCS-1 and TSC-2 proteins,
which form a complex upstream of mTOR that negatively regulates the
activation of mTORC1177. We found that TSC-1 or TSC-2 alone did not
impair TACI-induced NF-κB-dependent gene transcription, whereas a
combination of TSC-1 and TSC-2 did (Fig. 12). These data indicate that
TACI enhances NF-κB-dependent gene transcription through an mTORdependent pathway negatively regulated by the TSC-1-TSC-2 complex.
Page 77
Figure 12. TACI-induced NF-κB-dependent gene transcription is negatively
regulated by the mTOR inhibitory proteins TSC-1 and TSC-2. 293 cells cotransfected with a minimal NF-κB-responsive luciferase reporter vector and with
or without TACI, TSC-1 and/or TSC-2 expression vectors. Ctrl, control empty
vector. Data summarize three experiments. Error bars, SEM. *P < 0.05 (twotailed unpaired Student's t-test).
To characterize the regions of TACI, MyD88 and mTOR required for the
induction of NF-κB-dependent gene transcription, we co-transfected 293
cells with a minimal NF-κB-responsive luciferase reporter vector and the
TACI, MyD88 or mTOR deletion mutants described earlier. Compared to
WT TACI, which induced strong NF-κB-dependent gene transcription,
TACI D1 and D2 deletion mutants lacking the MyD88-TOR (but also
TRAF2) binding site induced little or no NF-κB-dependent gene
transcription (Fig. 13A). Of note, WT MyD88 and MyD88 D3 and D4
deletion mutants, which contained the mTOR-binding site, sustained
TACI-mediated NF-κB-dependent gene transcription more vigorously
than MyD88 D1 and D2 deletion mutants, which lacked the mTORbinding site (Fig. 13B). Compared to WT MyD88, D3 and D4 deletion
mutants
showed
reduced
TACI-mediated
NF-κB-dependent
gene
transcription due to the lack of the IRAK-interacting DD domain. Finally,
mTOR D1 deletion mutant, which lacked the MyD88-binding site,
Page 78
1
2
sustained TACI-mediated NF-κB-dependent gene transcription as much as
WT mTOR, probably due to its ability to retain an active KD (Fig. 13C).
In contrast, mTOR D2 and D3 deletion mutants sustained TACI-mediated
NF-κB-dependent gene transcription less effectively than WT mTOR or
mTOR D1, probably due to the lack of the C-terminal HEAT region
required for the interaction with RAPTOR.
A
B
Figure 13. MyD88 and mTOR regulate TACI-induced NF-κB-dependent
gene transcription. 293 cells co-transfected with a minimal NF-κB-responsive
luciferase reporter vector and with or without WT TACI, TACI D1, TACI D2,
WT MyD88, MyD88 D1, MyD88 D2, MyD88 D3, MyD88 D4, WT mTOR,
mTOR D1, mTOR D2 or mTOR D3 expression vectors. Data summarize three
experiments. Ctrl, control empty vector. Data summarize three experiments. Error
bars, SEM. *P < 0.05 (two-tailed unpaired Student's t-test).
Page 79
Together with our earlier results, these data indicate that TACI amplifies
NF-κB-dependent gene transcription by activating mTORC1 through a
ramamycin-sensitive pathway involving the interaction of TACI with
MyD88 and mTOR.
TACI enhances CSR through mTOR
Having shown that TACI enhances NF-κB activation through mTOR and
given the important role of TACI in TI antibody production205,
206
, we
wondered whether mTOR enhances the activation of MZ B cells by TACI
and TACI-cooperating molecules, including TLR9. This microbial CpG
DNA receptor enhances the induction of MZ B cell activation by TACI
and shares both MyD88 and mTOR with TACI.
First, we compared TACI, TLR9, MyD88 and mTOR expression in
splenic MZ and follicular B cells. As shown by flow cytometry, splenic
IgDloCD27+ MZ B cells expressed more TACI and more canonical
activation molecules such as CD69, CD80 and HLA-DR than splenic
follicular IgDhiCD27– B cells (Fig. 14A). The activated state of MZ B
cells was confirmed by QRT-PCR assays, which showed that MZ B cells
expressed more TACI and TLR9 transcripts than follicular B cells (Fig.
14B). Also transcripts for the CSR-induced enzyme AID were somewhat
increased in MZ B cells, whereas transcripts for MyD88, AKT, mTOR,
RAPTOR and RICTOR were not (Fig. 14B,C). Thus, compared to
follicular B cells, splenic MZ B cells display a pre-activated state that
includes more elevated expression of TACI and TLR9, but comparable
expression of signaling molecules downstream of TACI and TLR9,
including MyD88 and mTOR.
Page 80
A
B
C
Page 81
Figure 14. MZ B cells express more TACI, TLR9 and other activationrelated receptors than follicular B cells. (A) Flow cytometry of CD69, CD80,
HLA-DR and TACI on splenic MZ and follicular B cells. Solid gray profile,
isotype control. FO, follicular. (B,C) QRT-PCR of transcripts for AID, MyD88,
TACI, TLR9, mTOR, RAPTOR, RICTOR, and AKT in MZ and FO B cells. RE,
relative expression. Data summarize three experiments. Error bars, SEM. *P <
0.005 (two-tailed unpaired Student's t-test).
Having shown that MZ B cells express TACI and mTOR, we verified
whether these cells use mTOR to activate NF-κB in response to TACI
ligation. Consistent with earlier EMSA data from total splenic IgD+ B
cells, immunofluorescence analysis (IFA) showed that APRIL increased
p50 and p65 but not p52 nuclear translocation in MZ B cells (Fig. 15).
This effect disappeared after exposing MZ B cells to APRIL in the
presence of rapamycin. Thus, similar to total splenic IgD+ B cells, MZ B
cells enhance TACI signaling via NF-κB through a mechanism involving
mTOR.
Figure 15. TACI enhances NF-κB activation in MZ B cells via mTOR. IFA of
p65 (red), p50 (green), p52 (red) and DAPI (blue) in MZ B cells cultured in the
medium only (Ctrl) and treated with 500 ng/ml APRIL for 60 min in the presence
or absence of 10 nM rapamycin (rapa). Images are from one of two experiments
yielding similar results. Original magnification, ×63.
Given that NF-κB is critical for the induction of CSR, including germline
Cγ and Cα gene transcription and AID expression207,
208
, we verified
whether TACI induces CSR by stimulating MZ B cells through mTOR.
Page 82
Germline IH-S-CH gene transcription precedes CSR to promote the
recruitment of AID to Sµ and the targeted downstream SX region and
yields a spliced germline IH-CH transcript that generates no protein.
Following AID-mediated processing of DNA at Sµ and SX regions, CSR
generates a reciprocal switch DNA recombination product known as
switch circle. This excised extra-chromosomal DNA includes the IH
promoter 5’ of the targeted CH gene, the DNA segment between Sµ and
the targeted SX region, and Cµ. Under the influence of the IH promoter, the
switch circle transcribes a chimeric IH-Cµ product referred to as switch
circle transcript. Together with AID transcripts, germline IH-CH transcripts
and switch circle transcripts constitute molecular hallmarks of ongoing
CSR.
To determine the involvement of mTOR in TACI-induced CSR, we
measured germline IH-CH transcripts, switch circle IH-Cµ transcripts and
AID in MZ B cells exposed to APRIL in the presence or absence of
rapamycin. RT-PCR followed by Southern blotting, QRT-PCR and
immunoblotting showed that, in the presence of APRIL, MZ B cells upregulated the expression of germline Iγ1-Cγ1, Iγ2-Cγ2, Iγ3-Cγ3, Iα1-Cα1
and Iα2-Cα2 transcripts, switch circle Iγ1/2-Cµ, Iγ3-Cµ and Iα1/2-Cµ
transcripts as well as AID transcripts and protein (Fig. 16A-C). The upregulation of all these transcripts and that of AID protein decreased when
MZ B cells were exposed to rapamycin. Along with earlier data, these
findings indicate that TACI recruits mTOR to enhance NF-κB-dependent
induction of AID expression and CSR from IgM to IgG1, IgG2, IgG3,
IgG4, IgA1 or IgA2 in MZ B cells.
Page 83
A
B
C
Figure 16. TACI enhances AID expression and CSR from IgM to IgG or IgA
in MZ B cells. MZ B cells were treated for 72 h with 500 ng/mL APRIL in the
presence or absence of 10 nM rapamycin. (A) Southern blot analysis of RT-PCRamplified Iγ1/2-Cµ, Iγ3-Cµ, Iα1/2-Cµ, Iγ1/2-Cγ1, Iγ1/2-Cγ2, Iγ3-Cγ3, Iα1-Cα1
and Iα2-Cα2 transcripts. The Iµ-Cµ amplicon corresponds to a loading control.
Red numbers indicate band intensity relative to unstimulated MZ B cells. (B)
qRT-PCR of transcripts for AID. Results are normalized to β-actin mRNA. RE,
relative expression compared to unstimulated (Ctrl) MZ B cells. (C) IB of AID
and control actin proteins. Arrowhead indicates specific band. Data are from one
of three experiments giving similar results (A,C) or summarize three experiments
(B). Error bars, SEM. *P < 0.05 (two-tailed unpaired Student's t-test). N.S., not
significant.
Page 84
TACI enhances MZ B cell proliferation through mTOR
CSR is usually functionally coupled with the proliferation of activated B
cells209. Given that TACI signaling via mTOR enhances NF-κB-dependent
CSR in MZ B cells, we wondered whether this pathway also modulates
MZ B cell proliferation. In initial experiments, we took advantage of
phospho-protein arrays to identify proliferation-associated rapamycinsensitive gene products in MZ B cells exposed to APRIL. We found that
APRIL up-regulated the phosphorylation of key residues of mitogenactivated protein kinase p38 (p38), tyrosine protein kinase Src (Src),
signal transducer and activator of transcription 5 (STAT5) and cAMP
response element-binding protein (CREB) (Fig. 17A). These signaling
proteins regulate multiple processes in activated B cells, including
proliferation210-212.
As
expected,
APRIL
also
up-regulated
the
phosphorylation of enzymes linked to PI3K-mediated activation of
mTORC1, including AKT and p70S6K (Fig. 17B). Of note, rapamycin
decreased APRIL-induced phosphorylation of p38, Src, STAT5, CREB,
AKT and p70S6K (Fig. 17A,B). These data suggests that TACI recruits
mTOR to enhance the phosphorylation of proliferation-related enzymes in
MZ B cells.
Page 85
A
B
Page 86
Figure 17. TACI uses mTOR to enhance the activation of proliferationrelated signaling proteins in MZ B cells. Total proteins from splenic MZ B
cells cultured in the medium only (Ctrl) and treated with 500 ng/mL APRIL for
15 min in the presence or absence of 10 nM rapamycin (rapa) were analyzed
through a phospho-proteome profile kit. Bars indicate the mean pixel density of
dot blots from gels positioned underneath each graph. The protein
phosphorylation site is indicated in brackets. O.D., optical density. Error bars,
SEM. *P < 0.05 (two-tailed unpaired Student's t-test).
Page 87
Additional QRT-PCR experiments demonstrated that MZ B cells exposed
to APRIL up-regulated the expression of transcripts encoding Cyclin D1
(Fig. 18), a protein the controls cell entry into the cell cycle. This upregulation did not occur in follicular B cells and was inhibited in MZ B
cells by rapamycin. These data indicate that TACI uses mTOR to promote
signaling and transcriptional events favoring MZ B cell entry into the cell
cycle.
