* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Maurizio Gentile Role of mTOR in the Activation of Prof. Andrea Cerutti
Survey
Document related concepts
Transcript
Role of mTOR in the Activation of Marginal Zone B Cells by TACI Maurizio Gentile Doctoral Thesis UPF - 2014 DIRECTOR Prof. Andrea Cerutti iCREA Fundación IMIM Mount Sinai School of Medicine i ii The beginning of knowledge is the discovery of something we do not understand -Frank Herbert Alla mia famiglia iii iv ACKNOWLEDGEMENTS Non è facile citare e ringraziare, in poche righe, tutte le persone che hanno contribuito alla nascita e allo sviluppo di questa tesi. Chi con una collaborazione costante, chi con un supporto morale, chi con consigli e suggerimenti o solo con parole di incoraggiamento, sono stati in tanti a dare il loro apporto. Un ringraziamento speciale va rivolto ad Andrea Cerutti per il privilegio che mi ha concesso di effettuare questo lavoro di ricerca nel suo laboratorio, per il suo prezioso aiuto scientifico e per gli impagabili suggerimenti ricevuti. Un grazie di cuore ai miei colleghi e amici di laboratorio, senza i quali questa tesi non sarebbe mai stata realizzata. Ringrazio Linda per essere stata sempre al mio fianco nei buoni ma soprattutto nei cattivi momenti; senza di lei questi anni sarebbero stati difficili da vivere. Un grazie a Giuliana per la sua sinceritá, a volte un pò dura, ma comunque nutrita da un grande affetto. Irene, una macchina da guerra; instancabile, sempre in prima linea senza perdere mai il sorriso. Ringrazio Carol per essere stata una leale compagna di lavoro su cui ho potuto contare. Poi Sabrina, l’esplosione di gioia fatta persona; una “pija” con dei sentimenti umili e profondi. Inoltre Laura, con la sua forte metodocità e professionalità; sempre accurata nei dettagli, con una capacità unica nel trasmettere le sue conoscenze e con una spiccata sensibilità. David, nonostante mi abbia tolto il titolo di unico uomo del lab, lo ringrazio per la sua disponibilità costante e per la sua instancabile voglia di organizzare “escapadas”. Ringrazio Alessandra per avermi dato un gran aiuto tanto sperimentale quanto morale; è riuscita a risollevarmi in un difficile momento. Un grazie è rivolto anche a Jordi Farrés, il componente adottato dal gruppo; la sua risata travolgente ha dato un tocco di colore all’IMIM. Ringrazio poi Jordi Sintes, ultimo acquisto del B Cell Biology Lab; un peccato non v aver avuto modo di lavorare con lui. Sono sicuro che con la sua pacatezza avrei affrontato i momenti di stress in maniera molto più filosofica. Inoltre, ringrazio a tutti i componenti del Mucosal Immunology Lab di New York. In particolare vorrei ringraziare Meimei, per avermi dato l’opportunitá di partecipare nel progetto di MUC2. Bing, per avermi proporzionato reattivi importanti per il mio progetto. Kang, per avermi dato un caloroso benvenuto a New York e per credere nelle mie capacitá. Montse, senza la quale il primo anno nella grande mela sarebbe stato molto duro. Un grazie anche a Cindy, Alejo, Sandra, Cooper e John, per aver reso piú piacevole il mio soggiorno in USA. Doveroso inoltre il ringraziamento a Eric Meffre e Rogier W. Sanders per avermi coinvolto nella realizzazione di un lavoro di ricerca. Inoltre ringrazio Charlotte Cunningham, Julio Pascual e Marta Crespo per avermi concesso campioni preziosi di pazienti. Un grazie anche a Patrick Wilson e a tutti i membri del suo laboratorio per avermi ospitato per due settimane nella magnifica università di Chicago e per avermi mostrato la tecnica per generare in maniera rapida anticorpi monoclonali umani. Vorrei poi ringraziare tutte le persone dell’IMIM e del PRBB in generale. I gruppi di José Yélamos, José Aramburu, Cristina López-Rodríguez, Miguel López-Botet e il gruppo di genetica dell’osteoporosi. Ringrazio anche tutto lo staff delle core facilities, in particolare Òscar, Eva ed Erika. Un grande grazie anche a Rosa, Marta e Monica per avermi coinvolto nelle diverse iniziative di comunicazione scientifica. Un grazie speciale va rivolto a Andrea Vera, Rocio, Romilde, Leonor, Rocco, Matteo, Arnau, Steven, Guy, Jordina e Josep. Alla mia famiglia tutta, ai miei genitori, ai mei fratelli, va forse il ringraziamento piú grande: quello che sono lo devo al loro amore e alla costante dedizione nella mia crescita. Siete il mio riferimento piú bello e dolce. vi Non posso concludere questa pagina di ringraziamenti senza citare le persone che quotidianamente mi sono state vicine in questi anni. Un grazie di cuore va a Walter. Non ci sono parole per esprimere la gratitudine che ho nei suoi confronti; un enorme “grazie” per farmi sentire in famiglia ogni qualvolta sono con lui. Un ringraziamento speciale è rivolto anche a Pedro, per essermi stato vicino, per credere in me, per sopportare i miei continui sbalzi di umore e per accompagnarmi ai diversi colloqui di lavoro in giro per l’Europa. Infine ringrazio a tutti gli amici, Leonardo, Diego, Eddie, Carlos e ai membri della Famigghia. Grazie per avermi aiutato nei momenti difficili e aver creato sempre nuove occasioni per ridere e stare insieme. Grazie a tutti! vii viii THESIS ABSTRACT The marginal zone (MZ) of the spleen contains an innate-like subset of B cells that mount rapid protective antibody responses to polysaccharides and lipids from blood-borne viruses and bacteria. These antigens activate MZ B cells by engaging somatically recombined B cell receptors (BCRs) and germline-encoded pattern-recognition receptors, including Toll-like receptors (TLRs). MZ B cells receive additional co-stimulatory signals from a proliferation-inducing ligand (APRIL) and B cell-stimulating factor of the TNF family (BAFF), two tumor necrosis factor (TNF)-related cytokines released mainly by macrophages, dendritic cells and neutrophils in response to microbes. BAFF and APRIL stimulate MZ B cells through a poorly characterized receptor called transmembrane activator and CAML interactor (TACI). Here we show that TACI induces antibody production and class switching by activating the kinase mammalian target of rapamycin (mTOR) through MyD88, an adaptor protein usually associated with TLRs. The discovery of this rapamycin-sensitive signaling pathway may facilitate the development of novel strategies for the modulation of protective or pathogenic antibody responses emanating from MZ B cells. ix RESUM DE LA TESI La zona marginal (ZM) de la melsa conté un subgrup de cèl·lules B de tipus innat que organitzen de forma ràpida respostes d’anticossos protectors contra polisacàrids i lípids de virus i éacteris transmesos per la sang. Aquests antígens activen les cèl·lules B de la ZM en interaccionar amb receptors de les cèl·lules B (BCR) que han patit recombinació somàtica i receptors de reconeixement de patrons, incloent els receptors de tipus Toll (TLR). Les cèl·lules B de la ZM reben senyals co-estimuladores addicionals del lligand inductor de proliferació (APRIL) i el factor estimulant de cèl·lules B de la família del TNF (BAFF), dos citocines relacionades amb el factor de necrosis tumoral (TNF) alliberades principalment per macròfags, cèl·lules dendrítiques i neutròfils en resposta a microbis. BAFF i APRIL estimulen les cèl·lules B de la ZM mitjançant un receptor poc caracteritzat anomenat activador de transmembrana i interactor de CAML (TACI). En aquest estudi demostrem que TACI indueix producció d’anticossos i canvi de classe de la cadena pesada de les immunoglobulines activant la quinasa diana de la rapamicina dels mamífers (mTOR) mitjançant MyD88, una proteïna adaptadora habitualment associada amb els TLRs. El descobriment d’aquesta via de senyalització sensible a la ramapicina podria facilitar el desenvolupament de noves estratègies per la modulació de les respostes protectores o patogèniques dels anticossos produïts per les cèl·lules B de la ZM. x PREFACE Blood-borne encapsulated bacteria such as Streptococcus pneumoniae, Haemophylus influenzae and Neisseria meningitidis are fast replicating pathogens that account for the death of millions of children each year, particularly in developing countries. The pathogenicity of encapsulated bacteria depends on surface capsular polysaccharides (CPSs), which interfere with the phagocytic activity of neutrophils and macrophages of the innate immune system. The adaptive immune system compensates for this limitation by inducing CPS-reactive antibodies, which opsonize encapsulated bacteria and thus enhance their clearance by phagocytes. CPS-specific antibodies are produced by unique B cells positioned in the MZ of the spleen, a lymphoid compartment strategically interposed between the circulation and immune system. Unlike conventional protein antigens, CPS antigens do not efficiently activate conventional follicular B cells, which generate long-lasting antibodies with high affinity for antigen by establishing cognate interactions with T helper cells in the germinal center (GC) of lymphoid follicles. Instead, CPSs predominantly activate MZ B cells, which produce antibodies through an extrafollicular pathway that does not require cognate help from T cells. Despite being short-lived and having low affinity for antigen, antibodies produced by MZ B cells provide quick protection against blood-borne microbes. Indeed, these antibodies emerge as early as 1-3 days after the onset of the infection, whereas the antibodies produced by follicular B cells require 5 to 7 days. While lymphoid follicles develop during fetal life, the MZ develops after birth and reaches full maturation after the second year of life. This developmental delay may explain why non-vaccinated children are particularly susceptible to infections by encapsulated bacteria. Vaccination with protein-conjugated CPSs circumvents this problem by xi stimulating T cell-dependent (TD) antibody responses in follicular B cells. In adults, vaccination with native CPSs provides protection by simulating T cell-independent (TI) antibody responses in MZ B cells. However, this protection vanishes in individuals that undergo splenectomy as a result of trauma or disease. The overall aim of this work was to gain new insights into the mechanisms underlying the activation of human MZ B cells. By showing that MZ B cells utilize a rapamycin-sensitive signaling pathway to generate immunoglobulin M (IgM) as well as well as class-switched IgG and IgA antibodies, our studies may facilitate the development of novel, more effective and less expensive vaccine strategies against encapsulated bacteria and other blood-borne microbes, including viruses. This need for new vaccines is particularly pressing in developing countries and in patients with primary or acquired antibody deficiencies associated with an impaired function of MZ B cells, including common variable immunodeficiency (CVID), HIV infection and malaria. Finally, our findings may have implications in autoimmune disorders involving abnormal activation of autoreactive MZ B cells, including systemic lupus erythematosus, rheumatoid arthritis thrombocytopenic purpura. xii and possibly idiopathic CONTENTS Thesis abstract................................................................ Preface............................................................................ List of figures................................................................. Abbreviations................................................................. vii ix xiii xiv CHAPTER 1 INTRODUCTION 1. The Immune system.................................................. 1.1. Microbial sensing.................................................... 1.1.1. Antigen recognition by TLRs.............................. 1.2. Innate immune response.......................................... 1.3. Adaptative immune response ................................. 3 4 5 6 7 2. B cell.......................................................................... 2.1 B cell development................................................... 2.1.1. CSR ..................................................................... 2.1.2. SHM..................................................................... 2.2. Antibodies............................................................... 2.3. B cell activation...................................................... 2.3.1. TD antibody responses......................................... 2.3.2. Plasma cell and memory B cell differentiation.... 2.3.3. TI antibody responses.......................................... 2.4. MZ B cell responses................................................ 9 9 13 17 18 21 22 24 25 28 3. BAFF and APRIL in B cell responses....................... 3.1. BAFF and APRIL signaling in B cells.................... 32 33 4. BAFF and mTOR....................................................... 4.1. Composition of mTOR-containing complexes....... 4.2. Biology of mTORC1 and mTORC2....................... 4.3. Downstream targets of mTOR................................ 4.4. mTOR in BAFF signaling....................................... 4.5. mTOR in antibody responses.................................. 37 38 39 41 42 43 xiii CHAPTER 2 AIMS Aims…........................................................................... 47 CHAPTER 3 MATERIALS AND METHODS Material and Methods…................................................ 51 CHAPTER 4 RESULTS TACI activates mTOR through a mechanism involving MyD88........................................................... 65 TACI enhances IRAK, IKK and NF-κB activation through mTOR............................................................... 72 TACI enhances NF-κB dependent gen transcription through mTOR............................................................... 76 TACI enhances CSR through mTOR............................. 80 TACI enhances MZ B cell proliferation through mTOR............................................................................. 85 TACI enhances antibody production through mTOR............................................................................ 92 CHAPTER 5 DISCUSSION Discussion...................................................................... 101 CHAPTER 6 CONCLUSIONS Conclusions.................................................................... 115 Publications.................................................................... References...................................................................... 119 121 xiv LIST OF FIGURES Figure 1. Pre-BCR and BCR on B cell precursors and mature B cells................................................................... 11 Figure 2. V(D)J recombination......................................... 