Flow cytometric analysis of proliferation-induced dilution of
carboxyfluorescein succinimidyl ester (CFSE) demonstrated that TACI
engagement by APRIL was not sufficient to stimulate the proliferation of
MZ or follicular B cells (Fig. 19A,B). This result was not unexpected,
because TACI requires co-signals from TLRs, BCR and/or cytokines to
induce MZ B cell proliferation, CSR and antibody production65, 163. Thus,
we performed additional proliferation assays by stimulating MZ or
follicular B cells with a combination of APRIL and CpG DNA, a TLR9
ligand that provides powerful mitogenic signals to B cells.
Figure 18. TACI uses mTOR to enhance Cyclin D1 expression in MZ B cells.
QRT-PCR of Cyclin D1 transcripts in MZ B cell and treated for 6h with 500
ng/mL APRIL in the presence or absence of 10 nM rapamycin (rapa). Results are
normalized to β-actin transcripts. RE, relative expression compared to control
(Ctrl) unstimulated MZ B cells. Data summarize three experiments. Error bars,
SEM. *P < 0.05 (two-tailed unpaired Student's t-test). n.s.., not significant.
Page 88
We found that a combination of APRIL and CpG DNA induced more MZ
and follicular B cell proliferation than APRIL alone or CpG DNA alone
(Fig. 19A,B). Consistent with earlier results showing that MZ B cells
expressed more TACI and TLR9 than follicular B cells did, we also found
that a combination of APRIL and CpG DNA stimulated more proliferation
in MZ B cells than in follicular B cells (Fig. 19A,B). In agreement with
the ability of both TACI and TLR9 to recruit mTOR, rapamycin inhibited
the proliferation of MZ B cells exposed to either a combination of APRIL
and CpG DNA or CpG DNA alone (Fig. 19A). Rapamycin had a more
modest inhibitory effect on follicular B cells (Fig. 19B), which again
reflected the lower expression of both TACI and TLR9 by follicular B
cells as compared to MZ B cells. Overall, these data indicate that TACI
recruits mTOR to enhance TLR9-driven proliferation in MZ B cells.
A
Page 89
B
C
Page 90
Figure 19. TACI recruits mTOR to enhance TLR9-mediated MZ B cell
proliferation. (A,B) Splenic MZ and follicular B cells were stained with CFSE ,
cultured in the medium only (Ctrl) and treated with 500 ng/mL APRIL and/or 0,1
µg/mL CpG DNA in the presence or absence of 10 nM rapamycin. Numbers
indicate the frequency of proliferating B cells that have diluted CFSE. (C)
Summary of three experiments. Error bars, SEM. *P < 0.05 (two-tailed unpaired
Student's t-test).
Given that TACI and TLR9 functionally cooperate in MZ B cells through
a pathway involving MyD88 and mTOR, we wondered whether TACI and
TLR9 could undergo physical interaction in response to cognate ligands.
This interaction must occur in an intracellular compartment, because
TLR9 inhabits endosomes and needs to traffic into endolysosomes to
signal via MyD88. Ligand-induced endolysosomal trafficking of TLR9
promotes proteolytic cleavage of its ectodmain by cathepsin L and
recruitment of MyD88 to the TIR domain of truncated TLR9.
This implies that TACI-TLR9 cooperation may involve ligandinduced endocytosis of TACI and subsequent endolysosomal interaction
of TACI with truncated TLR9. Consistent with this possibility, TACIrelated molecules such as Fas have been previously shown to signal from
intracellular compartments after engagement by cognate ligands213. Co-IP
assays followed by IB demonstrated ligand-induced intracellular
association of TACI with truncated TLR9 in splenic B cells exposed to a
combination of APRIL and CpG DNA (Fig. 20). Of note, TACI interacted
with truncated TLR9 also in response to APRIL alone, possibly due to the
ability of signals from TACI to induce cleavage of TLR9. Conversely,
truncated TLR9 interacted with TACI in response to CpG DNA alone,
possibly due to the ability of CpG DNA to induce autocrine B cell release
of APRIL. Alternatively, a pool of TACI proteins may constitutively
inhabit endosomes and subsequently move to endolysosomes to interact
with truncated TLR9 in response to CpG DNA. Ongoing experiments are
testing these various possibilities as well as the involvement of mTOR in
the intracellular interaction of TACI with truncated TLR9.
Page 91
Figure 20. TACI interacts with truncated TLR9. Splenic B cells were cultured
in the medium only (Ctrl) and stimulated with 500 ng/ml APRIL in the presence
or absence of 0,1 µg/ml CpG DNA for 30 min. Whole cell extracts were
subjected to IB with antibodies to TLR9 or TACI following IP with a control
(IgG) antibody or an antibody to TACI. Truncated TLR9 is shown as a 65-kDa
band. Arrowhead indicates specific band. Data are from one of three experiments
yielding similar results.
Collectively, these experiments indicate that TACI recruits mTOR to
enhance MZ B cell proliferation through a TLR9-cooperative pathway
that may involve intracellular interaction of TACI with truncated TLR9.
TACI enhances antibody production through mTOR
MZ B cells co-stimulated via TACI and TLR9 rapidly differentiate into
antibody-secreting plasma cells. This maturation process usually requires
up-regulation of the plasma cell master plasma cell differentiation
transcription factor BLIMP-1, up-regulation of the secretory apparatusstimulating protein XBP-1, and down-regulation of the B cellspecification transcription factor PAX-5104,
100
. To determine the
involvement of mTOR in TACI-induced plasma cell differentiaton and
antibody production, we stimulated MZ B cells with APRIL and CpG
DNA in the presence or absence of rapamycin. QRT-PCRs demonstrated
the up-regulation of transcripts for BLIMP-1 and XBP-1 and the down-
Page 92
regulation of transcripts for PAX-5 in MZ B cells exposed to APRIL
alone, CpG DNA alone or a combination of APRIL and CpG DNA (Fig.
21). These plasma cell differentiation-related transcriptional changes were
inhibited by rapamycin, indicating that TACI and TLR9 recruit mTOR to
enhance the differentiation of MZ B cells into antibody-secreting plasma
cells.
Figure 21. TACI and TLR9 induce plasmablast-related transcriptional
changes by activating MZ B cells through mTOR. (A) Schematics of
transcriptional regulation of plasma cell differentiation. (B) QRT-PCRs of
BLIMP-1, XBP-1 and PAX-5 transcripts in MZ B cells cultured for 72 h in the
presence or absence of 500 ng/ml, APRIL, 0,1 µg/ml CpG DNA and/or 10 nM
rapamycin (rapa). Results are normalized to β-actin mRNA. RE, relative
expression compared to unstimulated (Ctrl) MZ B cells. The data summarize
three experiments (error bars, SEM). *P < 0.05 (two-tailed unpaired Student's t-
Page 93
test). N.S., not significant.
We then used flow cytometry to quantify the differentiation of MZ or
follicular B cells into plasmablasts expressing elevated surface CD27 and
CD38. Neither MZ nor follicular B cells differentiated into plasmablasts
in
response
to
APRIL
alone,
suggesting
that
APRIL-induced
transcriptional changes of BLIMP-1, XBP-1 and PAX-5 are insufficient to
induce a full-blown plasma cell differentiation program (Fig. 22 A-C).
Consistent with their higher expression of TLR9, a fraction of MZ B cells
underwent plasmablast differentiation in response to CpG DNA, whereas
follicular B cells did not (Fig. 22 A-C).
A
B
Page 94
C
Figure 22. TACI and TLR9 enhance the differentiation of MZ B cells into
plasmablasts through mTOR. (A,B) Flow cytometry of viable DAPI–
CD27hiCD38hi plasmablasts from MZ and follicular B cells cultured for 5 d with
500 ng/ml APRIL, 0,1 µg/ml of CpG DNA and/or 10 nM rapamycin (rapa). Data
are from one of three experiments with similar results. (C) Summary of three
plasmablast induction experiments. Error bars, SEM. *P < 0.05 (two-tailed
unpaired Student's t-test).
Of note, a combination of APRIL and CpG DNA stimulated more
plasmablast differentiation than did APRIL or CpG DNA alone (Fig. 22
A-C). Finally, rapamycin inhibited the induction of plasmablast
differentiation by CpG DNA alone or combined with APRIL (Fig. 22 AC). These data indicate that TACI and TLR9 recruit mTOR to enhance the
Page 95
formation of MZ B cells into plasmablasts via a BLIMP-1-dependent
differentiation program.
Next, we verified whether TACI and TLR9 could enhance antibody
secretion through mTOR. Consistent with earlier transcriptional and
phenotypic data, ELISAs demonstrated that a combination of APRIL and
CpG DNA induced MZ B cells to secrete some IgM as well as classswitched IgG and IgA antibodies (Fig. 23A). CpG DNA alone stimulated
less antibody secretion than APRIL and CpG DNA, whereas APRIL alone
showed no antibody-inducing effect. Of note, rapamycin inhibited
antibody secretion in MZ B cells exposed to APRIL and CpG DNA or
CpG DNA alone (Fig. 23A).
Page 96
Figure 23. TACI and TLR9 enhance antibody secretion through mTOR.
ELISAs of total IgM, IgG and IgA released by MZ B cells after incubation for 5 d
with 500 ng/mL APRIL, 0,1 µg/ml CpG DNA and/or 10 nM rapamycin (rapa).
Data summarize three experiments. Error bars, SEM. *P < 0.05 (two-tailed
unpaired Student's t-test).
Finally, we used flow cytometry to verify whether rapamycin inhibits
plasmablast differentiation by impacting on the survival of MZ B cells.
We found that APRIL alone or CpG DNA alone enhanced the survival of
MZ B cells, but this effect was not inhibited by rapamycin (Fig. 23A,B).
When combined with CpG DNA, APRIL did not further increase MZ B
cell survival (Fig. 23A,B). These results indicate that mTOR enhances
plasmablast differentiation by influencing the transcriptional programs
rather than the survival of MZ B cells stimulated via TACI and TLR9.
Page 97
A
B
B
Figure 24. mTOR does not interfere with the survival of MZ B cells
stimulated through TACI and TLR9. (A) Flow cytometry of viable AnnexinV–PI– MZ B cells cultured for 5 d with 500 ng/mL APRIL, 0,1 µg/ml CpG DNA
and/or 10 nM rapamycin (rapa). PI, propidium iodide. Numbers indicate
frequency of viable cells. (B) Summary of three experiments. Error bars, SEM.
*P < 0.05 (two-tailed unpaired Student's t-test).
Page 98
CHAPTER 5
DISCUSSION
99
Discussion
Page 100
DISCUSSION
We have shown that APRIL activated MZ B cells through mTORdependent signals emanating from TACI. APRIL induced the recruitment
of mTOR to the intracellular domain of TACI via a rapamycin-sensitive
pathway that required the TLR-associated adaptor protein MyD88.
Indeed, TACI used a MyD88-binding site to recruit mTOR through a
mechanism that involved the interaction of the central-terminal region of
mTOR with the TIR domain of MyD88. In addition to triggering a
classical signaling cascade encompassing P70S6K and 4E-BP1, mTOR
enhanced the induction of NF-κB by TACI, thereby augmenting CSR and
antibody production in MZ B cells exposed to APRIL. These responses
further increased in the presence of co-signals from TLR9, a CpG DNA
sensor that shares MyD88 and mTOR with TACI. Accordingly, TACI
interacted with TLR9 in MZ B cells exposed to APRIL and CpG DNA.
By showing that TACI uses mTOR to activate MZ B cells, our data
indicate that mTOR has a nodal position in the signaling networks
underlying innate-like antibody responses.
TACI links MZ B cells with the innate immune system
Splenic MZ B cells serve as professional sentinels in an anatomical area
continually exposed to small amounts of blood-borne antigens derived
from apoptotic cells and commensal bacteria. MZ B cells provide
additional protection against blood-borne pathogens, including viruses and
encapsulated bacteria. Unlike follicular B cells, MZ B cells are poised to
rapidly mount low-affinity IgM as well as class-switched IgG responses
without requiring help from T cells. Our findings indicate that this innatelike function involves the expression of elevated levels of both TACI and
TLRs. Accordingly, microbial products not only directly stimulate MZ B
cells by triggering B cell-intrinsic TLRs, but also induce the production of
Page 101
TACI ligands (i.e., BAFF and APRIL) by engaging TLRs in DCs,
macrophages, neutrophils and possibly ILCs152. Furthermore, TLR ligands
up-regulate TACI expression in MZ B cells200,143, a finding that echoes
other studies showing the central role of TLR signals in the autoimmune
pathology arising in transgenic mice overexpressing BAFF214. Of note,
innate immune cells express TACI ligands also in response to TLRinduced cytokines such as IFN-α, IFN-γ, IL-10 and granulocyte colony
stimulating factor (G-CSF)152,155. In general, the convergence of TACI and
TLR ligands into B cell-stimulating signaling pathways engenders the
optimization of TI antibody responses in the MZ.
By highlighting the central role of TACI in the stimulation of NF-κB
in MZ B cells, our data extend previous studies showing that TACI elicits
the recruitment of TRAF2 and TRAF6 adaptor proteins in B cells exposed
to BAFF or APRIL. Similar to CD40, TACI recruits TRAF2 and TRAF6
to stimulate the canonical IKK-dependent NF-κB pathway, which is
required to induce B cell proliferation, CSR and plasma cell
differentiation. We found that TACI further enhanced these NF-κBdependent responses by inducing a TLR-like pathway involving the
MyD88 adaptor protein as well as IRAK1 and IRAK4 kinases positioned
downstream of MyD88. This TLR-like signaling mode likely permits
TACI to optimize its cooperation with TLRs, which are powerful inducers
of canonical NF-κB signals in MZ B cells.
Together with dual BCR and PRR engagement by conserved TLR
ligands or carbohydrates, engagement of TACI by BAFF and APRIL may
be pivotal to the formation of extrafollicular short-lived plasmablasts
secreting large amounts of IgM and IgG. In addition to eliciting CSR and
antibody production in MZ B cells, BAFF and APRIL would provide
survival signals to MZ B cell-derived plasmablasts, possibly through a
mechanism involving BAFF-R. By inducing rapid low-affinity antibody
Page 102
responses to TI antigens, the combination of these BAFF-APRILdependent pathways would enable MZ B cells to bridge the temporal gap
required for the induction of high-affinity IgG production by follicular B
cells50.
mTOR enhances TACI-TLR cooperation
The molecular mechanism underlying the cooperation between TACI and
TLRs pathways have been recently elucidated by our group65. BAFF and
APRIL elicit CSR by inducing the recruitment of MyD88 to a highly
conserved motif positioned in the intracellular domain of TACI. This
MyD88-binding motif is different from the canonical TIR motif of TLRs
and its position nearby a TRAF2-binding motif underscores the relevance
of MyD88 to the activation of NF-κB in MZ B cells65. As recently
published163, the cooperation between TACI and TLRs would further
entail their physical interaction. Indeed, we found that TACI interacted
with the cleaved (i.e., activated) form of TLR9 in B cells exposed to both
APRIL and CpG DNA163. Given that TLR9 becomes signaling-competent
following
protease-mediated
cleavage
in
a
MyD88-containing
215
endolysosomal compartment , cooperative TACI-TLR9 interaction and
signaling likely take place in the endolysosome following liganddependent endocytosis of TACI. Consistent with this possibility, the
cytoplasm of B cells displaying robust TACI signaling contains abundant
TACI-expressing vesicles.
By showing that TACI recruits mTOR via a rapamycin-sensitive
MyD88-dependent pathway, our findings add further complexity to the
signaling network underlying the cooperation between TACI and TLRs.
The kinase mTOR is a central regulator of cell metabolism, growth,
proliferation and survival. However, mTOR also has immunological
functions and indeed has been recently linked to the induction of IFN-α, a
key antiviral and immunoenhancing cytokine, by pDCs exposed to TLR9
Page 103
ligands195. In these studies, genetic deletion of mTOR or p70S6K through
RNA interference impaired the production of IFN-α by disrupting both
TLR9-MyD88 interaction and downstream IRF7 signaling. Additional
studies have recently shown that TLRs use an mTOR-dependent
rapamycin-sensitive pathway to stimulate the production of the antiinflammatory cytokine IL-10 by DCs, monocytes and macrophages216, 217.
The use of TLR-like signaling modules by TACI prompted us to
hypothesize that TACI recruits mTOR via MyD88. Consistent with this
possibility, we found that engagement of TACI by APRIL elicited mTOR,
4E-BP1, p70S6 kinase and S6 phosphorylation through a pathway that
was specifically inhibited by rapamycin. By using specific inhibitors, we
also found that TACI activates mTOR through a pathway involving PI3K
and Akt. These results clearly indicate that TACI delivers B cellstimulating signals by using a signaling complex that includes mTORC1.
More in general, these data suggest that TACI enhances MZ B cell
responses by linking immunological and metabolic pathways via mTOR.
Recent studies show that mTOR-regulated pathways controlling
nutrient sensing and metabolic stress act as crucial regulators of innate
immunity218
219
. While strong evidence supports the involvement of
mTOR in protection against infections198,
220-222
, it remains unclear how
microbial signals activate mTOR and whether microbes have evolved
mechanisms to evade mTOR-dependent immune responses. Our analysis
of TACI-mTOR interaction provides a molecular framework to better
understand the complex crosstalk between immunity and metabolism.
Molecular requirement of TACI-mTOR interaction
Our studies show that the mTOR inhibitor rapamycin severely mitigates
TACI signaling in MZ B cells. But does TACI physically interact with
mTOR? This is an important question, because previous studies have
provided little or no evidence of mTOR interaction with immune
Page 104
receptors,
including
TLRs.
By
performing
challenging
co-
immunoprecipitation studies, we obtained evidence that APRIL enhances
the association of TACI with MyD88, mTOR, IRAK-1, IRAK-4, and
TRAF2. Rapamycin, which is a specific mTORC1 inhibitor, attenuated
the recruitment of mTOR, MyD88 and TRAF2 but not IRAK1 and
IRAK4 to TACI. These findings suggest that the ternary mTORrapamycin-FKBP12 complex not only blocks the kinase activity of
mTOR, but also modifies the composition of the TACI signaling complex,
preventing the binding of MyD88, TRAF2 and mTOR to TACI.
By taking advantage of TACI deletion mutants selectively missing
specific functional domains, we found that TACI required its MyD88binding site, also known as THC domain, to interact with mTOR. This
evidence points to a pivotal role of MyD88 in the recruitment of mTOR
by TACI. Additional studies further defined the molecular requirements
for TACI-MyD88-mTOR interaction. These studies showed that MyD88
interacted with mTOR through the TIR domain, which is located in the Cterminal region of MyD88 and is responsible for the binding of MyD88 to
TLRs. The N-terminal death domain of MyD88, which accounts for the
binding of MyD88 to IRAK4 and the propagation of downstream signals,
was not involved in the interaction of MyD88 with mTOR.
Finally, we found that mTOR uses its central-terminal region to bind
MyD88. This region contains the FAT domain, which mediates the
binding of mTOR to DEPTOR, which is a negative regulator of mTOR in
both mTORC1 and mTORC2 complexes223. Importantly, DEPTOR
undergoes proteasome-dependent degradation in the presence of signals
that lead to the activation of mTOR224. When exposed to APRIL, B cells
did not degrade DEPTOR (not shown), suggesting that the formation of
the TACI-MyD88-mTOR complex simply displaces DEPTOR from
mTOR to induce mTORC1 activation. Co-immunoprecipitation studies
failed to evidence the presence of DEPTOR in the TACI signaling
Page 105
complex, but this negative result could be due to technical reasons. Thus,
further studies, including site-directed mutagenesis, will be necessary to
define the precise composition and regulation of the TACI-MyD88mTOR complex.
A recent work has characterized a S231R substitution in the THC
motif of TACI from B cells of a patient with CVID, which is a primary
immunodeficiency characterized by impaired antibody production225. The
S231R substitution prevents the recruitment of MyD88 to TACI in
response to APRIL, but its role in the recruitment of mTOR by TACI
remains unknown. In future collaborative studies, we will take advantage
of B cells from this CVID patient to further define the function of the
TACI-MyD88-mTOR complex in B cell antibody production.
Role of mTOR in TACI-mediated NF-κB activation
TACI recruits TRAF2, TRAF6 and MyD88 adaptor proteins to induce
activation of the IKK complex and nuclear translocation of NF-κB65, a
transcription factor required for B cell proliferation, survival, CSR and
antibody production. We found that this canonical NF-κB pathway further
involved the recruitment and activation of mTOR by TACI. Indeed,
inhibition of mTOR by rapamycin or torin1 inhibited the activation of
IRAK-1, IRAK-4 and IKK, a kinase complex positioned downstream of
TRAF2, TRAF6 and MyD88. Inhibition of mTOR also caused reduced
TACI-dependent phosphorylation and degradation of IκBα, a cytoplasmic
inhibitor of NF-κB. This inhibitory effect prevented TACI-induced
nuclear translocation and DNA binding of NF-κB p65 and p50, two
canonical NF-κB proteins required for the expression of AID and the
induction of CSR. Accordingly, AID expression and CSR from IgM to
IgG decreased in MZ B cells stimulated through TACI.
Our findings in B cells are consistent with previously published
studies in malignant prostate cells lacking PTEN, a phosphatase and
Page 106
tumor suppressor that inhibits PI3K. These studies show that aberrant
PI3K-mediated mTOR activation dysregulate NF-κB activation by
causing interaction of mTOR with the IKK complex226. Along the same
lines, tumors lacking PTEN appear to exhibit increased sensitivity to
rapamycin227,
228
. In our study, mTOR amplified TACI-induced NF-κB
activation through a rapamycin-sensitive mechanism that involved the
formation of a TACI-MyD88-mTOR complex. Indeed, overexpression of
TSC1 and TSC2, two physiological inhibitors of mTOR, interfered with
the activation of NF-κB by TACI. A similar inhibitory effect followed the
overexpression of the C-terminal or central but not N-terminal regions of
mTOR. Owing to their ability to associate with TACI, the C-terminal and
central segments of mTOR may exert a dominant-negative effect by
preventing the recruitment of functionally intact mTOR to TACI (Fig.
25). Should this be the case, the activation of NF-κB by TACI may be
highly dependent on the N-terminal region of mTOR.
Figure 25. The N-terminal region of mTOR is required for the activation of
NF-κB by TACI. (A,B) Co-transfection of 293 cells with plasmids encoding
TACI and full-length or N-terminal mTOR is followed by the formation of a
ternary TACI-MyD88-mTOR complex that activates NF-κB. (C,D) Cotransfection of 293 cells with plasmids encoding TACI and either central or Cterminal regions of mTOR interferes with the activation of NF-κB by TACI,
possibly because the central and C-terminal regions of mTOR displace intact
endogenous mTOR from the ternary TACI-MyD88-mTOR complex.
Role of mTOR in TACI-induced CSR and antibody production
Published studies indicate that engagement of TACI on MZ B cells by
BAFF and APRIL triggers the induction of IgM as well as class-switched
Page 107
Ig to inducing B cell prolG and IgA responses against TI antigens65. This
pathway receives reinforcing signals from CpG DNA, which up-regulates
TACI expression on MZ B cells. In agreement with these findings and
with the known pre-activated state of MZ B cells, we detected more
elevated expression of TACI and TLR9 in MZ B cells than follicular B
cells. Furthermore, we found that TACI and TLR9 synergistically
cooperate to induce antibody production, a process highly dependent on
NF-κB.