12 Figure 3. CSR................................................................... 15 Figure 4. TD antibody responses by Follicular B cells.... 22 Figure 5. TI antibody responses by MZ B cells............... 26 Figure 6. Structure of the spleen....................................... 30 Figure 7. Signaling pathway emerging from TACI and BAFF-R............................................................................ 34 Figure 8. Structure of TACI protein................................. 36 Figure 9.Structure of mTOR............................................. 38 Figure10. Signals emanating from TORC1...................... 40 xv ABBREVIATIONS 4EBP1 ADCC AID APC APRIL BAFF BCMA BCR Blimp1 CAML CBP CD40L CLR CRD CSR CVID DCs DD DEPTOR FDC GAP H HSPGs Ig iNKT IRAK L LKB1 LLPCs MALT MHC mLST8 mTOR Factor 4E binding protein 1 Antibody-dependent cell-mediated cytotoxicity Activation-induced cytidine deaminase Antigen presenting cell A proliferation-inducing ligand B-cell activating factor B cell maturation antigen B cell receptor B limphocyte-induced maturation protein 1 Calcium-modulating cyclophilin ligand Cap binding CD40 ligand C-type lectin receptor Cysteine-rich motifs Class switching recombination Common variable immunodeficiencies Dendritic cells Death domain DEP domain containing mTOR - interacting protein Follicular dendritic cell GTPase activating protein Heavy Heparan sulfate proteoglycans Immunoglobulin invariant NKT IL-1R-associated kinase Light Liver kinase B1 Long lived plasma cells mucosal -associated lymphoid tissue Major histocompatibility complex mammalian lethal with sec 13 protein 8 Mammalian target of rapamycin xvi mTORC MZ NK pDC PDGF PDK1 PRRs RAG RAPTOR RSS S1P1 SAP SCID SHM SLAM SLE SLPCs TACI TCR TD TFH TI TLR TNFR TRAF TSC V(D)J XBP1 mTOR complex Marginal zone Natural killer plasmacytoid dendritic cell Platelet-derived growth factor Pyruvate dehydrogenase kinase 1 Pattern recognition receptors Recombination activating gene regulatory-associated protein of mTOR recombination signal sequences Sphingosine 1 phosphate receptor 1 SLAM associated protein Severe combined immunodeficiency Somatic hypermutation Signaling lymphocyte activation molecule Systemic lupus erythematosus Short lived plasma cells Transmembrane activator and CAML interactor T cell receptor T cell dependent T follicular helper cells T cell independent Toll-like receptor Tumor necrosis factor receptor TNF receptor associated factor Tuberous sclerosis complex Variable diversity joining segments X box binding protein xvii xviii CHAPTER 1 INTRODUCTION Page 1 Page 2 INTRODUCTION 1. The immune system The immune system is composed of a series of highly integrated physical structures and biologic processes that protect our body against disease. This protection involves the recognition and clearance of foreign agents referred to as antigens, which range from toxic molecules to complex microorganisms including viruses, bacteria, fungi, and parasites. These pathogens usually invade our body through the skin and mucosal surfaces1. When invasion occurs, various classes of leukocytes of our immune system sense the presence of intruding microbes and thereafter mount protective innate and adaptive responses characterized by a progressively increasing specificity 2, 3. The immune system can be divided in two fundamental components. The innate immune system provides a first line of defense that generates nonspecific responses capable to recognize and completely or partially clear invading microbes. The adaptive immune system provides a second line of defense that generates specific responses capable to completely remove invading antigens and generate immunological memory. Innate immunity is evolutionarily conserved and provides fundamental defensive mechanisms against pathogens1. Evolution has selected poorly specific innate immune receptors called pattern recognition receptors (PRRs), which recognize highly conserved microbial motifs termed pathogen associated molecular patterns (PAMPs). PRRs are non-clonally distributed germline-encoded receptors that activate neutrophils, macrophages, monocytes, dendritic cells (DCs) and other phagocytic and non-phagocytic effector cells of the innate immune system to provide immediate protection2. Although essential in the early phases of an infection, innate immune cells and their PRRs are not always adequate to mediate complete pathogen clearance. To compensate for this Page 3 limitation, vertebrates have evolved an additional and more sophisticated mechanism of immunological defense known as adaptive immunity4. Adaptive immune responses involve specific anticipatory immune receptors known as B cell receptor (BCR) and T cell receptor (TCR), which are specifically expressed by B and T lymphocytes, respectively. BCRs and TCRs are encoded by somatically recombined genes and recognize specific antigenic determinants on invading microbes5-7. Of note, adaptive immune responses require “preparatory” signals generated by early innate immune recognition events. 1.1. Microbial sensing PRRs recognize highly conserved molecules associated with the external protective structures of bacteria and fungi, including lipopolysaccharide (LPS), peptidoglycan, lipoteichoic acids, lipoproteins and β-glucan. In addition, PRRs recognize nucleic acids associated with viruses, including single-strand RNA (ssRNA), double-strand RNA (dsRNA) and nonmethylated deoxyribocytidinephosphateguanosine (CpG) DNA. This is probably because the envelope and capsid that protect viral pathogens often include autologous molecules that originating from the infected cells of the host. Of note, PRRs do not discriminate between invasive pathogens and noninvasive commensals, which physiologically inhabit our mucosal surfaces. Yet, the immune system attacks pathogens but tolerates commensals, except when commensals breach mucosal barriers8. According to their cellular localization, PRRs can be broadly grouped into secreted, transmembrane and intracellular molecules. Secreted PRRs mediate humoral innate immunity and include pentraxins (e.g., C-reactive protein and pentraxin-3), ficolins and collectins (e.g., mannose-binding lectin). These soluble PRR promote early pathogen recognition either directly or indirectly via activation of the complement cascade, thereby facilitating pathogen opsonization and phagocytosis9. Cytosolic receptors Page 4 include the nucleotide binding domain and leucine-rich repeats containing receptors (NLRs) and the retinoic acid-inducible gene I (RIG I)-like receptors (RLRs). NLRs detect degradation products of peptidoglycans10 as well as non-microbial stressors11, whereas RLRs recognize ssRNA and some dsRNA viruses12. Transmembrane PRRs include surface and intracellular Toll-like receptors (TLRs) as well as surface C-type lectin receptors (CLRs), including DC-specific ICAM-3-grabbing nonintegrin (DC-SIGN), langerin, mannose receptor, dectin-1, and various scavenger receptors. TLRs include at least ten distinct PRRs that recognize LPS, peptidoglycan, lipoteichoic acids, lipoproteins, flagellin, dsRNA, ssRNA and CpG DNA. In contrast, CLRs mostly recognize carbohydrates on viruses, fungi, mycobacteria, bacteria and helminthes, including mannose, fucose and glucan13. In addition to facilitating microbial sensing, opsonization, phagocytosis and killing, secreted, transmembrane and intracellular PRRs deliver intracellular signals that stimulate the production of a vast array of cytokines and chemokines. These soluble immune mediators amplify the activation of both innate and adaptive arms of the immune system. 1.1.1. Antigen recognition by TLRs TLRs were the first molecules identified among PRRs and remain the most widely studied family of PRRs. Humans express 10 TLRs, whereas mice express 13 TLRs14. These type-1 transmembrane proteins bind to a wide variety of PAMPs through a leucine-rich repeat (LRR) ectodomain and deliver intracellular signals through a cytosolic Toll/IL-1 receptor (TIR) domain. TLRs can recognize different ligands as a result of structural diversification of their ectodomains, which include variations in length and insertions at the level of the LRR loop15. TLRs use their intracellular TIR domain to recruit several signaling adaptor proteins, including MyD88 (myeloid differentiation fator 88), Mal Page 5 (MyD88-adaptor like; also called TIRAP), TRIF (TIR-domain containing adaptor protein inducing IFNβ) and TRAM (TRIF-related adaptor molecule). MyD88 is required for signaling downstream all TLRs, except TLR3, which exclusively recruits TRIF. TLR4 is unique among TLRs in that it signals via both MyD88-dependent and MyD88-independent (TRIF-dependent) pathways. In some instances, MyD88 and TRIF do not directly interact or signal with the TIR domain, but rather use Mal and TRAM adaptor proteins. In particular, TRAM is required for the binding of TRIF to TLR3 and TLR4, whereas Mal is required for the binding of MyD88 to TLR2 and TLR4, but not TLR9 and TLR516, 17. Individual TLRs recruit multiple signaling molecules downstream of MyD88 and TRIF, including members of the IRAK (IL-1 receptorassociated kinase), TRAF (TNF receptor-associated factor) and IRF (interferon responsive factor) families18. In general, MyD88 induces the production of inflammatory cytokines by activating NF-κB and MAPK kinases, whereas TRIF stimulates type-I IFN production via IRFs. In general, engagement of individual TLRs results in the formation of different signaling complexes that induce distinct cellular responses. 1.2. Innate immune response Granulocytes (including neutrophils, eosinophils and basophils), monocytes, macrophages, DCs, natural killer (NK) cells and mast cells of the innate immune system promote early protective responses after recognizing microbes through PRRs2. Neutrophils are the first leukocytes that migrate from the circulation to an infection site19. At this site, neutrophils remove dead cells and cellular debris and phagocytose and kill microbes. NK cells play a major role in the recognition and destruction of cells that are either infected by viruses or transformed by a neoplastic process20. Monocytes contribute to the induction of inflammation but also differentiate to macrophages and DCs21, Page 6 22 . Macrophages phagocytose microbes, dead cells and cellular debris, kill engulfed pathogens and induce inflammation23. Furthermore, macrophages positioned along the subcapsular sinus of lymph nodes and marginal sinus of the spleen present native antigen to B cells. In contrast, DCs internalize microbes to generate antigenic peptides that are presented to T cells in the context of major histocompatibility complex (MHC) molecules, also defined as 24 histocompatibility leukocyte antigen (HLA) in humans . DCs become professional antigen-presenting cells (APCs) capable to initiate both T and B cell responses after migrating from the infection/inflammation site to draining lymph nodes. DCs also promote the recruitment, activation and maturation of multiple cells of the innate and adaptive immune systems, including T and B cells25. Of note, DCs include conventional or myeloid DCs (mDCs), which mainly mediate antigen presentation, and lymphoid or plasmacytoid DCs (pDCs), which predominantly mediate antiviral responses26. Finally, mast cells elicit inflammation and cooperate with eosinophils and basophils to induce the expulsion of parasites infesting mucosal organs27. Remarkably, DCs as well as other cells of the innate immune system play a fundamental role in the initiation, polarization and amplification of adaptive immune responses, not only by presenting antigen to T cells, but also by releasing cytokines and chemokines. 1.3. Adaptive immune response The adaptive immune response includes both cellular and humoral components that are mediated by T cells and B cell, respectively. T cells include two major CD4+ and CD8+ subsets. While CD8+ T cells are primarily responsible for the destruction of cells infected with intracellular pathogens, CD4+ T cells help the activation of CD8+ T cells and B cells by secreting cytokines. Several subtypes of T helper (Th) cells with specific cytokine secretion patterns regulate the outcome of distinct immune responses. The two earliest and most clearly defined Th cell subsets are Page 7 known as Th1 and Th2 cells 28 . Th1 cells mediate protective responses against intracellular pathogens by secreting large amounts of interferon-γ (IFN-γ) and tumor necrosis factor-α (TNF-α), two cytokines that activate macrophages and induce IgG2 production by B cells. In contrast, Th2 cells predominantly secrete IL-4, IL-5 and IL-13 to mediate immune responses against extracellular pathogens, including helminths. Th2 cells are also implicated in pathogenic allergic reactions to common antigens referred to as allergens29. Both anti-helminthic and allergic Th2 responses lead to IgG1 and IgE production by B cells. A third subset of Th cells, known as T follicular helper (TFH) cells, is specialized in the activation of B cells in the germinal center (GC) of secondary lymphoid organs, including spleen and lymph nodes. These TFH cells appear essential to initiate protective antibody responses and generate long-term humoral immunity. Unlike effector cells of the innate immune system, T and B cells recognize specific antigens through somatically recombined TCRs and BCRs, respectively30, 31. These structures emerge from a process of V(D)J gene recombination that takes place in the bone marrow and thymus, respectively, and generates lymphocytes that express a virtually unlimited repertoire of highly specific antigen receptors. A side effect of V(D)J gene recombination relates to the possibility of producing pathogenic TCRs and BCRs that recognize self-antigens. However, T and B cell precursors in primary lymphoid organs undergo appropriate negative selection processes that usually prevent the generation of autoreactive lymphocytes32. Moreover, T cell precursors undergo an additional process of positive selection to further ensure their ability to recognize foreign molecules in the context of either MHC-I or MHC-II molecules33. While TCRs recognize processed peptide-MHC complexes exposed on the surface of APCs or infected cells, BCRs recognize native epitopes associated with soluble or cell-bound antigens. In addition, BCRs can Page 8 internalize native antigens and induce their processing by activated B cells into surface peptide-MHC-II complexes that are recognized by CD4+ T cells. Due to this dual activity, BCRs can mediate both T cell-dependent (TD) and T cell-independent (TI) antibody responses. The former usually target common protein antigens, whereas the latter usually target type-1 TI (TI-1) antigens such as bacterial wall components and TI-2 antigens such as carbohydrates with repetitive structure. In general, TI antibody responses involve the rapid activation of B cells by microbial structures capable to engage both BCRs and PRRs, including TLRs34. Thus, B cells mediate adaptive humoral immunity not only by directly differentiating into antibody-secreting cells in response to TI antigens, but also by serving as professional APCs capable in response to TD antigens35. 2. B cells B cells mediate humoral responses in the context of the adaptive immune system. Produced in the bone marrow through an antigen-independent process, B cells expressing highly specific BCRs migrate to the spleen and other secondary lymphoid tissues, where they differentiate into antibodysecreting plasma cells in an antigen-dependent manner. These developmental processes are integrated by central and peripheral “checkpoints” that promote the generation of protective antibodies reactive against microbes but not autologous antigens36. 2.1. B cell development B cell development includes two distinct antigen-independent and antigen-dependent phases. The antigen-independent phase of B cell development takes place in the bone marrow and generates a clonal repertoire of B cells that express diverse BCRs through a process known as immunoglobulin (Ig) V(D)J recombination. Transitional B cells emerging from the bone marrow migrate to secondary lymphoid organs, Page 9 including the spleen and lymph nodes. At these sites, transitional B cells become mature B cells that undergo further Ig gene diversification through two processes known as class switch recombination (CSR) and somatic hypermutation (SHM). Primary B cell development takes place in the yolk sac, fetal liver and fetal bone marrow during before birth 37 . After birth, the generation of mature B cells occurs in the bone marrow38, 39 . Primary B cell development proceeds through several stages (Fig. 1), which can be distinguished on the basis of B cell expression of various surface and intracellular molecules and ordered patterns of Ig heavy (H) chain and Ig light (L) chain gene rearrangement40. Newly generated B cells carry a transmembrane Ig receptor (BCR) that includes two identical IgH molecules and two identical IgL molecules of the Igκ or Igλ type. Both IgH and IgL chains include an antigenbinding variable region encoded by recombined VHDJH and VLJL genes, respectively. The variable (V), diversity (D) and joining (J) segments of these genes are organized in multiple families within the IgH and IgL loci and their assembly into in-frame VHDJH and VLJL exons requires an antigen-independent diversification process known as V(D)J 41 recombination (Fig. 2). Common lymphoid progenitors committed to become B cells initially differentiate into a pro-B cell, which join a D with a JH gene to form a DJH segment that subsequently recombines with a VH gene to assemble a complete VDJ exon encoding the antigen-binding VH region. These recombination events randomly target individual members of V, D and J gene families and require the induction of double-stranded DNA breaks in specific recombination signal sequences of these genes by a heterodimeric recombination activating gene (RAG) complex that includes RAG1 and RAG2 proteins42. These recombinases are also required for the rearrangement of TCR gene segments and thus their deficiency causes Page 10 severe combined immunodeficiency, which is characterized by the lack of both B and T cells43 44. RAG1 and RAG2 recognize short recombination signal sequences (RSS) adjacent to V, D and J gene segments. The initiation of V(D)J recombination is regulated at three distinct levels. First, the RAG proteins are expressed at high levels only during the early stages of lymphocyte development, thereby ensuring that the reaction does not occur in other tissues or cell types. Second, the ability of RAG to initiate V(D)J recombination is dictated by the ‘accessibility’ of short RSSs within chromatin45, 46 . And third, V(D)J recombination is regulated by the position and three dimensional architecture of Ig gene loci in the nucleus, chromosome looping and condensation having a vital role in allowing recombination between widely spaced gene segments. Productive VHDJH recombination inhibits RAG expression, leading to the transcription of the VHDJH gene together with the heavy chain constant gene µ (Cµ) gene to form a complete IgH chain. Subsequent assembly of the IgH chain with a surrogate invariant IgL chain formed by V-preB and λ5 proteins is followed by transient surface expression of a pre-B cell receptor (pre-BCR) that also includes anchoring Igα and Igβ subunits with signaling function. Signals emanating from the pre-BCR are a critical checkpoint for B cell development, because they regulate the expansion of pre-B cells and their further differentiation into immature B cells47 Immature B cells re-express RAG proteins to initiate the rearrangement of VL and JL segments from the IgL locus to form a complete VJ gene. RAG proteins target the Igλ locus if the Igκ locus fails to generate an in-frame VLJL rearrangement. Assembly of the IgL chain with the IgH chain is followed by the expression of a fully competent BCR of the IgM type on the surface of immature B cells. At this important checkpoint, immature B cells that express an autoreactive BCR undergo receptor editing, which involves the replacement of the V segment of an Page 11 autoreactive VLJL gene with an upstream VL segment through a RAGmediated reaction. An immature B cell unable to edit its autoreactive BCR is eliminated by apoptosis through clonal deletion 36. After progressing through this tolerance checkpoint, immature B cells leave the bone marrow as transitional B cells that co-express IgM and IgD through a process of alternative splicing of a long RNA containing VHDJH as well as both Cµ and Cδ exons48. These transitional B cells become fully mature B cells after colonizing peripheral lymphoid organs. Here, stromal cells provide mandatory survival signals that support the maintenance of a highly diversified and fully functional naïve B cell repertoire. Figure 1. Pre-BCR and BCR on B cell precursors and mature B cells. Early B cell development includes sequential VHDJH rearrangement of the Igµ heavy chain (HC), followed by VLJL rearrangement of the Ig light chain (LC). The pre-BCR includes Igµ, VpreB and λ5 surrogate IgL chain proteins, and the signaling molecules Igα and Igβ. After successful VLJL recombination, a mature BCR with both HC and LC is formed. The resulting immature B cell differentiates to a mature B cell that expresses both surface IgM and IgD through alternative mRNA splicing. Page 12 Figure 2. V(D)J recombination. The Ig loci include multiple cassettes of V, D, and J (IgH locus) and V and J (IgL loci, termed Igκ and Igλ) gene segments that undergo random rearrangement during B-cell development in the bone marrow through a process involving RAG proteins. In the IgL loci, a VL gene segment rearranges with a JL gene segment to generate a VLJL exon. Transcription of VLJL and subsequent splicing of VLJL mRNA to a Cκ or Cλ mRNA generates a VLJLCL mRNA that is polyadenylated and then translated into a mature IgL chain protein. In the IgH locus, similar recombination and transcription events lead to the formation of a VHDJH-CH (Cµ in the earliest stages of B cell differentiation) mRNA that undergoes splicing and polyadenylation to generate a mature IgH protein. In each Ig locus, V gene transcription initiates at the level of a leader (L) sequence positionated upstream of each V segment. Ultimately, two identical IgH and two identical IgL chain proteins are assembled to generate a membranebound heterotetrameric protein termed BCR. 2.1.1 CSR Mature B cells expressing somatically recombined V(D)J genes further diversify their antibody repertoire through class switching recombination (CSR) (Fig. 3), a DNA-modifying process that occurs in secondary lymphoid organs and requires a B cell-specific enzyme called activation- Page 13 induced cytidine deaminase (AID)49. CSR modulates the effector functions of an antibody without changing its antigen specificity by replacing the Cµ gene encoding the CH region of the IgM molecule with the Cγ, Cα or Cε gene encoding the CH region for IgG, IgA or IgE, respectively. In humans, there also is a non-canonical CSR replacement of Cµ with Cδ that results in selective IgD expression48. In TD antibody responses, BCR-engaged B cells express AID in the GC of secondary lymphoid follicles after receiving activation signals from , TFH cells expressing CD40 ligand (CD40L) and various cytokines50 51. In TI antibody responses, BCR-engaged B cells express AID in extrafollicular areas after receiving activation signals from TLR ligands and CD40L-like molecules and cytokines produced by DCs, macrophages, neutrophils and other antigen-capturing cells of the innate immune system50. CSR involves an AID-mediated recombinatorial event that targets intronic DNA sequences called switch (S) regions, which are located upstream of each CH gene. S regions guide CSR by recruiting AID after undergoing germline transcription. In general, TD61, 62 and TI52, 53 signals induce AID expression and germline transcription by activating the transcription factor nuclear factor-κB (NF-κB). Germline transcription requires additional signals from signal transducer and activation of transcription (STAT) proteins, which are induced by IL-4, IL-10, IL-21 and IFN-γ, and from SMAD and RUNX transcription factors, which are induced by transforming growth factor-β (TGF-β). Each of these cytokines activates germline transcription by inducing promoters located upstream of intervening (IH) exons, S regions and CH genes. In the presence of appropriate stimuli, germline IH-S-CH transcription proceeds through the S region and terminates downstream of the CH gene. The resulting primary transcript physically associates with the template strand of the DNA in the S region to form a stable DNA-RNA hybrid. Page 14 This structure generates R loops in which the displaced non-template strand exists as a G-rich single-stranded DNA. AID deaminates cytosine residues on both strands of S region DNA, thereby generating multiple DNA lesions that are ultimately processed into double-stranded DNA breaks. By generating and repairing DNA breaks, the CSR machinery rearranges the IgH locus, thereby yielding a deletional recombination product known as switch circle. Fusion of double-stranded DNA breaks at the two recombining S regions through the non-homologous end-joining pathway induces looping-out deletion of the intervening DNA, thereby juxtaposing VHDJH to a new CH gene54. Of note, the detection of AID, secondary germline transcripts and switch circles in activated B cells indicates the presence of ongoing CSR. Secondary germline transcripts derive from the splicing of primary transcripts to remove the intronic S region and join the IH exon with CH exons. Page 15 Figure 3. CSR. The IgH locus contains a rearranged VHDJH exon encoding the antigen-binding domain of an Ig. B cells produce intact IgM and IgD receptors (BCRs) through a transcriptional process driven by a promoter (P) upstream of VHDJH (blue arrow). Production of downstream IgG, IgA or IgE with identical antigen specificity but different effector function occurs through CSR. The diagram shows the mechanism of IgA CSR, but a similar mechanism also underlies IgG and IgE CSR. Appropriate stimuli induce germline transcription of the Cα gene from the promoter (Pα) of an Iα exon (black arrow) through a switch α (Sα) region located between Iα and Cα. In addition to yielding a sterile Iα-Cα mRNA, germline transcription renders the Cα gene substrate for AID. By generating and repairing DNA breaks at Sµ and Sα, the CSR machinery rearranges the IgH locus, thereby yielding a reciprocal deletional DNA recombination product known as Sα-Sµ switch circle. This episomal DNA transcribes a chimeric Iα-Cµ mRNA under the influence of signals that activate Pα. Postswitch transcription of the IgH locus generates mRNA for both secreted and membrane IgA proteins. Cα1-3, exons encoding Cα chain of IgA: S, 3’ portion of Cα3 encoding the tail piece of secreted IgA; M, exon encoding the transmembrane and cytoplasmatic portions of membrane-bound IgA; αs, polyadenylation site for secreted IgA mRNA; αm, polyadenylation site for membrane-bound IgA mRNA. Page 16 2.1.2. SHM SHM is another AID-dependent Ig diversification process that occurs in the GC of secondary lymphoid follicles55. SHM introduces point mutations in the complementarity determining regions of V(D)J genes, which form the antigen-binding pocket of an Ig molecule56. These mutations arise at a rate of 10−3/basepair/generation, which is several orders of magnitude above the rate of spontaneous mutation, and provide the structural correlate for the selection of high-affinity B cells by antigen. SHM includes an initial phase that requires the mutagenic activity of AID, followed by a second phase that involves the error-prone repair of AID-induced mutations57. Point mutations preferentially target specific hotspots, including the DGYW motif, where D stands for G, A or T nucleotides, Y for C or T nucleotides, and W for A of T nucleotides. Error-prone DNA repair is performed by members of a family of lowfidelity translesional DNA polymerases that recognize DNA lesions and bypass them by inserting bases opposite to the lesion. Amino acid replacements brought about by SHM increase the affinity and fine specificity of an antibody, but do not usually modify the framework regions, which regulate the structural architecture of the antigen-binding V region of an Ig molecule. Similarly, SHM does not induce amino acid replacements in the promoter and intronic enhancer, which regulate the transcriptional activity of the Ig locus. SHM can have different effects: 1) the antibody does not change its affinity for antigen; 2) the antibody loses affinity for antigen; or 3) the antibody increases its affinity for antigen. This latter outcome results in affinity maturation, which permits a more effective targeting and clearance of a pathogen58. Despite predominantly targeting rearranged V(D)J genes, SHM can also physiologically occur in non-Ig genes such as BCL6, which encodes a protein essential for the GC reaction59, Page 17 60 . The physiological relevance of this process remains unclear. Finally, illegitimate SHM can target and dysregulate various proto-oncogenes, including MYC, which is involved in the pathogenesis of GC-derived B cell tumors together with BCL661. 