In addition to inducing B cell proliferation and survival, NF-κB elicits
the expression of AID, a DNA-editing enzyme required for the induction
of CSR from IgM to IgG or IgA65. By showing that TACI activated the
transcription factor CREB through a rapamycin-sensitive pathway, our
findings suggest that TACI finely tunes canonical NF-κB signals via
mTOR. Indeed, published works show that the transcriptional activation
of several NF-κB-responsive genes involves the interaction of NF-κB with
CREB co-activators, including CREB binding protein (CBP) and p300229,
230
. Among other effects, these proteins enhance the acetylation of NF-κB
(namely p65), which stabilizes the binding of NF-κB to DNA202, 203.
However, the NF-κB region that binds CBP and p300 also interacts
with CREB. Given that CREB attenuates NF-κB-dependent gene
activation by competing with CBP and p300 for binding to NF-κB231, 232,
TACI may activate CREB via mTOR to restrain NF-κB-mediated gene
transcription. Should this be the case, TACI may use mTOR to establish
both positive (at the level of IKK) and negative (at the level of CBP/p300)
checkpoints along the antibody-inducing NF-κB signaling pathway.
By up-regulating AID expression as well as germline Cγ and Cα
transcription via NF-κB, mTOR enhanced the induction of IgG and IgA
CSR in MZ B cells activated via TACI. Indeed, when exposed to APRIL
in the presence of rapamycin, MZ B cells contained less abundant
hallmarks of ongoing IgG and IgA CSR, including AID transcripts,
Page 108
germline transcripts and switch circle transcripts. Besides helping TACImediated CSR through the induction of AID, mTOR might contribute to
the post-translational modifications required for the DNA-editing function
of
AID,
including
AID
oligomerization,
nuclear-cytoplasmic
translocation, phosphorylation and polyubiquitination233. Consistent with
this possibility, mTOR is known to establish a functional interplay with
protein kinase A (PKA), an enzyme required for AID function. Indeed,
PKA phosphorylates AID at a serine residue involved in the recruitment
of replication protein A (RPA), an AID co-factor required for the binding
of AID to actively transcribed S regions234.
Notably,
AID
expression
positively
correlates
with
B
cell
proliferation235. Accordingly, our data show that TACI used mTOR to
induce some cell cycle-related gene products, including cyclin D1 and
p38. Both these proteins are also involved in the induction of B cell
proliferation by CD40236. Despite increasing cyclin D1 expression and p38
activation in a mTOR-dependent manner, TACI was not sufficient to
trigger significant proliferation of MZ B cells. However, in the presence
of TLR9 co-signals, TACI engagement by APRIL not only induced
substantial B cell proliferation, but also triggered plasma cell
differentiation as well as IgM, IgG and IgA secretion in a rapamycinsensitive manner. The mechanism whereby mTOR facilitates these
synergistic effects remains to be elucidated. Following ligation-mediated
endocytosis of TACI, MyD88 may recruit mTOR to form a molecular
bridge that physically and functionally links TACI with TLR9. Consistent
with this possibility, we recently found that TACI co-localizes with
cleaved (i.e., active) TLR9 in a subcellular compartment of B cells coactivated by APRIL and CpG DNA.
Interestingly, mTOR-dependent signals from TACI and TLR9
induced not only IgG1, which is an IgG subclass that predominantly
targets protein antigens, but also IgG2 (data not shown), which is an IgG
Page 109
subclass that predominantly targets polysaccharide antigens. However,
IgG2 induction was mostly limited to MZ rather than follicular B cells.
This finding points to the involvement of TACI and mTOR in IgG2
responses to polysaccharide-containing bacteria, including Streptococcus
pneumoniae.
This pathogen is developing increasing resistance to
penicillins or macrolides and some of its strains are partially or totally
resistant to multiple classes of antibiotics. Due to this problem, there is an
urgent need for more efficacious vaccines. Our findings indicate that
polysaccharide-containing vaccines capable to stimulate the TACI-mTOR
axis may ameliorate protective IgM and IgG2 responses by MZ B cells.
Clinical implications
Rapamycin is usually considered an immunosuppressing and ntiproliferative drug that predominantly inhibits T cells. Indeed, rapamycin
is being used as an immunosuppressive agent in transplants recipients237.
Rapamycin is also used as an anti-proliferative agent in certain cancers
and cardiological disorders, including aortic stenosis237. By showing that
mTOR contributes to the activation of B cells via TACI, our findings
indicate that rapamycin could also have beneficial effects in B cell
disorders. In agreement with this possibility, a recently published study
indicates that rapamycin ameliorates antiviral responses by B cells.
Indeed, treatment with rapamycin during primary infection with
influenza virus H3N2 protected mice against a lethal, heterosubtypic,
secondary infection with H5N1, H7N9 or H1N1198. In this setting,
rapamycin impaired IgG class switching and decreased the frequency of
antibodies reactive against specific viral epitopes, while increasing the
frequency of antibodies reactive against conserved neutralizing epitopes.
Combined, these effects yielded a unique broadly reactive antibody
repertoire that generated heterosubtypic protection198. Thus, rapamycin
may help to develop a “universal” vaccine against influenza.
Page 110
Rapamycin could also be utilized to restrain the growth of B cell
tumors such as chronic lymphocytic leukaemia (CLL), non-Hodgkin
lymphoma, Waldenstrom macroglobulinemia and multiple myeloma. In
these lymphoid cancers, the serum levels of BAFF and APRIL are
increased238. In addition, malignant B cells express TACI, which
stimulates neoplastic B cell growth and survival by generating signals in
response to both autocrine and paracrine BAFF and APRIL239.
Rapamycin may also have a role in the therapy of autoimmune and
allergic disorders. In these inflammatory pathologies, the production of
BAFF is increased and appears to contribute to the expansion of
pathogenic B cells secreting pathogenic antibodies152,240, 241,242. In all these
clinical settings, there is an active effort to develop novel BAFF and
APRIL inhibitors. These inhibitors could be combined with existing drugs
to reduce their side effects while obtaining a superior therapeutic
advantage. Together with previous studies showing the involvement of
mTOR in the BAFF-R pathway, our finding that mTOR contributes to
TACI signaling strongly indicates that targeting of mTOR could be
beneficial for the treatment of B cell disorders associated with
dysregulated BAFF and APRIL production.
Page 111
Page 112
CHAPTER 6
CONCLUSIONS
Page 113
Page 114
CONCLUSIONS
In this study we found that:
•
TACI enhances the activation of splenic MZ B cells
through an mTOR pathway sensitive to rapamycin
•
TACI recruits mTOR through a mechanism involving the
adaptor protein MyD88
•
TACI, MyD88 and mTOR form a receptor complex
involving THC, TIR and FAT motifs, respectively
•
TACI activates mTOR in the context of a PI3K-AKTmTORC1 signaling pathway
•
TACI activates mTOR to enhance signaling via a
downstream IRAK1-IRAK4-IKK-NF-κB pathway
•
TACI activates mTOR to enhance NF-κB-dependent CSR
•
TACI activates mTOR to enhance BLIMP-1-dependent
plasma cell differentiation and antibody production
Page 115
Figure 26. Model of TACI signaling through mTOR. Engagement of TACI on
MZ B cells by APRIL recruits mTOR through a mechanism involving interaction
of the FAT domain of mTOR with the TIR domain of MyD88. The ID domain of
MyD88 further interacts with the THC motif of TACI, thereby generating a
TACI-MyD88-mTOR signaling complex. In this complex, mTOR is positively
regulated by signals from PI3K and AKT, which remove the inhibitory activity of
the TSC-1-TSC-2 complex on mTOR. The resulting activation of mTOR causes
induction of a canonical mTORC1 pathway involving phosphoylation of 4E-BP1,
p70S6K and S6 substrates. Furthermore, mTOR enhances the activation of
IRAK-1 and IRAK-4, two kinases associated with MyD88 and functionally
linked to the IKK complex. Thus, activated mTOR also enhances the activation of
IKK, thereby inducing nuclear translocation of NF-κB, including p50-p65 dimers.
Induction of NF-κB-responsive genes triggers B cell proliferation, AIDdependent CSR, and antibody production. The latter involves plasma cell
differentiation, the induction of which may involve additional mTOR-activated
Page 116
transcription factors, including BLIMP-1, STAT5 and CREB. Of note, TACI
induces MZ B cell proliferation and antibody production in cooperation with
TLR9, a CpG receptor located in endosomes. In the presence of CpG DNA,
TLR9 traffics into endolysosomes and undergoes proteolytic cleavage to signal
via MyD88 and mTOR. This process is associated with physical interaction of
truncated (i.e., active) TLR9 with TACI, which may facilitate the formation of a
shared MyD88-mTOR-IRAK signaling complex.
Page 117
Page 118
PUBLICATIONS
Original Articles
•
Gutzeit C, Nagy N, Gentile M, Lyberg K, Gumz J, Vallhov H,
Klein E, Gabrielsson S, Cerutti A, and Annika Scheynius.
Burkitt´s lymphoma cell lines induce proliferation, differentiation
and class switch recombination in B cells
Journal of Immunology, 192, 5852-5862 (2014).
•
Magri G, Miyajima M, Bascones S, Mortha A, Puga I, Cassis L,
Barra CM, Comerma L, Chudnovskiy A, Gentile M, Llige D,
Cols M, Serrano S, Aróstegui JI, Juan M, Yagüe J, Merad M,
Fagarasan S, Cerutti A. Innate lymphoid cells integrate stromal
and immunological signals to enhance antibody production by
splenic marginal zone B cells.
Nature Immunology, 15, 354-364 (2014).
•
Shan M, Gentile M, John R. Walland Y, Bomstein V, Kang, Chen
K, He B, Cassis L, Bigas A, Cols M, Comerma L, Blander M,
Xiong X, Meyer L, Berin C, Augenlicht L, Velchic A, Cerutti A.
Mucus Imprints Intestinal Dendritic Cells with Tolerogeni
Properties
Science, 342, 447-453 (2013).
•
Romberg N, Nicolas C, Saadoun D, Gentile M, Kinnunen T,
Shing NY, Virdee M, Menard L, Cantaert T, Morbach H, Rachid
R, Martinez-Pomar N, Matamoros N, Geha R, Grimbacher B,
Cerutti A, Cunningham-Rundles C, Meffre E. TACI mutations
associated with CVID affect autoreactive B-cell selection and
activation
Journal Clinical Investigation, 123, 4283-4293 (2013).
•
Melchers M, Bontjer I, Tong T, Chung NP, Klasse PJ, Eggink D,
Montefiori DC, Gentile M, Cerutti A, Olson WC, Berkhout B,
Binley JM, Moore JP, Sanders RW. Targeting HIV-1 envelope
glycoprotein trimers to B cells by using APRIL inproves antibody
responses. Journal of Virology, 86, 2488-2500 (2012).
•
Puga I, Cols M, Barra CM, He B, Cassis L, Gentile M, Comerma
L, Chorny A, Shan M, Xu W, Magri G, et al. B cell-helper
neutrophils stimulate the diversification and production of
immunoglobulin in the marginal zone of the spleen.
Nature Immunology, 13, 170-180 (2012).
Page 119
•
•
Calvayrac O, Rodríguez-Calvo R, Alonso J, Orbe J, MartínVentura JL, Guadall A, Gentile M, et al. CCL20 is increased in
hypercholesterolemic subjects and is upregulated by LDL in
vascular smooth muscle cells: role of NF-κB.