2.2. Antibodies CSR and SHM are followed by the generation of plasma cells specialized in the secretion of antibodies. Each antibody molecule consists of two smaller IgL chains (Igκ or Igλ) and two larger IgH chains held together by both covalent and non-covalent bonds. The antigen-binding fraction (Fab) of an antibody includes both VH and VL regions, whereas the crystallyzable fraction (Fc) encompasses the CH region. This segment can be expressed as a Cµ, Cδ, Cγ, Cα or Cε, which mediate specific effector functions by binding to FcγR (I, IIA, IIB, III) FcαRI or FcεR (I, II) on phagocytes and NK cells of the innate immune system. All antibodies share certain biologic functions, including the ability to neutralize and opsonize microbes and block toxins. Additional functions such as complement-mediated destruction of microbial, infected or neoplastic cells, antibody-dependent cell-mediated cytotoxicity (ADCC), translocation across mucosal epithelial cells, and histamine-mediated expulsion of parasites are more specific to certain antibody classes. In humans, there are five antibody classes or isotypes, named IgM, IgD, IgG, IgA, and IgE62. Each class is associated with specific effector functions that are mainly determined by the CH region. IgG and IgA further include IgG1, IgG2, IgG3 and IgG4 as well as IgA1 and IgA2 subclasses, respectively. IgM is expressed by pre-B, immature, transitional and mature naïve B cells and serves as surface BCR63. IgM is also released as a soluble pentameric protein by plasmablasts and plasma cells. The IgM pentamer is stabilized by a plasma cell-derived polypeptide called joining (J) chain. Page 18 In mucosal surfaces, the interaction of the J chain with a polymeric Ig receptor (pIgR) expressed on the basolateral surface of epithelial cells mediates transepithelial translocation of pentameric IgM onto the mucosal surface. In general, IgM has a rather low affinity but high avidity for antigen. The main effector functions of IgM are neutralization, opsonization and complement fixation. In addition, IgM binds to an Fcµ/α receptor expressed by B cells, macrophages and mesangial cells. This receptor also binds IgA and promotes the uptake of IgM/IgA-bound antigens. IgD is expressed by transitional and mature naïve B cells together with IgM and mainly functions as a surface BCR. After activation by antigen, most B cells down-regulate the expression of IgD through a transcriptionally regulated mechanism. However, a subset of B cells from the upper respiratory tract undergoes class switching from IgM to IgD and differentiates tino IgD-secreting plasmablasts, which enter the circulation, and release monomeric IgD. This antibody binds to an unknown receptor on various innate immune cells, including basophils64. The effector functions of secreted IgD may include neutralization and opsonization, but not complement activation. IgG is expressed by memory B cells as a surface BCR after the induction of class switching, but is also released by class-switched plasma cells, representing the most abundant antibody isotype in our circulation65. IgG is also abundant in mucosal secretions from the respiratory and urogenital tracts. In general, IgG1 and IgG3 have more Fab flexibility, complement-fixing activity, and affinity for FcγRs than IgG2 and IgG4. FcγRs include FcγRI, FcγRII, and FcγRIII receptors that functionally link B cells with phagocytes and other effector cells of the innate immune system. These FcγRs enhance the clearance of opsonized microbes and promote NK-cell–mediated ADCC of infected or tumoral cells66 67. IgA is expressed by memory B cells as a surface BCR after induction Page 19 of class switching, but is also released by class-switched plasma cells in both circulation and mucosal secretions68, 69 . In humans, IgA includes 70 IgA1 and IgA2 subclasses . Mucosal IgA encompasses dimeric IgA1 and IgA2 molecules held together by a J chain that interacts with pIgR expressed on the basolateral surface of epithelial cells. This interaction permits IgA to transcytose across epithelial cells to reach mucosal secretions. Circulating IgA is composed mostly of monomeric IgA1, which binds FcαRI and less characterized Fcα/µ, asialoglycoprotein and transferrin receptors expressed on granulocytes, monocytes, macrophages, DCs, Kuppfer’s cells and mesangial cells. Collectively, these IgA receptors may enable IgA to generate a second line of systemic defense against microbes that breach the mucosal barrier71, 72. IgE is expressed by memory B cells as a surface BCR after the induction of class switching, but is also released by class-switched plasma cells in both circulation and mucosal secretions73. IgE triggers inflammatory reactions to airborne, dietary or blood-born allergens after binding to a high-affinity FceRI receptor expressed by mast cells, eosinophils and basophils74, 75 . Cross-linking of cell-bound IgE by allergens triggers the discharge of pre-formed or newly formed inflammatory and antimicrobial mediators, including histamine76. In addition to mediating allergic reactions, IgE interaction with FcεRI provides immune protection against parasites and indeed increased serum IgE levels correlate with the presence of worm infections77. IgE is also produced under homeostatic conditions, possibly to enhance the survival and optimize the protective function of mast cells, eosinophils, and basophils that populate mucosal surfaces78. Consistent with this possibility, binding of IgE to FcεRI is thought to deliver survival signals to mucosal mast cells in the absence of antigen79. Binding of IgE by lowaffinity ligands may induce basophil and mast cell secretion of protective cytokines without eliciting degranulation80. IgE further interacts with a Page 20 low-affinity FcεRII, which modulates the activation of B cells and mediates IgE translocation across mucosal epithelial cells81. 2.3. B cell activation A critical step in the initiation of antibody production is the activation of B cells by antigen. This process can occur in the following ways: 1) B cells bind soluble antigen that penetrates lymphoid follicles82; 2) B cells capture particulate antigen from DCs lodged in the paracortical area of lymph nodes83; 3) B cells interact with antigen-containing immune complexes on follicular dendritic cells (FDCs)84; 4) B cells capture particulate antigen from subcapsular macrophages lining the subcapsular sinus of lymph nodes or from MZ macrophages lining the marginal sinus of the splenic MZ85. In the spleen, MZ B cells can transport opsonized antigens to the follicle by using both complement receptors85, 86 and BCRs87. B cells can also encounter antigen outside secondary lymphoid organs, but subsequently transport it to either lymph nodes or spleen 88. Regardless of the modalities of antigen encounter, antigen-BCR interaction trigger signaling cascades that cause B cell proliferation as well as processing of internalized antigen into peptide-MHC-II complexes that are exposed on the surface of B cells89. Antigen-loaded B cells migrate to the border between the B cell follicle and the T cell zone (T-B border), where they establish cognate interactions with TFH cells90, 91. These professional B cell-helper CD4+ T cells provide critical signals that optimize the activation of antigenengaged B cells. Upon B-T cell interaction, B cells may either clonally expand and differentiate into short-lived IgM-secreting plasma cells outside the follicle92,93 or enter the follicle to initiate the GC reaction. This process involves clonal expansion of GC B cells, SHM, CSR from IgM to IgG, IgA or IgE, and differentiation of high-affinity GC B cells into long- Page 21 lived memory B cells or plasma cells. 2.3.1. TD antibody responses The GC reaction is central to TD antibody responses against protein antigens. Indeed, the microenvironment of the GC fosters antigen-driven processes of positive and negative B cell selection that promote the production of protective antibodies with high affinity for antigen. In addition, B cell selection minimizes the production of potentially harmful autoreactive antibodies with low affinity for self-antigens. After receiving activation signals from the BCR, mature B cells migrate to the T-B cell border94, where they present processed antigens to TFH cells. The development of TFH cells involves poorly defined signals from DCs and requires the expression of the transcriptional repressor Bcl6, which induces up-regulation of CXCR5 and down-regulation of CCR7 chemokine receptors95, 96. Stable interactions between TFH cells and B cells promote their migration to the center of the follicle97, where TFH cells activate B cells through a process involving CD40L. This TNF family member promotes B cell proliferation, CSR, SHM and differentiation in cooperation with cytokines such as IL-21, IL-4 and IFN-γ from TFH cells. GC B cells include proliferating centroblasts located in the dark zone of the GC and non-cycling centrocytes positioned in light zone of the GC. This latter contains abundant FDCs that capture antigen-containing immunocomplexes through CD21 and CD35 complement receptors as well as FcγRII (or CD32). Together with TFH cells, antigen on FDCs is critical to select B cells expressing high-affinity BCRs98 (Fig. 4). According to recent models, GC B cells undergo clonal expansion and SHM in the dark zone of the GC and then migrate to the light zone of the GC to complete CSR and affinity maturation. In the light zone, centrocytes expressing low-affinity BCRs die by apoptosis, whereas centrocytes expressing high-affinity BCRs either re-enter the dark zone to Page 22 undergo additional rounds of SHM or further differentiate into long-lived circulating memory B cells or antibody-secreting plasma cells. Figure 4. TD antibody response by follicular B cells. Follicular B cells capture native antigen from subcapsular sinus macrophages and paracortical DCs through the BCR (both IgM and IgD molecules) and subsequently establish a cognate interaction with TFH cells located at the boundary between the follicle and the extrafollicular area. After activation by TFH cells via CD40L and cytokines such as IL-21, B cells enter either an extrafollicular pathway to become short-lived IgM-secreting plasmablasts or a follicular pathway to become GC centroblasts. GC cells in the dark zone (DZ) proliferate and activate the SHM machinery, which includes AID. After one (or potentially more) cycles of division/mutation, surviving centroblasts migrate toward the light zone. Centroblasts become centrocytes and interact with antigen contained in immune complexes on the surface of FDCs. Centrocytes with very low or no affinity for antigen undergo apoptosis, whereas centrocytes with high affinity for antigen differentiate to longlived memory B cells or plasma cells. Page 23 2.3.2. Plasma cell and memory B cell differentiation The differentiation of GC B cells into antibody-secreting plasma cells involves a complex network of transcriptional regulators that include Bcl6, Pax5 and B lymphocyte–induced maturation protein-1 (Blimp-1)99, 100. Bcl-6 was initially identified in B cell lymphomas101 and is required for the establishment and maintenance of the GC102, 103 , whereas Pax5 is essential for the development and function of naïve, GC and memory B cells. In addition to activating a number of genes required for the GC reaction, Bcl-6 and Pax5 suppress the plasma cell–inducing transcription factor Blimp-199. Up-regulation of Blimp-1 by a subset of GC B cells initiates plasma cell differentiation through a mechanism involving suppression of both Bcl-6 and Pax5 expression104. In particular, Blimp-1 up-regulates the expression of X-box–binding protein (XBP)-1 and IRF-4, two proteins required for plasma cell differentiation100. Blimp-1-expressing plasma cells emerging from the GC up-regulate the chemokine receptor CXCR4 and migrate to the bone marrow, which express the CXCR4 ligand CXCL12. At this anatomical site, plasma cells establish long-lived secretory memory with the help of survival signals from eosinophils and stromal cells105. Memory B cells are critical to mount quick secondary humoral responses to recall antigens. In addition to entering the circulation, memory B cells form IgG-expressing extrafollicular aggregates and IgMexpressing follicle-like structures in draining lymph nodes106, 107. After a secondary exposure to antigen, IgG-expressing memory B cells rapidly generate antibody-secreting plasmablasts, whereas IgM-expressing memory B cells initiate a secondary GC reaction. These anamnestic responses are characterized by rapid B cell activation, proliferation and differentiation and by massive secretion of high-affinity antibodies108. The Page 24 signals involved in the long-term survival of memory B cells remain unclear, but some studies point to an important role of non-antigenspecific signals provided by TLR ligands109. 