Arteriosclerosis Thrombosis and Vascular Biology, 31, 27332741 (2011).
•
Gentile M*, Martorell Ll*, Rius J, Rodríguez C, Badimon L,
Martínez-González J. The HIF-NOR1 axis regulates the survival
response of endothelial cells to hypoxia.
Molecular Cell Biology, 29, 5828-5842 (2009).
•
Martorell Ll, Martínez-González J, Rodríguez C, Gentile M,
Calvayrac O, Badimon L. Thrombin and protease-activated receptors
(PARs) in atherothrombosis.
Journal of Thrombosis and Haemostasis, 99, 305-315 (2008).
•
Martorell Ll, Rodríguez C, Calvayrac O, Gentile M, Badimon L,
Martínez-González J. Vascular effects of thrombin: involvement of
NOR-1 in thrombin-induced mitogenic stimulus in vascular cells.
Frontiers in Bioscience, 13, 2909-2915 (2008).
Reviews
•
Cerutti A, Cols M, Gentile M, Cassis L, Barra CM, He B, Puga I,
Chen K. Regulation of mucosal IgA responses: lessons from primary
immunodeficiencies.
Annals of New York Academy of Science 2011, 1238, 132-144
(2011).
Books
•
Cerutti A, Magri G, Cols M, Cassis L, Gutzeit C, Chorny A, Gentile
M, Barra CM and Puga I.The Immune System. Knowles’ Neoplastic
Hematopathology.
Wolters Kluwer Health Editorial, 2012.
Page 120
References
1.
Janeway, C.A., Jr. Approaching the asymptote? Evolution and
revolution in immunology. Cold Spring Harb Symp Quant Biol 54
Pt 1, 1-13 (1989).
2.
Janeway, C.A., Jr. & Medzhitov, R. Innate immune recognition.
Annu Rev Immunol 20, 197-216 (2002).
3.
Hoebe, K., Janssen, E. & Beutler, B. The interface between innate
and adaptive immunity. Nat Immunol 5, 971-974 (2004).
4.
Cooper, M.D. & Alder, M.N. The evolution of adaptive immune
systems. Cell 124, 815-822 (2006).
5.
Janeway, C.A., Jr. The immune system evolved to discriminate
infectious nonself from noninfectious self. Immunol Today 13, 1116 (1992).
6.
Fearon, D.T. & Locksley, R.M. The instructive role of innate
immunity in the acquired immune response. Science 272, 50-53
(1996).
7.
Iwasaki, A. & Medzhitov, R. Regulation of adaptive immunity by
the innate immune system. Science 327, 291-295 (2010).
8.
Macpherson, A.J. & Harris, N.L. Interactions between commensal
intestinal bacteria and the immune system. Nat Rev Immunol 4,
478-485 (2004).
9.
Bottazzi, B., Doni, A., Garlanda, C. & Mantovani, A. An
integrated view of humoral innate immunity: pentraxins as a
paradigm. Annu Rev Immunol 28, 157-183 (2010).
10.
Kufer, T.A., Fritz, J.H. & Philpott, D.J. NACHT-LRR proteins
(NLRs) in bacterial infection and immunity. Trends Microbiol 13,
381-388 (2005).
11.
Martinon, F., Mayor, A. & Tschopp, J. The inflammasomes:
guardians of the body. Annu Rev Immunol 27, 229-265 (2009).
Page 121
12.
Rehwinkel, J. & Reis e Sousa, C. RIGorous detection: exposing
virus through RNA sensing. Science 327, 284-286 (2010).
13.
Geijtenbeek, T.B. & Gringhuis, S.I. Signalling through C-type
lectin receptors: shaping immune responses. Nat Rev Immunol 9,
465-479 (2009).
14.
Kawai, T. & Akira, S. Toll-like receptors and their crosstalk with
other innate receptors in infection and immunity. Immunity 34,
637-650 (2011).
15.
Botos, I., Segal, D.M. & Davies, D.R. The structural biology of
Toll-like receptors. Structure 19, 447-459 (2011).
16.
Palm, N.W. & Medzhitov, R. Pattern recognition receptors and
control of adaptive immunity. Immunol Rev 227, 221-233 (2009).
17.
Aderem, A. & Ulevitch, R.J. Toll-like receptors in the induction
of the innate immune response. Nature 406, 782-787 (2000).
18.
Sansonetti, P.J. The innate signaling of dangers and the dangers of
innate signaling. Nat Immunol 7, 1237-1242 (2006).
19.
Borregaard, N. Neutrophils, from marrow to microbes. Immunity
33, 657-670 (2010).
20.
Caligiuri, M.A. Human natural killer cells. Blood 112, 461-469
(2008).
21.
Serbina, N.V., Jia, T., Hohl, T.M. & Pamer, E.G. Monocytemediated defense against microbial pathogens. Annu Rev Immunol
26, 421-452 (2008).
22.
Geissmann, F. et al. Development of monocytes, macrophages,
and dendritic cells. Science 327, 656-661 (2010).
23.
Adams, D.O. & Hamilton, T.A. The cell biology of macrophage
activation. Annu Rev Immunol 2, 283-318 (1984).
24.
Sallusto, F. & Lanzavecchia, A. The instructive role of dendritic
cells on T-cell responses. Arthritis Res 4 Suppl 3, S127-132
(2002).
Page 122
25.
Steinman, R.M. & Hemmi, H. Dendritic cells: translating innate
to adaptive immunity. Curr Top Microbiol Immunol 311, 17-58
(2006).
26.
Hashimoto, D., Miller, J. & Merad, M. Dendritic cell and
macrophage heterogeneity in vivo. Immunity 35, 323-335 (2011).
27.
Kita, H. Eosinophils: multifaceted biological properties and roles
in health and disease. Immunol Rev 242, 161-177 (2011).
28.
Pulendran, B. Modulating TH1/TH2 responses with microbes,
dendritic cells, and pathogen recognition receptors. Immunol Res
29, 187-196 (2004).
29.
Kool, M., Hammad, H. & Lambrecht, B.N. Cellular networks
controlling Th2 polarization in allergy and immunity. F1000 Biol
Rep 4, 6 (2012).
30.
Sleckman, B.P. et al. Accessibility control of variable region gene
assembly during T-cell development. Immunol Rev 165, 121-130
(1998).
31.
Ehlich, A. & Kuppers, R. Analysis of immunoglobulin gene
rearrangements in single B cells. Curr Opin Immunol 7, 281-284
(1995).
32.
Cornall, R.J., Goodnow, C.C. & Cyster, J.G. The regulation of
self-reactive B cells. Curr Opin Immunol 7, 804-811 (1995).
33.
Zerrahn, J., Held, W. & Raulet, D.H. The MHC reactivity of the T
cell repertoire prior to positive and negative selection. Cell 88,
627-636 (1997).
34.
Zhang, J., Liu, Y.J., MacLennan, I.C., Gray, D. & Lane, P.J. B
cell memory to thymus-independent antigens type 1 and type 2:
the role of lipopolysaccharide in B memory induction. Eur J
Immunol 18, 1417-1424 (1988).
35.
Janeway, C.A., Jr., Ron, J. & Katz, M.E. The B cell is the
initiating antigen-presenting cell in peripheral lymph nodes. J
Immunol 138, 1051-1055 (1987).
Page 123
36.
von Boehmer, H. & Melchers, F. Checkpoints in lymphocyte
development and autoimmune disease. Nat Immunol 11, 14-20
(2010).
37.
Orkin, S.H. & Zon, L.I. Hematopoiesis: an evolving paradigm for
stem cell biology. Cell 132, 631-644 (2008).
38.
Cooper, M.D., Raymond, D.A., Peterson, R.D., South, M.A. &
Good, R.A. The functions of the thymus system and the bursa
system in the chicken. J Exp Med 123, 75-102 (1966).
39.
Alt, F.W., Blackwell, T.K. & Yancopoulos, G.D. Development of
the primary antibody repertoire. Science 238, 1079-1087 (1987).
40.
LeBien, T.W. & Tedder, T.F. B lymphocytes: how they develop
and function. Blood 112, 1570-1580 (2008).
41.
Kondo, M. et al. Biology of hematopoietic stem cells and
progenitors: implications for clinical application. Annu Rev
Immunol 21, 759-806 (2003).
42.
Busslinger, M. Transcriptional control of early
development. Annu Rev Immunol 22, 55-79 (2004).
43.
Oettinger, M.A., Schatz, D.G., Gorka, C. & Baltimore, D. RAG-1
and RAG-2, adjacent genes that synergistically activate V(D)J
recombination. Science 248, 1517-1523 (1990).
44.
Schwarz, K. et al. RAG mutations in human B cell-negative
SCID. Science 274, 97-99 (1996).
45.
Yancopoulos, G.D. & Alt, F.W. Developmentally controlled and
tissue-specific expression of unrearranged VH gene segments.
Cell 40, 271-281 (1985).
46.
Lewis, S.M. The mechanism of V(D)J joining: lessons from
molecular, immunological, and comparative analyses. Adv
Immunol 56, 27-150 (1994).
47.
Herzog, S., Reth, M. & Jumaa, H. Regulation of B-cell
proliferation and differentiation by pre-B-cell receptor signalling.
Nat Rev Immunol 9, 195-205 (2009).
Page 124
B
cell
48.
Chen, K. & Cerutti, A. The function and regulation of
immunoglobulin D. Curr Opin Immunol 23, 345-352 (2011).
49.
Honjo, T., Kinoshita, K. & Muramatsu, M. Molecular mechanism
of class switch recombination: linkage with somatic
hypermutation. Annu Rev Immunol 20, 165-196 (2002).
50.
Pone, E.J. et al. BCR-signalling synergizes with TLR-signalling
for induction of AID and immunoglobulin class-switching
through the non-canonical NF-kappaB pathway. Nat Commun 3,
767 (2012).
51.
Cerutti, A. et al. CD40 ligand and appropriate cytokines induce
switching to IgG, IgA, and IgE and coordinated germinal center
and plasmacytoid phenotypic differentiation in a human
monoclonal IgM+IgD+ B cell line. J Immunol 160, 2145-2157
(1998).
52.
Weller, S. et al. Human blood IgM "memory" B cells are
circulating splenic marginal zone B cells harboring a
prediversified immunoglobulin repertoire. Blood 104, 3647-3654
(2004).
53.
William, J., Euler, C., Christensen, S. & Shlomchik, M.J.
Evolution of autoantibody responses via somatic hypermutation
outside of germinal centers. Science 297, 2066-2070 (2002).
54.
Stavnezer, J., Guikema, J.E. & Schrader, C.E. Mechanism and
regulation of class switch recombination. Annu Rev Immunol 26,
261-292 (2008).
55.
Wagner, S.D. & Neuberger, M.S. Somatic hypermutation of
immunoglobulin genes. Annu Rev Immunol 14, 441-457 (1996).
56.
Rajewsky, K., Forster, I. & Cumano, A. Evolutionary and somatic
selection of the antibody repertoire in the mouse. Science 238,
1088-1094 (1987).
57.
Di Noia, J.M. & Neuberger, M.S. Molecular mechanisms of
antibody somatic hypermutation. Annu Rev Biochem 76, 1-22
(2007).
Page 125
58.
Odegard, V.H. & Schatz, D.G. Targeting of
hypermutation. Nat Rev Immunol 6, 573-583 (2006).
59.
Pasqualucci, L. et al. BCL-6 mutations in normal germinal center
B cells: evidence of somatic hypermutation acting outside Ig loci.
Proc Natl Acad Sci U S A 95, 11816-11821 (1998).
60.