2.3.3. TI antibody responses TD antibody responses to protein antigens require 5 to 7 days, which is too much of a delay to control fast-replicating pathogens. To compensate for this limitation, invariant natural killer T cells (iNKT) generate earlier waves of IgM and IgG responses to glycolipid antigens by interacting with follicular B cells through a TD pathway that resembles that orchestrated by TFH cells110. This pathway does not usually generate immunological memory and high-affinity antibodies. Additional early antibody-inducing pathways involve the activation of extrafollicular B cells by macrophages, DCs, innate lymphoid cells (ILCs) and neutrophils without any help from T cells and iNKT cells. These TI antibody responses typically generate IgM as well as IgG and IgA to carbohydrates and lipids111-113 93, 114, 115 and involve B-1 and MZ B cells that neither undergo affinity maturation nor generate immunological memory111, 112. B-1 cells constitute a distinct lineage of self-renewing B cells that occupy serosal cavities, spleen and intestine112. In mice, B-1 cells generate “natural” (or pre-immune) immunity by spontaneously releasing polyspecific and largely unmutated IgM but also class-switched IgA and IgG3 that provide a first line of defense against infections. Recent work has identified B-1 cells in the circulation of humans116, but further studies are needed to define the frequency and function of these cells. Similar to B-1 cells, MZ B cells express polyspecific and largely unmutated antibodies that recognize TI antigens with low affinity, at least in mice114. In humans, MZ B cells can also produce monospecific and mutated , antibodies that recognize TI antigens with high affinity117 111. TI antigens can be divided in two distinct categories. TI-1 antigens Page 25 include highly conserved microbial structures such as LPS and CpG DNA, which activate B cells by engaging TLRs only or TLRs and BCRs118. In contrast, TI-2 antigens include repetitive structures such as capsular polysaccharides, which activate B cells by engaging BCRs with or without help from CLRs and possibly other poorly understood PRRs. In general, TI-2 antigens are large molecules with periodic epitopes that favors the cross-linking of multiple BCRs, but cannot be uploaded onto MHC-II molecules119. Irrespective of their mechanism, TI-1 and TI-2 antigens rapidly induce the differentiation of B-1, MZ and some B-2 cells into short-lived plasma cells that secrete low-affinity antibodies. This TI response bridges the temporal gap required for the induction of highaffinity antibodies by follicular B cells. In addition to presenting TI antigens to MZ and B-1 cells, macrophages, monocytes, DCs and neutrophils release CD40L-related B cell-helper cytokines such as B cell-activating factor of the TNF family (BAFF) and its homologue a proliferation-inducing ligand (APRIL). These TNF family members also originate from mucosal epithelial cells, mucosal and splenic stromal cells as well as splenic sinus-lining cells. In addition to providing B cell and plasma cell survival signals, BAFF and APRIL deliver CSR-inducing and antibody-inducing signals. Of note, BAFF and APRIL bind TACI (transmembrane activator and caliummodulating cyclophilin ligand interactor), which extensively cooperates with BCR ligands, TLR ligands, conventional cytokines (IL-6, IL-10, IL21, TGF-β) and chemokines (CXCL10) to rapidly induce extrafollicular plasma cell differentiation and antibody production (Fig. 5). Despite being specialized in TI antibody responses, MZ B cells can also participate in TD antibody responses owing to their ability to capture antigen and shuttle from the MZ to the follicle. At this site, MZ B cells can either deposit antigen on FDCs or present immunogenic peptides to TFH cells120, 121 . This functional flexibility may explain why MZ B cells Page 26 have heterogeneous features in humans, including production of hypermutated antibodies. Figure 5. TI antibody response by MZ B cells. Tl antigens are thought to enter the human marginal zone (MZ) through capillaries emanating from the centrale arteriole and draining into the perifollicular zone. Antigen capture may involve B cell-helper neutrophils (NBH cells), macrophages, sinus-lining cells and DCs. In addition to making TI antigens available to MZ B cells as BCR and TLR ligands, antigen-capturing cells of the innate immune system release BAFF and APRIL, which engage the receptor TACI on MZ B cells. The generation of plasmablasts secreting IgM or class switched IgG and IgA involves the production of IL-6, IL10, IL-21 and chemokines such as CXCL10 by antigen-capturing cells. PALS: periarteriolar sheath containing T cells. Page 27 2.4. MZ B cell responses MZ B cells are innate-like lymphocytes strategically located at the interface between the immune system and the circulation122. In mice, the marginal sinus receives capillaries from the central arteriole and uses fenestrated spaces to directly drain arterial blood into the MZ. In humans, there is no marginal sinus, but the perifollicular zone may represent its functional equivalent. Indeed, the perifollicular zone consists of an open circulatory system of blood-filled spaces that directly communicate with capillaries from the central arteriole and sinusoidal vessels from the red pulp123, 124 (Fig. 6). Given their unique position and functional features, MZ B cells are poised to rapidly and effectively respond to any commensal, postapoptotic or pathogenic antigen present in the general circulation. In particular, MZ B cells mount rapid antibody responses against encapsulated bacteria. Consistent with this function, splenectomy results in increased susceptibility to invasive infections with encapsulated bacteria such as Streptococcus pneumoniae, Neisseria meningitides, or Hemophilus influenzae125, 126. These infections are also more frequent in the first two-five years of life due to an anatomical and functional immaturity of the MZ127, 128. There appear to be two major factors that drive the development of MZ B cells. The first factor is the intensity of signals from the BCR, which determine whether a transitional T2-MZ precursor differentiates into either a follicular or a MZ B cell. The second factor is the expression of NOTCH2, which delivers MZ differentiation signals to T2-MZ precursor cells engaged by Delta-like 1 (DLL1)129, 130 . Of note, signals from TLRs may also contribute to the development of MZ B cells and indeed patients with defective TLR signaling have reduced numbers of MZ B cells131. In humans, MZ-like B cells are located in the inner wall of the Page 28 subcapsular sinus of lymph nodes, in the epithelium of tonsillar crypts and in the subepithelial area of mucosa-associated lymphoid tissues, including the subepithelial dome of intestinal Peyer’s patches117, 132-134 . These MZ-equivalent areas are poorly understood, but may provide alternative functional niches for MZ B cells. This could explain why splenectomized individuals recover TI antibody responses against encapsulated bacteria a few years after splenectomy111. In humans, MZ-like B cells are also present in the peripheral blood, which may explain how can newly formed MZ B cells reach multiple extrafollicular sites52. Although primarily defined by their anatomical localization, MZ B cells are also characterized by a unique surface phenotype that includes large amounts of IgM, small amounts of IgD, expression of MHC-like molecules such as CD1c and CD1d, and large amounts of the complement receptor CD21 and CD35. In addition, MZ B cells express large amounts of non-clonally distributed and germline-encoded TLRs, which cooperate with BCRs and complement receptors to rapidly mount antibody responses against TI antigens124. From a functional standpoint, MZ B cells are characterized by a pre-activation state and respond more rapidly and efficiently to antigen and polyclonal mitogens than follicular B cells. Regarding BCRs, these molecules are encoded by moderately mutated V(D)J genes in human but not mouse MZ B cells. In mice, MZ B cells acquire large TI antigens from metallophilic macrophages strategically positioned along the marginal sinus or MZ macrophages scattered throughout the MZ. These professional macrophages capture antigens through various PRRs of the scavenger receptor and CLR families. Particulate TI antigens are also conveyed to mouse MZ B cells by circulating DCs that weakly express CD11c and therefore may correspond to pDCs. In humans, DCs and perhaps neutrophils and sinus-lining cells may compensate for the lack of specific macrophages in the MZ113, 117. Page 29 After interacting with antigen, MZ B cells rapidly differentiate into plasmablasts that produce large amounts of IgM117, 135, 136. In addition, MZ B cells produce IgG and some IgA via CSR117, 93. In humans, MZ B cells also undergo SHM111, which contribute along CSR to MZ B cell responses to pathogens and commensal antigens. Remarkably, a fraction of mouse and human MZ B cells produce class-switched antibodies under steadystate conditions, possibly in response to TI antigens that could come from mucosal surfaces, including the intestine 117, 137, 138. In humans, this process is associated with the induction of CSR by a unique subset of neutrophils that form extracellular trap (NET)-like structures117. By capturing antigens, NETs may provide BCR and TLR ligands to MZ B cells117. NETs may further stimulate MZ B cells by delivering endogenous TLR ligands, including CpG DNA139, 140,117 . Another subset of splenic innate immune cells, ILCs, helps the survival and activation of neutrophils by releasing granulocyte macrophage colony-stimulating factor (GM-CSF). ILCs also deliver autonomous activation signals to both MZ B cells and plasma cells via BAFF, APRIL, CD40L (in humans) and DLL1141. In addition to TLRs, MZ B cells strongly express TACI, a receptor that binds both BAFF and APRIL. Of note, TACI requires signals from microbial TLR ligands for its high expression and thus functionally cooperates with TLRs to induce CSR and antibody production in MZ B cells. In general, currently available data indicate that MZ B cells initiate rapid antibody responses to TI antigens by integrating adaptive signals from BCR ligands with innate signals from TLR ligands and TNF-related cytokines, including BAFF, APRIL and CD40L. This latter may play a crucial role when MZ B cells respond to TD antigens. The composition of the immunizing antigen is likely crucial in determining whether MZ B cells enter TI or TD pathway of differentiation142. In general, blood-borne bacteria express TI antigens such as TLR ligands and conventional polysaccharides as well as TD Page 30 antigens such polysaccharides as outer-membrane 143, 50, 144, 145 proteins and zwitterionic . The latter are processed into peptides and low-molecular-weight carbohydrates, respectively, and both are presented to CD4+ T cells through the MHC-II endocytic pathway146, 147 . In this regard, MZ B cells express more MHC-II, CD80 (B7.1) and CD86 (B7.2) molecules than follicular B cells and thus display a more robust APC activity148. Figure 6. Structure of the spleen. A: Diagram of the spleen with trabeculae that form lobular compartments after emanating from a fibrous capsule. The splenic artery branches into arterioles that terminate in the red pulp. The white pulp includes lymphoid structures called periarteriolar lymphoid sheath (PALS), which are composed of T cells organized around a central arteriole. The white pulp also includes primary follicles with no germinal center and secondary follicles with a germinal center. Each follicle is surrounded by a large MZ that is in direct contact with the open circulation of the red pulp. Sinusoidal vessels drain blood from the red pulp into the venous system. B: Light micrographs of spleen sections stained with hematoxylin and eosin. The red pulp (RP) is filled with erythrocytes from circulating blood, whereas the white pulp contains numerous lymphoid follicles with or without a germinal center (GC), each surrounded by the MZ. This area contains constitutively activated B cells that are larger than the small naïve B cells lodged in the follicular mantle. Therefore, the MZ stains paler than the follicular mantle. Original magnification, ×2 (left image) and ×20 (right image). Page 31 3. BAFF and APRIL in B cell responses MZ B cells are highly responsive to BAFF (also known as BLyS) and APRIL (also known as TALL-1), two CD40L-like proteins belonging to the TNF family. Full-length transmembrane BAFF and APRIL yield shorter soluble isoforms after undergoing proteolytical processing by furin-like convertases149. In the presence of IgG-containing immune complexes, myeloid cells increase the enzymatic processing of transmembrane BAFF through a process involving activation signals from FcγRI150. The resulting soluble BAFF adopts either a trimeric conformation, which predominantly stimulates B cell survival, or further assembles into a capsid-like sixtymeric structure, which additionally stimulates CSR, plasma cell differentiation and antibody production151. Of note, heteromers composed of both BAFF and APRIL have also been described149. BAFF and APRIL share two receptors on B cells known as TACI and B-cell maturation antigen (BCMA)152. BAFF binds TACI with higher affinity than BCMA, whereas APRIL binds BCMA with higher affinity than TACI149. In addition to sharing TACI and BCMA with APRIL, BAFF has private receptor known as BAFF receptor (BAFF-R), also known as BR3153. APRIL also has a private receptor expressed on both B cells and non-B cells. This receptor has been identified as heparan-sulfate proteoglycans (HSPGs), which bind basic amino acid residues on APRIL through sulfated glycosaminoglycan side chains154. BAFF and APRIL mainly originate from epithelial cells, stromal cells and cells of the innate immune system, including neutrophils, macrophages, monocytes, DCs and FDCs152. These cells increase BAFF and APRIL expression in response to IFN-α, IFN-γ, IL-10, granulocyte colony-stimulating factor (G-CSF) and/or TLR ligands152,155. The receptors for BAFF and APRIL are mainly expressed by B cells and Page 32 plasma cells156. While BAFF-R is widely expressed by all B cells except plasma cells156, TACI is mostly expressed by MZ and memory B cells and by some plasma cells156, 157. Plasma cells also express BCMA along with HSPGs, particularly in the bone marrow154,156. Studies in BAFF–/– and BAFF-R–/– mice show that BAFF is essential for the survival of follicular and MZ B cells and for the maturation of newly formed T1 cells into transitional T2 cells152. However, B-1 and memory B cells do not require survival signals from BAFF152, 158, 159. In contrast, APRIL–/– mice show a conserved B cell maturation149, but impaired IgA production, particularly in the gut. Consistent with this finding, APRIL promotes IgA CSR and production as well as survival of IgA-secreting plasma cells. The important role of BAFF and APRIL in CSR and antibody production is further indicated by the phenotype of TACI–/– mice, which show impaired IgM, IgG3 and IgA responses by MZ and B-1 cells to TI antigens. Of note, TACI also regulates the lifespan of MZ B cell-derived plasma cells by up-regulating the expression of the death-inducing molecule FasL and that of its cognate receptor Fas on MZ B cells. This negative regulatory function may explain why TACI–/– mice progressively accumulate B cells as they age. Finally, BCMA–/– mice fail to generate long-lived bone marrow plasma cells after immunization with TD antigens. It remains unclear whether BCMA also plays a role in the survival of plasmablasts emerging from TI responses. 