Muschen, M. et al. Rare occurrence of classical Hodgkin's disease
as a T cell lymphoma. J Exp Med 191, 387-394 (2000).
61.
Pasqualucci, L. et al. Hypermutation of multiple proto-oncogenes
in B-cell diffuse large-cell lymphomas. Nature 412, 341-346
(2001).
62.
Stavnezer, J. Antibody class switching. Adv Immunol 61, 79-146
(1996).
63.
Kehry, M. et al. The immunoglobulin mu chains of membranebound and secreted IgM molecules differ in their C-terminal
segments. Cell 21, 393-406 (1980).
64.
Chen, K. & Cerutti, A. New insights into the enigma of
immunoglobulin D. Immunol Rev 237, 160-179 (2010).
65.
He, B. et al. The transmembrane activator TACI triggers
immunoglobulin class switching by activating B cells through the
adaptor MyD88. Nat Immunol 11, 836-845 (2010).
66.
Ravetch, J.V. & Bolland, S. IgG Fc receptors. Annu Rev Immunol
19, 275-290 (2001).
67.
Nimmerjahn, F. & Ravetch, J.V. Fc[gamma] receptors as
regulators of immune responses. Nat Rev Immunol 8, 34-47
(2008).
68.
Cerutti, A. The regulation of IgA class switching. Nat Rev
Immunol 8, 421-434 (2008).
69.
Fagarasan, S., Kawamoto, S., Kanagawa, O. & Suzuki, K.
Adaptive immune regulation in the gut: T cell-dependent and T
cell-independent IgA synthesis. Annu Rev Immunol 28, 243-273
(2010).
Page 126
somatic
70.
Macpherson, A.J., McCoy, K.D., Johansen, F.E. & Brandtzaeg, P.
The immune geography of IgA induction and function. Mucosal
Immunol 1, 11-22 (2008).
71.
Monteiro, R.C. & Van De Winkel, J.G. IgA Fc receptors. Annu
Rev Immunol 21, 177-204 (2003).
72.
van Egmond, M. et al. IgA and the IgA Fc receptor. Trends
Immunol 22, 205-211 (2001).
73.
Geha, R.S., Jabara, H.H. & Brodeur, S.R. The regulation of
immunoglobulin E class-switch recombination. Nat Rev Immunol
3, 721-732 (2003).
74.
MacGlashan, D., Jr. IgE receptor and signal transduction in mast
cells and basophils. Curr Opin Immunol 20, 717-723 (2008).
75.
Kinet, J.P. The high-affinity IgE receptor (Fc epsilon RI): from
physiology to pathology. Annu Rev Immunol 17, 931-972 (1999).
76.
Gould, H.J. & Sutton, B.J. IgE in allergy and asthma today. Nat
Rev Immunol 8, 205-217 (2008).
77.
Hagan, P. IgE and protective immunity to helminth infections.
Parasite Immunol 15, 1-4 (1993).
78.
Burton, O.T. & Oettgen, H.C. Beyond immediate
hypersensitivity: evolving roles for IgE antibodies in immune
homeostasis and allergic diseases. Immunol Rev 242, 128-143
(2011).
79.
Kawakami, T. & Kitaura, J. Mast cell survival and activation by
IgE in the absence of antigen: a consideration of the biologic
mechanisms and relevance. J Immunol 175, 4167-4173 (2005).
80.
Gauchat, J.F. et al. Induction of human IgE synthesis in B cells by
mast cells and basophils. Nature 365, 340-343 (1993).
81.
Acharya, M. et al. CD23/FcepsilonRII: molecular multi-tasking.
Clin Exp Immunol 162, 12-23 (2010).
82.
Pape, K.A., Catron, D.M., Itano, A.A. & Jenkins, M.K. The
humoral immune response is initiated in lymph nodes by B cells
Page 127
that acquire soluble antigen directly in the follicles. Immunity 26,
491-502 (2007).
83.
Qi, H., Egen, J.G., Huang, A.Y. & Germain, R.N. Extrafollicular
activation of lymph node B cells by antigen-bearing dendritic
cells. Science 312, 1672-1676 (2006).
84.
Tew, J.G., Phipps, R.P. & Mandel, T.E. The maintenance and
regulation of the humoral immune response: persisting antigen
and the role of follicular antigen-binding dendritic cells as
accessory cells. Immunol Rev 53, 175-201 (1980).
85.
Phan, T.G., Grigorova, I., Okada, T. & Cyster, J.G. Subcapsular
encounter and complement-dependent transport of immune
complexes by lymph node B cells. Nat Immunol 8, 992-1000
(2007).
86.
Youd, M.E., Ferguson, A.R. & Corley, R.B. Synergistic roles of
IgM and complement in antigen trapping and follicular
localization. Eur J Immunol 32, 2328-2337 (2002).
87.
Ferguson, A.R., Youd, M.E. & Corley, R.B. Marginal zone B
cells transport and deposit IgM-containing immune complexes
onto follicular dendritic cells. Int Immunol 16, 1411-1422 (2004).
88.
Sonoda, K.H. & Stein-Streilein, J. CD1d on antigen-transporting
APC and splenic marginal zone B cells promotes NKT celldependent tolerance. Eur J Immunol 32, 848-857 (2002).
89.
Lankar, D. et al. Dynamics of major histocompatibility complex
class II compartments during B cell receptor-mediated cell
activation. J Exp Med 195, 461-472 (2002).
90.
Garside, P. et al. Visualization of specific B and T lymphocyte
interactions in the lymph node. Science 281, 96-99 (1998).
91.
Okada, T. et al. Antigen-engaged B cells undergo chemotaxis
toward the T zone and form motile conjugates with helper T cells.
PLoS Biol 3, e150 (2005).
92.
Fazilleau, N., Mark, L., McHeyzer-Williams, L.J. & McHeyzerWilliams, M.G. Follicular helper T cells: lineage and location.
Immunity 30, 324-335 (2009).
Page 128
93.
MacLennan, I.C. et al. Extrafollicular antibody responses.
Immunol Rev 194, 8-18 (2003).
94.
Cyster, J.G. B cell follicles and antigen encounters of the third
kind. Nat Immunol 11, 989-996 (2010).
95.
Crotty, S. Follicular helper CD4 T cells (TFH). Annu Rev
Immunol 29, 621-663 (2011).
96.
Vinuesa, C.G., Tangye, S.G., Moser, B. & Mackay, C.R.
Follicular B helper T cells in antibody responses and
autoimmunity. Nat Rev Immunol 5, 853-865 (2005).
97.
Cannons, J.L. et al. Optimal germinal center responses require a
multistage T cell:B cell adhesion process involving integrins,
SLAM-associated protein, and CD84. Immunity 32, 253-265
(2010).
98.
Victora, G.D. & Nussenzweig, M.C. Germinal centers. Annu Rev
Immunol 30, 429-457 (2012).
99.
Shapiro-Shelef, M. et al. Blimp-1 is required for the formation of
immunoglobulin secreting plasma cells and pre-plasma memory B
cells. Immunity 19, 607-620 (2003).
100.
Calame, K.L., Lin, K.-I. & Tunyaplin, C. Regulatory mechanisms
that determine the development and function of plasma cells.
Annu Rev Immunol 21, 205-230 (2003).
101.
Ye, B.H. et al. Alterations of a zinc finger-encoding gene, BCL-6,
in diffuse large-cell lymphoma. Science 262, 747-750 (1993).
102.
Dent, A.L., Shaffer, A.L., Yu, X., Allman, D. & Staudt, L.M.
Control of inflammation, cytokine expression, and germinal
center formation by BCL-6. Science 276, 589-592 (1997).
103.
Ye, B.H. et al. The BCL-6 proto-oncogene controls germinalcentre formation and Th2-type inflammation. Nat Genet 16, 161170 (1997).
104.
Turner, C.A., Jr., Mack, D.H. & Davis, M.M. Blimp-1, a novel
zinc finger-containing protein that can drive the maturation of B
Page 129
lymphocytes into immunoglobulin-secreting cells. Cell 77, 297306 (1994).
105.
Chu, V.T. et al. Eosinophils are required for the maintenance of
plasma cells in the bone marrow. Nat Immunol 12, 151-159
(2011).
106.
Dogan, I. et al. Multiple layers of B cell memory with different
effector functions. Nat Immunol 10, 1292-1299 (2009).
107.
Blink, E.J. et al. Early appearance of germinal center-derived
memory B cells and plasma cells in blood after primary
immunization. J Exp Med 201, 545-554 (2005).
108.
Tarlinton, D. B-cell memory: are subsets necessary? Nat Rev
Immunol 6, 785-790 (2006).
109.
Cerutti, A., Cols, M. & Puga, I. Activation of B cells by noncanonical helper signals. EMBO Rep 13, 798-810 (2012).
110.
Chang, P.P. et al. Identification of Bcl-6-dependent follicular
helper NKT cells that provide cognate help for B cell responses.
Nat Immunol 13, 35-43 (2012).
111.
Weill, J.C., Weller, S. & Reynaud, C.A. Human marginal zone B
cells. Annu Rev Immunol 27, 267-285 (2009).
112.
Baumgarth, N. The double life of a B-1 cell: self-reactivity selects
for protective effector functions. Nat Rev Immunol 11, 34-46
(2011).
113.
Magri, G. et al. Innate lymphoid cells integrate stromal and
immunological signals to enhance antibody production by splenic
marginal zone B cells. Nat Immunol 15, 354-364 (2014).
114.
Cerutti, A., Puga, I. & Cols, M. Innate control of B cell responses.
Trends Immunol 32, 202-211 (2011).
115.
Chorny, A. & Cerutti, A. A gut triumvirate rules homeostasis. Nat
Med 17, 1549-1550 (2011).
116.
Covens, K. et al. Characterization of proposed human B-1 cells
reveals pre-plasmablast phenotype. Blood 121, 5176-5183 (2013).
Page 130
117.
Puga, I. et al. B cell-helper neutrophils stimulate the
diversification and production of immunoglobulin in the marginal
zone of the spleen. Nat Immunol 13, 170-180 (2012).
118.
Lesinski, G.B. & Westerink, M.A. Novel vaccine strategies to Tindependent antigens. J Microbiol Methods 47, 135-149 (2001).
119.
Mond, J.J., Lees, A. & Snapper, C.M. T cell-independent antigens
type 2. Annu Rev Immunol 13, 655-692 (1995).
120.
Cinamon, G., Zachariah, M.A., Lam, O.M., Foss, F.W., Jr. &
Cyster, J.G. Follicular shuttling of marginal zone B cells
facilitates antigen transport. Nat Immunol 9, 54-62 (2008).
121.
Song, H. & Cerny, J. Functional heterogeneity of marginal zone B
cells revealed by their ability to generate both early antibodyforming cells and germinal centers with hypermutation and
memory in response to a T-dependent antigen. J Exp Med 198,
1923-1935 (2003).
122.
Kraal, G. & Mebius, R. New insights into the cell biology of the
marginal zone of the spleen. Int Rev Cytol 250, 175-215 (2006).
123.
Mebius, R.E. & Kraal, G. Structure and function of the spleen.
Nat Rev Immunol 5, 606-616 (2005).
124.
Steiniger, B., Timphus, E.M. & Barth, P.J. The splenic marginal
zone in humans and rodents: an enigmatic compartment and its
inhabitants. Histochem Cell Biol 126, 641-648 (2006).
125.
Likhite, V.V. Immunological impairment and susceptibility to
infection after splenectomy. JAMA 236, 1376-1377 (1976).
126.
Cowan, M.J. et al. Pneumococcal polysaccharide immunization in
infants and children. Pediatrics 62, 721-727 (1978).
127.