3.1. BAFF and APRIL signaling in B cells Similar to other TNF receptor (TNFR) family members, BCMA, TACI and BAFF-R have cytoplasmic domains with no intrinsic enzymatic activity and thus need to recruit various adaptor molecules to initiate ligation-dependent signaling events. TNFR-associated factors (TRAFs) are intracellular proteins that bind TRAF-binding sequences associated Page 33 with TNFR family members. In the steady state, TRAFs have low affinity for their cognate binding sequences on TNFRs. When these receptors undergo trimerization in response to a cognate ligand, TRAF complexes bind to TNFRs with higher affinity, thereby initiating a signaling cascade usually centered on the activation of the transcription factor NF-κB. Engagement of BAFF-R by BAFF elicits the recruitment of TRAF3, which is followed by the degradation of TRAF3 through a mechanism involving TRAF2, cellular inhibitor of apoptosis protein (c-IAP), and MALT1160, 161. TRAF3 degradation causes activation of the enzyme NFκB-inducing kinase (NIK), which initiates an alternative NF-κB pathway involving IKKα-dependent processing of the p100 subunit of NF-κB into p52. Together with RelB, p52 up-regulates the expression of intracellular anti-apoptotic proteins such as Bcl-2, Bcl-xL and Mcl-1162 (Fig. 7). BAFF-R also triggers down-regulation of intracellular pro-apoptotic proteins such as Bax, Bid and Bad, thereby supporting the survival of mature B cells, including follicular and MZ B cells. Page 34 Figure 7. Signaling pathways emerging from TACI and BAFF-R. Engagement of BAFF-R by BAFF is followed by the recruitment of TRAF2 and TRAF3. After degradation of TRAF3, NIK becomes activated and initiates an alternative NF-κB pathway involving IKKα-dependent processing of the p100 subunit of into p52. Together with RelB, p52 transactivates various pro-survival factors of the Bcl2 family. Engagement of TACI by BAFF or APRIL induces recruitment of TRAF2, TRAF5 and TRAF6, which activate an IKK complex formed by IKKα, IKKβ and IKKγ (also known as NEMO). TACI also recruits MyD88, which further activates IKK by triggering a pathway involving IRAK-1, IRAK-4, TRAF6 and the TAK1-TAB1-TAB2 complex. By facilitating proteasome-dependent degradation of the NF-κB inhibitor IκBα, IKK induces nuclear translocation of p50 and p65 subunits of NF-κB, which initiate CSR and antibody production by transactivating germline CH genes and the gene encoding AID. Page 35 Engagement of BCMA by BAFF or APRIL leads to the recruitment of TRAF1, TRAF2 and TRAF3 and possibly TRAF5 and TRAF6. The resulting signaling complex leads to the activation of a classical NF-κB pathway that requires an IκB-inducing kinase (IKK) complex formed by IKKα, IKKβ and IKKγ (also known as NEMO). By facilitating proteasome-dependent degradation of the NF-κB inhibitor IκBα, IKK induces nuclear translocation of p50 and p65 subunits of NF-κB. These transcription factors may facilitate the expression of pro-survival genes in plasma cells lodged in the bone marrow and possibly plasmablasts originating from memory B cells. Engagement of TACI by BAFF or APRIL causes the interaction of TACI with TRAF2, TRAF5 and TRAF6, which leads to the activation of the classical NF-κB pathway. Of note, optimal TACI signaling requires the recruitment of at least two TRAF trimers to six TACI cytoplasmic tails. In addition to recruiting TRAFs, TACI interacts with MyD88, an adaptor protein that usually interacts with the TIR domain of TLRs (Fig. 8). Similar to TLRs, TACI causes activation of IL-1 receptor-associated kinase 1 (IRAK1) and IRAK4 downstream of MyD88, which form a complex with TRAF6. This TRAF6-containing signaling complex functions as an E3 ligase that activates transforming growth factor-βactivated kinase-1 (TAK1) after inducing TRAF6 polyubiquitination. By forming an active IKK kinase complex with TAB1 and TAB2, TAK1 triggers activation of IKK and nuclear translocation of NF-κB. Canonical NF-κB signals from TACI mostly induce B cell activation, including CSR, plasma cell differentiation and antibody production. Of note, TACI enhances these effects by cooperating with TLRs through a shared MyD88 pathway. This cooperation further entails the interaction of TACI with cleaved signaling-competent forms of TLRs (namely TLR7 and TLR9) along with the ability of TLRs to up-regulate BAFF and Page 36 APRIL release from myeloid cells as well as TACI expression on B cells. Ultimately, cooperative TACI and TLR signals converge on the classical NF-κB pathway, which is required to induce germline CH gene transcription, AID expression, CSR and antibody production. Accordingly, B cells lacking MyD88 or IRAK-4 are hyporesponsive to TACI ligation65. Figure 8. Structure of TACI protein. TACI includes an extracellular domain (ED) that contains two tandemly arrayed CRD1 and CRD2 cysteine-rich domains involved in the binding of BAFF or APRIL. A transmembrane domain (TD) is followed by cytoplasmic domain (CD) that contains binding sites for the adaptor proteins CAML (an NF-AT inducer with unknown function in B cells), TRAFs and MyD88. In addition to cross-talking with TLRs, TACI cooperates with the BCR pathway, which regulates the negative selection of autoreactive B cells in the bone marrow. This may explain why immunodeficient patients with deleterious TACI substitutions develop a primary antibody deficiency along with autoimmunity due to impaired removal of autoreactive B cells163. 4. BAFF and mTOR In addition to enhancing B cell survival, engagement of BAFF-R by BAFF promotes glycolysis, protein synthesis and growth through a pathway involving mammalian target of rapamycin (mTOR)164, 165 . This protein is a broadly expressed serine/threonine kinase that was first identified during a screening of yeast mutants capable of growing in the presence of the immunosuppressive agent rapamycin166,167, Page 37 168 . mTOR integrates environmental cues to optimize cell metabolism, cell growth and survival169,170,171. 4.1. Composition of mTOR-containing complexes There are two distinct mTOR complexes termed mTORC1 and mTORC2172 (Fig. 9). mTORC1 includes mTOR (RAPTOR regulatory associated protein of mTOR), DEPTOR (DEP domain containing mTORinteracting protein), Rheb (a small GTPase) mLST8 (mammalian lethal with sec-13 protein 8, also known as GβL), PRAS40 (proline-rich Akt substrate 40 kDa), and the Tti1/Tel2 complex. In mTORC1, RAPTOR serves as a scaffolding protein essential for TORC1 signaling. The downstream substrates of TORC1 are not completely understood, but include S6K1 (ribosomal S6 kinase) and 4E-BP1, a repressor of protein translation. mTORC2 is comprised of mTOR, RICTOR (rapamycininsensitive companion of TOR), DECTOR, PROTOR1/2 (protein observed with RICTOR1/2), mLST8, mSin1 (mammalian stress-activated map kinase-interacting protein 1), and the Tti1/Tel2 complex172,173. In mTORC2, RICTOR serves as a scaffolding protein essential for TORC2 signaling. mTORC2 directly activates Akt by phosphorylating a hydrophobic motif corresponding to the serine 473 residue174, 175,176. Akt is a kinase positioned both upstream and downstream of the mTOR pathway. Page 38 Figure 9. Structure of mTOR. mTOR contains an amino-terminal cluster of HEAT (huntingtin, elongation factor 3, a subunit of protein phosphatase 2A and TOR1) repeats required for mTOR binding to RAPTOR. In addition, mTOR contains a FAT (FRAP, ATM and TRRAP) domain that binds the regulatory protein DEPTOR, a FKBP12-rapamycin binding (FRB) domain that binds rapamycin, a kinase domain, and a carboxy-terminal FATC domain. 4.2. Biology of mTORC1 and mTORC2 mTORC1 integrates signals generated by growth factors, energy stress, oxygen levels and amino acid intake to regulate many processes required for cell growth. One of the most important sensors involved in the regulation of mTORC1 is the tuberous sclerosis complex (TSC), which includes TSC1 (also known as hamartin) and TSC2 (also known as tuberin) (Fig. 10). Activation of Akt by phosphatidylinositol 3-kinase (PI3K) via phosphorylation at threonine 308 facilitates mTOR activation by inhibiting the TSC1-TSC2 complex177. In contrast, activation of TSC2 by the kinase AMPK causes suppression of mTOR during energy stress 178 . Of note, the carboxy-terminus of TSC2 contains a conserved GTPase-activating protein (GAP) domain that acts on the small GTPase Rheb179. When the TSC1-TSC2 complex is activated, Rheb becomes inactive and mTOR signaling is inhibited. In this manner, growth factors Page 39 block TSC1–TSC2 activity and activate mTORC1, whereas genotoxic stress, energy deficit, and oxygen deprivation promote TSC1–TSC2 activation and inhibit mTORC1. mTORC2 is activated by growth factors through a mechanism that is not well understood. The early lethality of mice lacking essential components of mTORC2 as well as the absence of specific mTORC2 inhibitors have limited the study of this protein complex. However, various genetic approaches have demonstrated that mTORC2 plays important roles in cell cytoskeleton organization survival, 180-182 metabolism, proliferation and . Importantly, compared to mTORC1, mTORC2 shows little or no sensitivity to the inhibitory activity of rapamycin183,184. This agent binds to FK506-binding protein (FKBP12)185 and the resulting complex interacts with mTOR167. In mTORC1, rapamycin-FKBP12-mTOR interaction inhibits the kinase activity of mTOR by preventing its binding to RAPTOR186. Page 40 Figure 10. Signals emanating from TORC1. The TORC1 pathway integrates signals from growth factors, stress, energy status, oxygen and aminoacid supply to control protein and lipid synthesis. Active GTP-Rheb directly interacts with TORC1 and strongly stimulates its kinase activity. TSC1 and TSC2 form a complex that inhibits TORC1 by activating a Rheb GTPase that converts active GTP-Rheb into inactive GDP-Rheb. Of note, the TSC1-TSC2 complex transmits many of the upstream signals that impinge on TORC1 function, including signals from PI3K and Akt. Phosphorylation by Akt inhibits TSC1-TSC2, thereby causing activation of mTOR, followed by phosphorylation of 4E-BP1 and S6K, which promote protein synthesis. 4.3. Downstream targets of mTOR There are two well-characterized downstream targets of mTOR: p70S6K and 4E-BP1 (eukaryotic initiation factor-4E binding protein 1). The kinase Page 41 activity of p70S6K is strongly enhanced by growth factors such as insulin187 and nutrients such as amino acids. p70S6K requires pyruvate dehydrogenase kinase 1 (PDK1) for its activation in addition to Akt and mTOR188. Activated p70S6K phosphorylates several targets crucial for protein translation and RNA splicing, including CBP80 (40S ribosomal S6 protein and cap-binding complex 80)189. Of note, eukaryotic initiation factor 3 (eIF3) from the pre-initiation complex functions as a scaffold protein for the dynamic interaction of p70S6K with its substrates IF4B and S6, a 40S ribosomal protein190. Indeed, p70S6K binds to eIF3 under basal conditions, but dissociates from eIF3 following the recruitment of mTOR-RAPTOR as induced by the activation of mTORC1. This dissociation permits p70S6K to phosphorylate its downstream substrates. 4.4. mTOR in BAFF signaling BAFF activates TORC1 through a BAFF-R-dependent pathway involving the initial activation of Akt by PDK1 and PKCβ, followed by the activation of PI3K by Akt. The resulting phosphorylation of S6K1 and 4E-BP1 increases both mRNA translation rate and protein synthesis. BAFF-R further induces 4E-BP1 via PIM2, a kinase associated with the alternative NF-κB pathway. Together with Mcl-1, a pro-survival protein induced by the alternative NF-κB pathway, the mTOR-PIM2 axis promotes the survival, growth and metabolic fitness of B cells exposed to BAFF. The profound impact of mTOR on BAFF signaling is consistent with growing evidence that mTOR regulates not only metabolism and growth, but also immunity, including T cell and B cell responses191-194. Accordingly, rapamycin is widely used as an immunosuppressive drug to prevent allograft rejection and is also being evaluated for clinical use in the treatment of a variety of other immune-mediated diseases. Page 42 Nevertheless, whether and how rapamycin regulates B cell responses remains poorly understood. Recent data indicate that mTOR enhances the release of IFN-α from pDCs by up-regulating TLR signaling via MyD88195. In particular, inhibition of mTOR by rapamycin blocks the interaction of TLR9 (a receptor for microbial CpG DNA) with MyD88 and thereby inhibits the activation of interferon regulatory factor 7 (IRF7), a transcription factor required for the induction of IFN-α195. Consistent with this, targeting pDCs with rapamycin-containing microparticles diminishes IFN-α production in response to CpG DNA or yellow fever virus195. Similar to TLRs, TACI uses MyD88 to activate B cells. Thus, it is conceivable that mTOR regulates B cell responses to both BAFF and APRIL in addition to pDC responses to CpG DNA. 4.5. mTOR in antibody responses In addition to promoting metabolic fitness in B cells exposed to BAFF, mTOR facilitates the proliferation and plasma cell differentiation of B cells exposed to BCR or TLR agonists. Recently, two mouse models with altered mTOR activity have been used to study the role of mTOR in antibody production196. In mice expressing a hypomorphic mTOR, B cells have impaired mTOR signaling and show reduced post-immune antibody production due to decreased plasma cell differentiation. In mice with B cell-conditional deletion of TSC-1, B cells have enhanced mTOR signaling, but show decreased plasma cell differentiation and impaired post-immune antibody production197. The reason behind the discrepant behavior of these two mouse models remains unclear, but could relate to different alterations of B cell development. Additional studies show that administration of rapamycin during primary infection with influenza virus subtype H3N2 enhances protection against a lethal secondary infection with H5N1, H7N9 or H1N1. Page 43 Rapamycin treatment decreases the dominant IgG response to hemagglutinin (HA) from the primary immunizing strain, but enhances the formation of IgM and IgG antibodies to more conserved epitopes shared by heterosubtypic viruses. These data suggest that rapamycin enhances protection against a lethal heterosubtypic infection by changing the isotype profile and reactivity of the antibody repertoire induced by the primary viral strain198. Finally, some evidence indicates that distinct B cell subsets are differentially controlled by mTOR. For example, MZ B cells maintain high levels of mTOR activity in response to nutrients in the absence of mitogens. Conversely, follicular B cells display lower basal levels of mTOR activity and are less sensitive to inhibition by rapamycin199. In summary, these findings show that mTOR plays an important role in antibody production, but also emphasize that more studies are needed to elucidate the mechanism by which mTOR regulates CSR, plasma cell differentiation and antibody production in B cells responding to TD or TI antigens. Page 44 CHAPTER 2 AIMS Page 45 Page 46 Aims This project has been developed to elucidate the mechanism by which the TACI receptor activates CSR and antibody production in human splenic MZ B cells. The main objectives of this study were: AIM 1: To determine the molecular requirements underlying the recruitment of mTOR to the cytoplasmic domain of TACI in MZ B cells AIM 2: To elucidate the mechanism by which mTOR enhances TACI signaling through the transcription factor NF-κB in MZ B cells AIM 3: To dissect the involvement of mTOR in the induction of CSR and antibody production in MZ B cells activated through TACI Page 47 Page 48 CHAPTER 3 MATERIALS AND METHODS Page 49 Page 50 MATERIALS AND METHODS Cells Human B cells were isolated from buffy coats purchased from the Banc de Sang and Teixit of Barcelona or from histologically normal spleens from deceased organ donors or splenectomized trauma patients without clinical signs of infection or inflammation. The use of blood and tissues was approved by the Ethical Committee for clinical investigation of Institut Hospital del Mar d'Investigacions Mèdiques (CEIC-IMIM 2011/4494/I). Tissue samples were collected by the department of pathology of Hospital del Mar. Prior to collection, signed informed consent was obtained from the patient or his/her parent or guardians. All the blood and tissue samples were coded and relevant clinical information remained anonymous. PBMCs (peripheral blood mononuclear cells) or SMCs (splenic mononuclear cells) were isolated by ficoll technique. IgD+ B cells were obtained by magnetic separation as specified by the manufacturer (Miltenyi Biotech). Briefly, PBMCs or SMCs were resuspended in an appropriate amount 1(07 cells/ 50 µL) of PBS + 2% FBS (fetal bovine serum). FcR blocking reagent (107 cells / 20 µL) were added to the cells. The PBMCs were labeled (107 cell/ 5 µg) with a biotinylated monoclonal antibody to IgD (Southern biotechnology) for 10 min at 4 oC. After washing with PBS, the cells were incubated for 15 min at 4 oC with anti-biotin MicroBeads (20 µL per 107 cells). The cells were washed again, resuspended (up to 108 cells in 500 µL) in MACS buffer (PBS 0,5% FBS 2mM EDTA) and applied onto the column. The column was washed for three times with 3mL of MACS buffer. Finally, the column was removed from the separator and the cells were collected by pipetting 5mL of MACS buffer onto the column and flushing out the magnetically labeled cells by firmly pushing the punger into the column. 51 1 2 MZ and follicular B cells were obtained by FACSorting. Cells were stained with specific antibody cocktail (CD19-PECy7, CD27-PE, IgDFITC) and discrete subsets purified with a FACSAria III BSL2 cell sorter (Becton Dickinson) after exclusion of dead cells through 4',6-diamidin-2fenilindolo (DAPI) staining. The purity of sorted cells was consistently above 98%. Cells were sorted using the following gating strategy: Singlet SMCs Live SMCs FSC-H SSC-A DAPI Total SMCs FSC-A Total B cells FSC-A FSC-A MZ (1) and Fo (2) B cells CD19-PECy7 CD27-PE Surface Markers MZ B cell (1) 1 CD19+ IgD lowCD27+ Fo B cells (2) 2 FSC-A CD19+ IgD+ CD27- IgD-FITC Cultures and reagents Peripheral and splenic IgD+ B cells, MZ and Fo sorted B cells were cultured in RPMI 1640 medium supplemented with 10% FBS. 2E2 B cells line were cultured in RPMI 1640 medium supplemented with 5% FBS. 293T cells were cultured in DMEM supplemented with 10% FBS until reaching 70-80% confluence. Page 52 The cells were seeded in multiwell plates and were maintained under standard culture conditions (21% O2, 5% CO2, 95% humidity). MZ, Fo and IgD+ B cells were incubated with 500 ng/ml APRIL MegaLigand (Alexis), 0,1 ug/mL CpG (invitrogen). 10 nM of Rapamycin or Torin 1 (Cell Signaling) or 25 µM Ly2940002 (Calbiochem) were added 30 min before of the treatments. Flow cytometry Cells were first incubated with an Fc-blocking reagent (Miltenyi Biotech) and then stained with specific antibody cocktail (CD19-PECy7, CD27PercPCy5.5, IgD-FITC, TACI-PE). DAPI was used to exclude dead cells from the analysis as indicated by the manufacturer (BD Pharmingen). All gates and quadrants were drawn to give ≤ 1% total positive cells in the sample stained with control Abs. Cells were acquired using a BD LSRFortessa Cell Analyzer (BD Biosciences) and data were analyzed with the FlowJo software (Tree Star). Viability and proliferation assays Cell survival was measured using the Annexin-V Apoptosis Detection Kit II (BD Pharmingen). Gates and quadrants were drawn to give ≤ 1% total positive cells in samples incubated with isotype control mAbs. Cell proliferation was assessed by CFSE ((5-(and-6)-Carboxyfluorescein Diacetate, Succinimidyl Ester) staining using the CellTrace CFSE Cell Proliferation Kit (Invitrogen). Enzyme linked immunosorbent assays In order to measure the level of Igs (IgM, IgG and IgA), enzyme linked immunosorbent assays (ELISAs) were perfomed. Plates were coatedovernight at 4°C with unlabeled goat anti human IgA, IgG and IgA (Southern Biotechnology, 1µg/mL in coating buffer). After washing the Page 53 plates with PBS, the wells were filled with 200 µL of blocking solution (PBS 1% BSA) for 2 h at room temperature. After two washing with PBS, 50 µL of properly diluted (dilution buffer, PBS 1% BSA 0,05% Tween) supernatant from B cell culture were added. Plates were incubated O/N at 4 oC. After washing for five times with 0,05% Tween in PBS 50 µL of the labeled secondary antibody were added. In the detail, 0,2 µg/mL goat antihuman IgM-HRP, 0,4 µg/mL goat anti- human IgG-HRP and 0,25 µg/mL goat anti human IgA-HRP were added. Plates were incubated for 2 h at room temperature in a humid atmosphere. After washing the plates with PBS 0,05% Tween, the substrate (TMB) was added as indicated by manufacturer (BD bioscience). The reaction was blocked by adding stop solution (H2SO4) and optical density at 450 nm was measured with an ELISA plate reader. Immunofluorescence Sorted MZ B cells were resuspended in Cell Adhesive Solution as instructed by the manufacturer (Crystalgen), applied into slides (Gold Seal Products), fixed with 1% paraformaldehyde, and permeabilized with 0.2% Triton-100 in phosphate buffer solution. Stainings were performed with unconjugated or biotin-conjugated primary antibodies to human p65, p50 and p52 (SantaCruz). Isotype antibodies were used as negative controls (Santa Cruz Biotechnologies). Slides were incubated with the following secondary reagents: Alexa Fluor 488-conjugated polyclonal antigoat, Alexa Fluor 647-conjugated polyclonal anti-rabbit and cyanine 5conjugated streptavidin. streptavidin. Nuclei were visualized with 4′,6diamidine-2′-phenylindole dihydrochloride Mannheim). coverslipped Slides were (DAPI) with (Boehringer FluorSave reagent (Calbiochem). Fluorescence images were generated with a Leica microscope. Page 54 Quantitative PCR analysis and Southern blotting To quantify human gene products, RNA was obtained by High Pure RNA Isolation kit as specified by the manufacturer (Roche) and the cDNA was synthetized as indicated by manufacturer (Invitrogen). qRT-PCRs were performed using SIBR®-green methods as indicated by the manufacturer (applied biosystems). Specific primers were utilized for the amplification of the different genes (Table 1). Gene expression profile analysis was performed using the SDS 2.0 software (Appied Biosystems). Southern blots To detect human germline and circle transcripts, total RNA was extracted (Roche) and cDNA was synthesized as indicated by manufacturer (Roche). Transcripts were amplified by standard RT-PCR and hybridized with appropriate radiolabeled probes through Southern blotting assay. The amplicons were transferred from the gel to a porous membrane by capillary action using absorbent paper to soak solution through the gel and the membrane. Specific sequences were detected in the membrane by molecular hybridization with labeled nucleic acid probes. Western blotting and phospho-kinase array Total, cytoplasmic and nuclear proteins were obtained by lysing the cells in presence of proteases inhibitors. Equal amounts of proteins were fractionated onto a 10% SDS-PAGE and transferred onto PVDF membranes (BioRad). After blocking, membranes were probed with Abs to specific proteins (Table 2), washed and incubated with appropriate secondary Abs. Proteins were detected with an enhanced chemiluminescence detection system (Amersham). The phosphorylation of AKT, p70S6K, p38, Src, CREB and STAT5 was analyzed using a Proteome Profiler Human Phospho-Kinase Array kit according to the manufacturer's instructions (R&D Systems). In these Page 55 assays, the following lysis buffer was used: 50 mM Tris, 150 mM NaCl, 1% NP40, proteases inhibitors of (1 mM DTT, 1 mM Vanadate, 1 mM PMSF, and 1X inhibitor cocktail (Roche), pH 7.5-8. A transmission-mode scanner (Epson) and ImageJ analysis software was used to perform a comparative densitometric analysis of immunoreactions. Kinase assays The kinase assays were performed using 2E2 B cell line as indicated by manufacturer (Millipore). 2E2 cells (20 x 106cells per condition) were treated with 500 ng/ml APRIL for 15 min in presence or absence of 10nM of rapamycin. Anti-phospho IRAK1/IRAK4 or control antibody (Ctrl) immunoprecipitation of lysates was carried out. The phosphorylated substrate was then analyzed by immunoblot analysis, using a monoclonal antibody to phosphorylated myelin basic protein (MBP). Co-immunoprecipitation and Western blots Co-immunoprecipitation (co-IP) assays were performed using splenic IgD+ cells, 2E2 B cell line and transfected 293T cells. For each condition 20 x 106 IgD+ cells (or 2E2 B cell line) or 5 x 106 293 cells were used. The assay was performed as indicated by the manufacturer (Roche) with minor modifications. Briefly, after washing with ice cold PBS, cell pellets were resuspended in 1mL of lysis buffer (cooled 4oC) and homogenized in a Dounce homogenizer using a type B pestle by repeated strokes (approx 10) and incubated for 20 min at 4oC. The homogenized suspension was centrifugated at 12 000 x g for 20 min at 4oC in a table-top microfuge and the debris was removed. By adding 50 µL of streptavidin sepharose beads or protein A/G sepharose beads for 3 hours (or overnight) at 4 oC on a rocking platform a preclearing step was performed. The beads were pelleted by centrifugation (12 000 x g for 20 s) and 5 µg of specific antibody (or 5 µg of biotinylated IgG or IgG as negative control, see table Page 56 2) were added to the supernatant for 3 hours. Then 50 µL of streptavidn sepharose or protein A/G sepharose (previously washed with lysis buffer) were added. After an O/N incubation at 4 oC, the protein complexes were collected by centrifugation at 12 000 x g for 20 s. The supernatants were removed and sequential washings were performed using 1 mL of wash buffer 1 and wash buffer 2. The complexes were incubated 20 min with the buffer 1 and 10 min with the buffer 2. Then the complexes were collected by centrifugation and 60 uL of gel-loading buffer were added to the agarose pellet (2X). The proteins were denaturated at 100 oC for 5 min. Finally, the beads were removed by centrifugation at 12 000 g for 20 s and the proteins were analyzed by western blot. In these experiments, the following buffer were used. Lysis Buffer: 50 mM TRIS HCl ph7,5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 0,5% TRITON, 0,2 mg/mL BSA, Inhibitor proteases (1 mM Vanadate, 1 mM PMSF, cocktail inhibidors 1X, Roche). Wash Buffer 1: 50 mM Tris-HCl pH 7.5, 500 mM NaCl, 0.1% Triton. Wash Buffer 2: 10 mM Tris-HCl pH 7.5, 0.1% Triton. Electrophoretic mobility shift assays Oligonucleotides encompassing commercially available consensus NFκB-binding (Santa Cruz) were labeled with [α-32P] ATP and used at approximately 50,000 c.p.m. in each reaction. Reaction samples were prepared and electrophoresed through a 5% non-denaturing polyacrylamide gel. The composition of DNA-bound protein complexes was determined by incubation of the reaction mixture with 1ug polyclonal antibody to p65 (c-20), c-Rel (B-6) or p50 (C-19; Santa Cruz) before the addition of radiolabeled probe. Luciferase reporter assays 2E2 B cell line was nucleofected with 500 ng commercial minimal κB promoter reporter plasmid expressing firefly luciferase (Promega) Page 57 together with a 1 µg TACI expressing vector and with 200 ng pRL-TK reporter plasmid expressing renilla luciferase under the control of the thymidine kinase promoter (Promega). The nucleofection was performed by using the Pulse controller Plus. After washing, the cells were resuspended in 500 µl of RPMI without serum and in presence of plasmid DNA. The cells were transferred to an electroporation cuvette, incubated on ice for 5 min and electroporated for 10 s using the following setting: low range 200, high range 500, Volts (kV) .210, and High Cap (µF) 0,75. Then the cells were transfered into T75 flasks containing RPMI with 10% FBS. After 8 hours at 37 oC 5% CO2 the cells were treated with 10nM of rapamycin. Finally, the luciferase activity was measured by Dual Luciferase Assay System (Promega). The results were normalized considering the renilla signal. 