Kruetzmann, S. et al. Human immunoglobulin M memory B cells
controlling Streptococcus pneumoniae infections are generated in
the spleen. J Exp Med 197, 939-945 (2003).
128.
Carsetti, R., Pantosti, A. & Quinti, I. Impairment of the
antipolysaccharide response in splenectomized patients is due to
Page 131
the lack of immunoglobulin M memory B cells. J Infect Dis 193,
1189-1190 (2006).
129.
Okumoto, K. et al. Differentiation of bone marrow cells into cells
that express liver-specific genes in vitro: implication of the Notch
signals in differentiation. Biochem Biophys Res Commun 304,
691-695 (2003).
130.
Tanigaki, K. et al. Notch-RBP-J signaling is involved in cell fate
determination of marginal zone B cells. Nat Immunol 3, 443-450
(2002).
131.
Cerutti, A., Cols, M. & Puga, I. Marginal zone B cells: virtues of
innate-like antibody-producing lymphocytes. Nat Rev Immunol
13, 118-132 (2013).
132.
Spencer, J., Finn, T., Pulford, K.A., Mason, D.Y. & Isaacson,
P.G. The human gut contains a novel population of B
lymphocytes which resemble marginal zone cells. Clin Exp
Immunol 62, 607-612 (1985).
133.
Tierens, A., Delabie, J., Michiels, L., Vandenberghe, P. & De
Wolf-Peeters, C. Marginal-zone B cells in the human lymph node
and spleen show somatic hypermutations and display clonal
expansion. Blood 93, 226-234 (1999).
134.
Dono, M. et al. Heterogeneity of tonsillar subepithelial B
lymphocytes, the splenic marginal zone equivalents. J Immunol
164, 5596-5604 (2000).
135.
Martin, F., Oliver, A.M. & Kearney, J.F. Marginal zone and B1 B
cells unite in the early response against T-independent bloodborne particulate antigens. Immunity 14, 617-629 (2001).
136.
Balázs, M., Martin, F., Zhou, T. & Kearney, J.F. Blood Dendritic
cells interact with splenic marginal zone B cells to initiate Tindependent immune responses. Immunity 17, 341-352 (2002).
137.
Clarke, T.B. et al. Recognition of peptidoglycan from the
microbiota by Nod1 enhances systemic innate immunity. Nat Med
16, 228-231 (2010).
Page 132
138.
Kool, J. et al. Detection of intestinal flora-derived bacterial
antigen complexes in splenic macrophages of rats. J Histochem
Cytochem 42, 1435-1441 (1994).
139.
Bernasconi, N.L., Traggiai, E. & Lanzavecchia, A. Maintenance
of serological memory by polyclonal activation of human memory
B cells. Science 298, 2199-2202 (2002).
140.
Lande, R. et al. Neutrophils activate plasmacytoid dendritic cells
by releasing self-DNA-peptide complexes in systemic lupus
erythematosus. Sci Transl Med 3, 73ra19 (2011).
141.
Scapini, P. et al. G-CSF-stimulated neutrophils are a prominent
source of functional BLyS. J Exp Med 197, 297-302 (2003).
142.
Snapper, C.M. Mechanisms underlying in vivo polysaccharidespecific immunoglobulin responses to intact extracellular bacteria.
Ann N Y Acad Sci 1253, 92-101 (2012).
143.
Treml, L.S. et al. TLR stimulation modifies BLyS receptor
expression in follicular and marginal zone B cells. J Immunol 178,
7531-7539 (2007).
144.
Colino, J., Shen, Y. & Snapper, C.M. Dendritic cells pulsed with
intact Streptococcus pneumoniae elicit both protein- and
polysaccharide-specific immunoglobulin isotype responses in
vivo through distinct mechanisms. J Exp Med 195, 1-13 (2002).
145.
Cunningham, A.F. et al. Salmonella induces a switched antibody
response without germinal centers that impedes the extracellular
spread of infection. J Immunol 178, 6200-6207 (2007).
146.
Mazmanian, S.K., Liu, C.H., Tzianabos, A.O. & Kasper, D.L. An
immunomodulatory molecule of symbiotic bacteria directs
maturation of the host immune system. Cell 122, 107-118 (2005).
147.
Cobb, B.A., Wang, Q., Tzianabos, A.O. & Kasper, D.L.
Polysaccharide processing and presentation by the MHCII
pathway. Cell 117, 677-687 (2004).
148.
Attanavanich, K. & Kearney, J.F. Marginal zone, but not
follicular B cells, are potent activators of naive CD4 T cells. J
Immunol 172, 803-811 (2004).
Page 133
149.
Dillon, S.R., Gross, J.A., Ansell, S.M. & Novak, A.J. An APRIL
to remember: novel TNF ligands as therapeutic targets. Nat Rev
Drug Discov 5, 235-246 (2006).
150.
Li, X. et al. Immune opsonins modulate BLyS/BAFF release in a
receptor-specific fashion. J Immunol 181, 1012-1018 (2008).
151.
Liu, Y. et al. Ligand-receptor binding revealed by the TNF family
member TALL-1. Nature 423, 49-56 (2003).
152.
Mackay, F., Schneider, P., Rennert, P. & Browning, J. BAFF and
APRIL: a tutorial on B cell survival. Annu Rev Immunol 21, 231264 (2003).
153.
Schiemann, B. et al. An essential role for BAFF in the normal
development of B cells through a BCMA-independent pathway.
Science 293, 2111-2114 (2001).
154.
Ingold, K. et al. Identification of proteoglycans as the APRILspecific binding partners. J Exp Med 201, 1375-1383 (2005).
155.
Boule, M.W. et al. Toll-like receptor 9-dependent and independent
dendritic
cell
activation
by
chromatinimmunoglobulin G complexes. J Exp Med 199, 1631-1640
(2004).
156.
Darce, J.R., Arendt, B.K., Wu, X. & Jelinek, D.F. Regulated
expression of BAFF-binding receptors during human B cell
differentiation. J Immunol 179, 7276-7286 (2007).
157.
Ng, L.G. et al. B cell-activating factor belonging to the TNF
family (BAFF)-R is the principal BAFF receptor facilitating
BAFF costimulation of circulating T and B cells. J Immunol 173,
807-817 (2004).
158.
Crowley, J.E. et al. Homeostatic control of B lymphocyte subsets.
Immunol Res 42, 75-83 (2008).
159.
Scholz, J.L. et al. BLyS inhibition eliminates primary B cells but
leaves natural and acquired humoral immunity intact. Proc Natl
Acad Sci U S A 105, 15517-15522 (2008).
Page 134
160.
Castro, I. et al. B cell receptor-mediated sustained c-Rel
activation facilitates late transitional B cell survival through
control of B cell activating factor receptor and NF-kappaB2. J
Immunol 182, 7729-7737 (2009).
161.
Rothe, M., Pan, M.G., Henzel, W.J., Ayres, T.M. & Goeddel,
D.V. The TNFR2-TRAF signaling complex contains two novel
proteins related to baculoviral inhibitor of apoptosis proteins. Cell
83, 1243-1252 (1995).
162.
Bossen, C. & Schneider, P. BAFF, APRIL and their receptors:
structure, function and signaling. Semin Immunol 18, 263-275
(2006).
163.
Romberg, N. et al. CVID-associated TACI mutations affect
autoreactive B cell selection and activation. J Clin Invest 123,
4283-4293 (2013).
164.
Patke, A., Mecklenbrauker, I., Erdjument-Bromage, H., Tempst,
P. & Tarakhovsky, A. BAFF controls B cell metabolic fitness
through a PKC beta- and Akt-dependent mechanism. J Exp Med
203, 2551-2562 (2006).
165.
Woodland, R.T. et al. Multiple signaling pathways promote B
lymphocyte stimulator dependent B-cell growth and survival.
Blood 111, 750-760 (2008).
166.
Heitman, J., Movva, N.R., Hiestand, P.C. & Hall, M.N. FK 506binding protein proline rotamase is a target for the
immunosuppressive agent FK 506 in Saccharomyces cerevisiae.
Proc Natl Acad Sci U S A 88, 1948-1952 (1991).
167.
Sabatini, D.M., Erdjument-Bromage, H., Lui, M., Tempst, P. &
Snyder, S.H. RAFT1: a mammalian protein that binds to FKBP12
in a rapamycin-dependent fashion and is homologous to yeast
TORs. Cell 78, 35-43 (1994).
168.
Sabers, C.J. et al. Isolation of a protein target of the FKBP12rapamycin complex in mammalian cells. J Biol Chem 270, 815822 (1995).
169.
Sabatini, D.M. mTOR and cancer: insights into a complex
relationship. Nat Rev Cancer 6, 729-734 (2006).
Page 135
170.
Goberdhan, D.C. & Boyd, C.A. mTOR: dissecting regulation and
mechanism of action to understand human disease. Biochem Soc
Trans 37, 213-216 (2009).
171.
Harris, T.E. & Lawrence, J.C., Jr. TOR signaling. Sci STKE 2003,
re15 (2003).
172.
Yang, Q. & Guan, K.L. Expanding mTOR signaling. Cell Res 17,
666-681 (2007).
173.
Sarbassov, D.D. et al. Rictor, a novel binding partner of mTOR,
defines a rapamycin-insensitive and raptor-independent pathway
that regulates the cytoskeleton. Curr Biol 14, 1296-1302 (2004).
174.
Hresko, R.C. & Mueckler, M. mTOR.RICTOR is the Ser473
kinase for Akt/protein kinase B in 3T3-L1 adipocytes. J Biol
Chem 280, 40406-40416 (2005).
175.
Sarbassov, D.D., Guertin, D.A., Ali, S.M. & Sabatini, D.M.
Phosphorylation and regulation of Akt/PKB by the rictor-mTOR
complex. Science 307, 1098-1101 (2005).
176.
Franke, T.F. Intracellular signaling by Akt: bound to be specific.
Sci Signal 1, pe29 (2008).
177.
Inoki, K., Li, Y., Zhu, T., Wu, J. & Guan, K.L. TSC2 is
phosphorylated and inhibited by Akt and suppresses mTOR
signalling. Nat Cell Biol 4, 648-657 (2002).
178.
Shaw, R.J. et al. The LKB1 tumor suppressor negatively regulates
mTOR signaling. Cancer Cell 6, 91-99 (2004).
179.
Shaw, R.J. & Cantley, L.C. Ras, PI(3)K and mTOR signalling
controls tumour cell growth. Nature 441, 424-430 (2006).
180.
Goncharova, E.A. et al. mTORC2 is required for proliferation and
survival of TSC2-null cells. Mol Cell Biol 31, 2484-2498 (2011).
181.
Sen, B. et al. mTORC2 regulates mechanically induced
cytoskeletal reorganization and lineage selection in marrowderived mesenchymal stem cells. J Bone Miner Res 29, 78-89
(2014).
Page 136
182.
Jacinto, E. et al. Mammalian TOR complex 2 controls the actin
cytoskeleton and is rapamycin insensitive. Nat Cell Biol 6, 11221128 (2004).
183.
Sarbassov, D.D. et al. Prolonged rapamycin treatment inhibits
mTORC2 assembly and Akt/PKB. Mol Cell 22, 159-168 (2006).
184.
Zeng, Z. et al. Rapamycin derivatives reduce mTORC2 signaling
and inhibit AKT activation in AML. Blood 109, 3509-3512
(2007).
185.
Bierer, B.E., Somers, P.K., Wandless, T.J., Burakoff, S.J. &
Schreiber, S.L. Probing immunosuppressant action with a
nonnatural immunophilin ligand. Science 250, 556-559 (1990).
186.
Burnett, P.E., Barrow, R.K., Cohen, N.A., Snyder, S.H. &
Sabatini, D.M. RAFT1 phosphorylation of the translational
regulators p70 S6 kinase and 4E-BP1. Proc Natl Acad Sci U S A
95, 1432-1437 (1998).
187.
Chung, J., Grammer, T.C., Lemon, K.P., Kazlauskas, A. &
Blenis, J. PDGF- and insulin-dependent pp70S6k activation
mediated by phosphatidylinositol-3-OH kinase. Nature 370, 71-75
(1994).
188.
Pullen, N. et al. Phosphorylation and activation of p70s6k by
PDK1. Science 279, 707-710 (1998).
189.
Wilson, K.F., Wu, W.J. & Cerione, R.A. Cdc42 stimulates RNA
splicing via the S6 kinase and a novel S6 kinase target, the
nuclear cap-binding complex. J Biol Chem 275, 37307-37310
(2000).
190.
Holz, M.K. & Blenis, J. Identification of S6 kinase 1 as a novel
mammalian target of rapamycin (mTOR)-phosphorylating kinase.
J Biol Chem 280, 26089-26093 (2005).
191.
Delgoffe, G.M. & Powell, J.D. mTOR: taking cues from the
immune microenvironment. Immunology 127, 459-465 (2009).
192.
Mills, R.E. & Jameson, J.M. T cell dependence on mTOR
signaling. Cell Cycle 8, 545-548 (2009).
Page 137
193.
Thomson, A.W., Turnquist, H.R. & Raimondi, G.
Immunoregulatory functions of mTOR inhibition. Nat Rev
Immunol 9, 324-337 (2009).
194.
Weichhart, T. & Saemann, M.D. The multiple facets of mTOR in
immunity. Trends Immunol 30, 218-226 (2009).
195.
Cao, W. et al. Toll-like receptor-mediated induction of type I
interferon in plasmacytoid dendritic cells requires the rapamycinsensitive PI(3)K-mTOR-p70S6K pathway. Nat Immunol 9, 11571164 (2008).
196.
Zhang, S. et al. Constitutive reductions in mTOR alter cell size,
immune cell development, and antibody production. Blood 117,
1228-1238 (2011).
197.
Benhamron, S. & Tirosh, B. Direct activation of mTOR in B
lymphocytes confers impairment in B-cell maturation andloss of
marginal zone B cells. Eur J Immunol 41, 2390-2396 (2011).
198.
Keating, R. et al. The kinase mTOR modulates the antibody
response to provide cross-protective immunity to lethal infection
with influenza virus. Nat Immunol 14, 1266-1276 (2013).
199.
Donahue, A.C. & Fruman, D.A. Distinct signaling mechanisms
activate the target of rapamycin in response to different B-cell
stimuli. Eur J Immunol 37, 2923-2936 (2007).
200.
Katsenelson, N. et al. Synthetic CpG oligodeoxynucleotides
augment BAFF- and APRIL-mediated immunoglobulin secretion.
Eur J Immunol 37, 1785-1795 (2007).
201.
Hardenberg, G. et al. Specific TLR ligands regulate APRIL
secretion by dendritic cells in a PKR-dependent manner. Eur J
Immunol 37, 2900-2911 (2007).
202.
Vogt, P.K. PI 3-kinase, mTOR, protein synthesis and cancer.
Trends Mol Med 7, 482-484 (2001).
203.
Thoreen, C.C. et al. An ATP-competitive mammalian target of
rapamycin inhibitor reveals rapamycin-resistant functions of
mTORC1. J Biol Chem 284, 8023-8032 (2009).
Page 138
204.
Sengupta, S., Peterson, T.R. & Sabatini, D.M. Regulation of the
mTOR complex 1 pathway by nutrients, growth factors, and
stress. Mol Cell 40, 310-322 (2010).
205.
von Bulow, G.U., van Deursen, J.M. & Bram, R.J. Regulation of
the T-independent humoral response by TACI. Immunity 14, 573582 (2001).
206.
Mantchev, G.T., Cortesao, C.S., Rebrovich, M., Cascalho, M. &
Bram, R.J. TACI is required for efficient plasma cell
differentiation in response to T-independent type 2 antigens. J
Immunol 179, 2282-2288 (2007).
207.
Bhattacharya, D., Lee, D.U. & Sha, W.C. Regulation of Ig class
switch recombination by NF-kappaB: retroviral expression of
RelB in activated B cells inhibits switching to IgG1, but not to
IgE. Int Immunol 14, 983-991 (2002).
208.
Dedeoglu, F., Horwitz, B., Chaudhuri, J., Alt, F.W. & Geha, R.S.
Induction of activation-induced cytidine deaminase gene
expression by IL-4 and CD40 ligation is dependent on STAT6
and NFkappaB. Int Immunol 16, 395-404 (2004).
209.
Muramatsu, M. et al. Class switch recombination and
hypermutation require activation-induced cytidine deaminase
(AID), a potential RNA editing enzyme. Cell 102, 553-563
(2000).
210.
Yasuda, T. et al. Erk kinases link pre-B cell receptor signaling to
transcriptional events required for early B cell expansion.
Immunity 28, 499-508 (2008).
211.
Neron, S. et al. B cell proliferation following CD40 stimulation
results in the expression and activation of Src protein tyrosine
kinase. Int Immunol 18, 375-387 (2006).
212.
Johnson, S.E., Shah, N., Panoskaltsis-Mortari, A. & LeBien, T.W.
Murine and human IL-7 activate STAT5 and induce proliferation
of normal human pro-B cells. J Immunol 175, 7325-7331 (2005).
213.
Hyer, M.L., Voelkel-Johnson, C., Rubinchik, S., Dong, J. &
Norris, J.S. Intracellular Fas ligand expression causes Fasmediated apoptosis in human prostate cancer cells resistant to
Page 139
monoclonal antibody-induced apoptosis. Mol Ther 2, 348-358
(2000).
214.
Groom, J.R. et al. BAFF and MyD88 signals promote a lupuslike
disease independent of T cells. J Exp Med 204, 1959-1971 (2007).
215.
Park, B. et al. Proteolytic cleavage in an endolysosomal
compartment is required for activation of Toll-like receptor 9. Nat
Immunol 9, 1407-1414 (2008).
216.
Weichhart, T. et al. The TSC-mTOR signaling pathway regulates
the innate inflammatory response. Immunity 29, 565-577 (2008).
217.
Schaeffer, V. et al. Role of the mTOR pathway in LPS-activated
monocytes: influence of hypertonic saline. J Surg Res 171, 769776 (2011).
218.
Cobbold, S.P. The mTOR pathway and integrating immune
regulation. Immunology 140, 391-398 (2013).
219.
Tsalikis, J., Croitoru, D.O., Philpott, D.J. & Girardin, S.E.
Nutrient sensing and metabolic stress pathways in innate
immunity. Cell Microbiol 15, 1632-1641 (2013).
220.
Surviladze, Z., Sterk, R.T., DeHaro, S.A. & Ozbun, M.A. Cellular
entry of human papillomavirus type 16 involves activation of the
phosphatidylinositol 3-kinase/Akt/mTOR pathway and inhibition
of autophagy. J Virol 87, 2508-2517 (2013).
221.
Soares, J.A. et al. Activation of the PI3K/Akt pathway early
during vaccinia and cowpox virus infections is required for both
host survival and viral replication. J Virol 83, 6883-6899 (2009).
222.
Bose, S.K., Meyer, K., Di Bisceglie, A.M., Ray, R.B. & Ray, R.
Hepatitis C virus induces epithelial-mesenchymal transition in
primary human hepatocytes. J Virol 86, 13621-13628 (2012).
223.
Efeyan, A. & Sabatini, D.M. mTOR and cancer: many loops in
one pathway. Curr Opin Cell Biol 22, 169-176 (2010).
224.
Peterson, T.R. et al. DEPTOR is an mTOR inhibitor frequently
overexpressed in multiple myeloma cells and required for their
survival. Cell 137, 873-886 (2009).
Page 140
225.
Almejun, M.B. et al. Naturally occurring mutation affecting the
MyD88-binding site of TNFRSF13B impairs triggering of class
switch recombination. Eur J Immunol 43, 805-814 (2013).
226.
Dan, H.C. et al. Akt-dependent regulation of NF-{kappa}B is
controlled by mTOR and Raptor in association with IKK. Genes
Dev 22, 1490-1500 (2008).
227.
Neshat, M.S. et al. Enhanced sensitivity of PTEN-deficient
tumors to inhibition of FRAP/mTOR. Proc Natl Acad Sci U S A
98, 10314-10319 (2001).
228.
Podsypanina, K. et al. An inhibitor of mTOR reduces neoplasia
and normalizes p70/S6 kinase activity in Pten+/- mice. Proc Natl
Acad Sci U S A 98, 10320-10325 (2001).
229.
Ghosh, S. & Hayden, M.S. New regulators of NF-kappaB in
inflammation. Nat Rev Immunol 8, 837-848 (2008).
230.
Medzhitov, R. & Horng, T. Transcriptional control of the
inflammatory response. Nat Rev Immunol 9, 692-703 (2009).
231.
Ollivier, V., Parry, G.C., Cobb, R.R., de Prost, D. & Mackman, N.
Elevated cyclic AMP inhibits NF-kappaB-mediated transcription
in human monocytic cells and endothelial cells. J Biol Chem 271,
20828-20835 (1996).
232.
Parry, G.C. & Mackman, N. Role of cyclic AMP response
element-binding protein in cyclic AMP inhibition of NF-kappaBmediated transcription. J Immunol 159, 5450-5456 (1997).
233.
Zan, H. & Casali, P. Regulation of Aicda expression and AID
activity. Autoimmunity 46, 83-101 (2013).
234.
Chen, Y.J. et al. Interplay of PI3K and cAMP/PKA signaling, and
rapamycin-hypersensitivity in TGFbeta1 enhancement of FSHstimulated steroidogenesis in rat ovarian granulosa cells. J
Endocrinol 192, 405-419 (2007).
235.
Rush, J.S., Liu, M., Odegard, V.H., Unniraman, S. & Schatz, D.G.
Expression of activation-induced cytidine deaminase is regulated
by cell division, providing a mechanistic basis for division-linked
Page 141
class switch recombination. Proc Natl Acad Sci U S A 102,
13242-13247 (2005).
236.
Craxton, A. et al. p38 MAPK is required for CD40-induced gene
expression and proliferation in B lymphocytes. J Immunol 161,
3225-3236 (1998).
237.
Li, Y., Zheng, X.X., Li, X.C., Zand, M.S. & Strom, T.B.
Combined costimulation blockade plus rapamycin but not
cyclosporine produces permanent engraftment. Transplantation
66, 1387-1388 (1998).
238.
Mackay, F. & Tangye, S.G. The role of the BAFF/APRIL system
in B cell homeostasis and lymphoid cancers. Curr Opin
Pharmacol 4, 347-354 (2004).
239.
Cols, M. et al. Stromal endothelial cells establish a bidirectional
crosstalk with chronic lymphocytic leukemia cells through the
TNF-related factors BAFF, APRIL, and CD40L. J Immunol 188,
6071-6083 (2012).
240.
Jacob, N. et al. B Cell and BAFF dependence of IFN-alphaexaggerated disease in systemic lupus erythematosus-prone NZM
2328 mice. J Immunol 186, 4984-4993 (2011).
241.
Kessel, A. et al. Elevated serum B-cell activating factor in
patients with chronic urticaria. Hum Immunol 73, 620-622 (2012).
242.
Toubi, E. et al. Elevated serum B-Lymphocyte activating factor
(BAFF) in chronic hepatitis C virus infection: association with
autoimmunity. J Autoimmun 27, 134-139 (2006).
Page 142