293T cells were transfected using Superfect transfection reagent (Qiagen) with 500 ng commercial minimal κB promoter reporter plasmid expressing firefly luciferase (Promega) together with a 500 ng of protein expressing vector (TACI, MyD88, mTOR, native or deletion mutants, see Table 3) and with 200 ng pRL-TK reporter plasmid expressing renilla luciferase under the control of the thymidine kinase promoter (Promega). The transfection was performed as indicated by the manufacturer (Qiagen). Statistical analysis The data were analyzed by two-tailed Student's test. Differences were considered significant at a probability of error below 5% versus control. Page 58 Table 1. Primers PRIMER b-Actins b-Actintas AICDs AICDas MyD88s MyD88as TACIs TACIas TLR9s TLR9as Blimp1s Blimp1as XBP1 XBP1 Pax5s Pax5as Deptors Deptoras Rictors Rictoras Raptors Raptoras mTORs mTORas Akts Aktas Iα1/2s Cα1as Cα2as IγG1/2s IγG3s IγG4s Cγ1as Cγ2as Cγ3as Cγ4as SEQUENCE GGATGCAGAAGGAGATCACT CGATCCACACGGAGTACTTG AGA GGC GTG ACA GTG CTA CA TGT AGC GGA GGA AGA GCA AT GAGCGTTTCGATGCCTTCAT CGGATCATCTCCTGCACAAA CAGACAACTCGGGAAGGTACC GCCACCTGATCTGCACTCAGCTTC ACAACAACATCCACAGCCAAGTGTC AAGGCCAGGTAATTGTCACGGAG GTGGTATTGTCGGGACTTTGCAG TCGGTTGCTTTAGACTGCTCTGTG AGGAGTTAAGACAGCGCTTGG AGAGGTGCACGTAGTCTGAGTGCTG TTGCTCATCAAGGTGTCAGG CTGATCTCCCAGGCAAACAT CACCATGTGTGTGATGAGCA TGAAGGTGCGCTCATACTTG GGAAGCCTGTTGATGGTGAT GGCAGCCTGTTTTATGGTGT ACTGATGGAGTCCGAAATGC TCATCCGATCCTTCATCCTC TTGCTTGAGGTGCTACTG CTGACTTGACTTGGATTCTG TCTATGGCGCTGAGATTGTG CTTAATGTGCCCGTCCTTGT CAGCAGCCCTCTTGGCAGGCAGCCAG GGGTGGCGGTTAGCGGGGTCTTGG TGTTGGCGGTTAGTGGGGTCTTCA GGGCTTCCAAGCCAACAGGGCAGGACA AGGTGGGCAGCCTTCAGGCACCGAT TTGTCCAGGCCGGCAGCATCACCAGA GTTTTGTCACAAGATTTGGGCTC GTGGGCACTCGACACAACATTTGCG TTGTGTCACCAAGTGGGGTTTTGAGC ATGGGCATGGGGGACCATATTTGGA qPCR, quantitative PCR South, Southern blot Page 59 USE qPCR qPCR qPCR qPCR qPCR qPCR qPCR qPCR qPCR qPCR qPCR qPCR qPCR qPCR qPCR qPCR qPCR qPCR qPCR qPCR qPCR qPCR qPCR qPCR qPCR qPCR South South South South South South South South South South Table 2. Antibodies Antigen Manufacturer Use TACI MyD88 TRAF2 p-IRAK1 (T387) IRAK1 p-IRAK4 (T345) IRAK4 p-mTOR (S2448) mTOR p-p70S6K (T389) p70S6K p-S6K (S235/236) S6K p-4E-BP1 (T37/46) 4E-BP1 p-IKKα/β (S176/180) IKKα/β p-IκBα (S32/36) IκBα p65 p50 p52 His MYC FLAG HA Abcam Abcam Abcam Cell Signaling Cell Signaling Cell Signaling Cell Signalling Cell Signaling Cell Signaling Cell Signaling Cell Signalling Cell Signaling Cell Signalling Cell Signalling Cell Signaling Cell Signalling Cell Signalling Cell Signalling Cell Signalling SantaCruz SantaCruz SantaCruz SantaCruz SantaCruz SantaCruz SantaCruz WB/IP WB WB WB/IP WB WB/IP WB WB WB WB WB WB WB WB WB WB WB WB WB WB/EMSA/IF WB/EMSA/IF WB/EMSA/IF WB/IP WB WB/IP WB/IP WB, Western blotting IP, immunoprecipatation EMSA, Electrophoretic mobility shift assays IF, immunofluorescence Page 60 Table 3. Vectors Vectors TACI WT TACI D1 TACI D2 MyD88 WT MyD88 WT MyD88 D1 MyD88 D2 MyD88 D3 MyD88 D4 mTOR WT mTOR D1 mTOR D2 mTOR D3 TSC1 TSC2 Manufacturer Cerutti laboratory Cerutti laboratory Cerutti laboratory Cerutti laboratory Cerutti laboratory Cerutti laboratory Cerutti laboratory Cerutti laboratory Cerutti laboratory Addgene Addgene Addgene Addgene Addgene Addgene Page 61 Tag Histidine Histidine Histidine HA FLAG FLAG FLAG FLAG FLAG MYC MYC MYC MYC - Expressed Region (aa) 1-293 1-226 1-216 1-296 1-296 1-109 1-160 109-296 160-296 1-2549 1-1482 1271-2000 1750-2549 WB WB Page 62 CHAPTER 4 RESULTS Page 63 Page 64 RESULTS TACI activates mTOR through a mechanism involving MyD88 We recently found that TACI recruits the adaptor protein MyD88 to activate a TLR-like pathway that enhances CSR and antibody production in B cells exposed to BAFF or APRIL65. Given that TACI collaborates with TLRs in B cells163 143, 200, 201 and considering that some TLRs recruit both MyD88 and mTOR in pDCs195, we hypothesized that mTOR plays an important role in the stimulation of B cells by TACI. To determine the involvement of mTOR in TACI signaling, we performed immunoblotting (IB) assays to measure the phosphorylation profile of mTOR and downstream mTOR substrates in human splenic IgD+ B cells exposed to APRIL in the presence or absence of rapamycin, a selective inhibitor of mTORC1 (Fig. 1). These and subsequent signaling studies could not be performed with isolated IgDlowCD27+ MZ B cells due to limitations in the amount of cells available after FACSorting. Nonetheless, total splenic IgD+ B cells included a large fraction (ranging from 25% to 40%) of MZ B cells. In addition, total splenic IgD+ B cells expressed TACI and BAFF-R but not BCMA (not shown), which allowed the use of APRIL to selectively engage TACI. Engagement of TACI by APRIL induced the phosphorylation of mTOR and some of its downstream targets, including p70S6 kinase, 4EBP1 and S6. Interestingly, both mTOR activation and downstream signaling were strongly inhibited by exposing B cells to rapamycin. Thus, in the presence of TACI ligation by APRIL, B cells activate mTOR through a rapamycin-sensitive pathway that involves mTORC1. Page 65 Figure 1. TACI engagement by APRIL activates mTOR and its canonical downstream substrates through a rapamycin-sensitive pathway. IgD+ B cells were cultured in the medium only (Ctrl) and treated with 500 ng/mL of APRIL for 5, 10, 15 and 30 min. in presence or absence of 10 nM of rapamycin (rapa). Cellular extracts were analyzed by Western blot. Representative immunoblots of phospho (p)-mTOR, mTOR, p-4E-BP1, 4EBP1, p-p70S6K, p70S6K, p-S6 and S6. Red numbers indicate band intensity relative to total protein. Arrowhead indicates specific band. Data are from one of three experiments giving similar results. To further confirm the activation of mTORC1 by TACI, we activated splenic IgD+ B cells with APRIL in the presence of Ly294002. This compound specifically inhibits PI3K, an enzyme that functionally links the mTORC1 complex with growth signals from multiple receptors202. In these experiments we also used Torin 1, a compound that inhibits mTORC1 more efficiently than rapamycin203. IB assays showed that both Ly294002 and Torin 1 prevented S6 phosphorylation in splenic IgD+ B cells exposed to APRIL (Fig. 2). Page 66 Figure 2. TACI engagement by APRIL activates mTORC1 through PI3K. IgD+ B cells were cultured in the medium only (Ctrl) and treated with 500 ng/mL of APRIL for 15 min. in the presence or absence of 25 µM Ly294002 (Ly) and 10 nM Torin1, followed by immunoblotting of p-S6 and S6. Red numbers indicate band intensity relative to S6 protein (loading control). Arrowhead indicates specific band. Data are from one of three experiments giving similar results. Given that APRIL induces MyD88 recruitment to TACI in B cells65 and that MyD88 associates with mTOR in pDCs195, we wondered whether TACI ligation leads to the recruitment of mTOR via MyD88. To address this question, we performed co-immunoprecipitation (co-IP) followed by IB assays. These experiments showed that TACI associated with TRAF2 (a canonical TACI-interacting adaptor protein), mTOR, MyD88 as well as IRAK-1 and IRAK-4 (two kinases downstream of MyD88) in splenic IgD+ B cells incubated with APRIL (Fig. 3). Of note, rapamycin impaired the association of TACI with MyD88, mTOR and TRAF2, but did not affect the interaction of TACI with IRAK-1 and IRAK-4 (Fig. 3). Page 67 Figure 3. TACI recruits mTOR, MyD88, TRAF2, IRAK-1 and IRAK-4 in response to APRIL. Protein lysates from human IgD+ B cells cultured in the medium (Ctrl) and treated for 15 min. with 500 ng/mL of APRIL in the presence or absence of 10 nM rapamycin (rapa) were used in co-IP assays with anti-TACI or control (IgG) antibodies. Co-IP was followed by immunoblotting (IB) using antibodies to TACI, mTOR, MyD88, TRAF-2, IRAK-4, IRAK-1 and TACI. Red numbers indicate band intensity relative to TACI protein (loading control). Arrowhead indicates specific band. Data are from one of three experiments giving similar results. We next investigated the molecular requirements for the interaction of the intracellular domain of TACI with mTOR by transfecting 293 cells with expression plasmids encoding histidine (His)-tagged wild type (WT) TACI or His-tagged TACI deletion mutants (Fig. 4A). The cytoplasmic domain of WT TACI contains a highly conserved THC motif that spans amino acids 217-239 and functions as MyD88-binding site65. This site is different from the canonical TIR domain of TLRs and is positioned immediately upstream of a canonical TRAF2-binding site65. TACI deletion mutant 1 (D1) and D2 span amino acids 1-226 and 1-216, Page 68 respectively, and thus lack both MyD88-binding and TRAF2-binding sites. Compared to TACI D1, TACI D2 also lacks a segment of the cytoplasmic domain of TACI involved in the recruitment of TRAF5 and TRAF665. Co-IP followed by IB showed that WT TACI interacted with both mTOR and MyD88, whereas TACI D1 and D2 did not (Fig. 4B). Thus, TACI requires its MyD88-binding THC site to recruit mTOR. A B Figure 4. TACI requires its MyD88-binding site to interact with mTOR. (A) Structure of WT, D1 and D2 TACI-His proteins. Left and right numbers indicate N-terminal and C-terminal residues, respectively. ED, extracellular domain; TD, transmembrane domain; CD, cytoplasmic domain. (B) His-specific and control (IgG) antibodies were used in co-IP assays involving total lysates from 293 cells transfected with WT, D1 and D2 TACI-His expression plasmids. Co-IP was followed by IBs with antibodies to mTOR, MyD88 or His. Arrowhead indicates specific band. Data are from one of three experiments giving similar results. In subsequent experiments, we mapped the region of MyD88 required for the interaction with mTOR by co-transfecting 293 cells with expression plasmids encoding Myc-tagged mTOR and FLAG-tagged WT MyD88 or FLAG-tagged MyD88 deletion mutants (Fig. 5A). WT MyD88 encompassed th N-terminal death domain (DD) required for the Page 69 recruitment of IRAK kinases, the intermediary domain (ID) required for the binding to TACI, and the TIR domain required for the binding to TLRs65. MyD88 D1 spun amino acids 1-109 and contained the DD, but neither ID nor TIR domains. MyD88 D2 encompassed amino acids 1-160 and contained the DD and ID domains, but not the TIR domain. MyD88 D3 spun amino acids 1-160, contained the ID and TIR domains, but lacked the DD domain. Finally, MyD88 deletion mutant D4 encompassed amino acids 160-296 and included the TIR domain but not the DD and ID domains. Co-IP and IB assays demonstrated that WT, D3 and D4 MyD88 proteins interacted with mTOR, whereas D1 and D2 showed little or no interaction with MyD88 (Fig. 5B). These data indicate that MyD88 uses its TIR domain to interact with mTOR. A B Page 70 Figure 5. MyD88 requires its TIR domain to interact with mTOR. (A) Structure of WT, D1, D2, D3 and D4 MyD88-FLAG proteins. Left and right numbers indicate N-terminal and C-terminal residues, respectively. (B) FLAGspecific and control (IgG) antibodies were used in co-IP assays involving total lysates from 293 cells co-transfected with mTOR-MYC and WT, D1, D2, D3 or D4 MyD88-FLAG expression plasmids. Co-IP was followed by IBs with antibodies to MYC or FLAG. Arrowhead indicates specific band. Data are from one of three experiments giving similar results. Finally, we mapped the region of mTOR required for the interaction with MyD88 by co-transfecting 293 cells with expression plasmids encoding hemagglutinin (HA)-tagged MyD88 and MYC-tagged WT mTOR or MYC-tagged mTOR deletion mutants (Fig. 6A). WT mTOR included the N-terminal HEAT (Huntington, elongation factor 3, protein phosphatase 2A, and TOR1) region (HR), which interacts with RAPTOR, the central region encompassing the FAT (FRAP, ATM, TRRAP) domain, which binds DEPTOR204, and the C-terminal region encompassing the kinase domain (KD), which accounts for the enzymatic activity of the protein. D1 mTOR spun amino acids 1-11482 and included HR, but not FAT and KD domains. D2 mTOR spun amino acids 1271-2000 and encompassed the central region, including most of the FAD domain. D3 mTOR spun amino acids 1750-2549 and encompassed the C-terminal region, including part of the FAT domain and the KD. Co-IP and IB assays showed that WT, D2 and D3 mTOR proteins interacted with MyD88, whereas D1 mTOR showed little or no binding to MyD88 (Fig. 6B). These data indicate that mTOR uses its central region, including the FAT domain, to interact with mTOR. Page 71 A B Figure 6. mTOR uses its central-terminal region to interact with MyD88. (A) Structure of WT, D1, D2, D3 and D4 mTOR-MYC proteins. Left and right numbers indicate N-terminal and C-terminal residues, respectively. (B) MYCspecific and control (IgG) antibodies were used in co-IP assays involving total lysates from 293 cells co-transfected with MyD88-HA and WT, D1, D2 or D3 mTOR-MYC expression plasmids. Co-IP was followed by IBs with antibodies to MYC or HA. Arrowhead indicates specific band. Data are from one of three experiments yielding similar results. Overall, this molecular evidence demonstrates that TACI engagement by APRIL induces the recruitment of mTOR to the cytoplasmic domain of TACI through a mechanism involving the THC, IR and FAT motifs of TACI, MyD88 and mTOR, respectively. The recruitment of mTOR to TACI occurs in the context of TACI interaction with MyD88, TRAF2, IRAK-1 and IRAK-4 and causes PI3K-dependent activation of mTORC1. TACI enhances IRAK, IKK and NF-κB activation through mTOR Given its kinase activity, mTOR may modify the activation of kinases positioned downstream of TACI, TRAF2 and MyD88, including IRAK-1, IRAK-4 and IKK65. These kinases cause activation of NF-κB, a Page 72 transcription factor essential for the induction of CSR and antibody production in B cells. To verify whether TACI activates IRAK-1 and IRAK-4 via mTOR, we performed ad hoc kinase assays by immunoprecipitating the phosphorylated (i.e., active) form of IRAK-1 or IRAK-4 from an IgD+ 2E2 B cell line stimulated with APRIL in the presence or absence of rapamycin. Myelin basic protein (MBP) was added to immunoprecipitated proteins to measure the kinase activity of IRAK-1 and IRAK-4. IP assays followed by IB showed that splenic IgD+ B cells exposed to APRIL increased the kinase activity of both IRAK-1 and IRAK-4 (Fig. 7). This effect was reduced in B cells exposed to rapamycin. Thus, TACI recruits mTOR through a MyD88-dependent rapamycin-sensitive pathway to enhance the activation of NF-κBinducing kinases positioned downstream of MyD88, including IRAK-1 and IRAK-4. Figure 7. TACI enhances IRAK1 and IRAK4 activation through mTOR. IgD+ 2E2 B cells were cultured in the medium only (Ctrl) and treated with or without 500 ng/mL APRIL for 15 min in the presence or absence of 10 nM rapamycin (rapa). IP of whole cell lysates with antibodies to p-IRAK-1 or pIRAK-4 or a control (IgG) antibody was followed by incubation with MBP and Page 73 by IB with an antibody to p-MBP. Red numbers indicate band intensity relative to total IRAK-1 or IRAK-4. Arrowhead indicates specific band. Data are from one of three experiments giving similar results. We next verified the role of mTOR in the activation of the IKK complex by TACI. Active IKK causes cytoplasmic-nuclear translocation of canonical NF-κB dimers such as p65-p50 and p50-c-Rel by inducing phosphorylation-dependent degradation of IκBα, an inhibitor of NF-κB that retains p65-p50 and p50-c-Rel dimers in an inactive cytoplasmic form. IB assays demonstrated that, in the presence of APRIL, splenic IgD+ B cells showed increased IKKα/β and IκBα phosphorylation as well as increased IκBα degradation (Fig. 8). However, in the presence of rapamycin, APRIL induced little or no IKKα/β phosphorylation, IκBα phosphorylation and IκBα degradation. These data indicate that TACI enhances IKK activation via mTOR. Figure 8. TACI enhances IKK activation through mTOR. Splenic IgD+ B cells were cultured in the medium only (Ctrl) and treated with 500 ng/mL APRIL for 5, 10, 15 and 30 min in the presence or absence of 10 nM rapamycin (rapa). IBs were performed with antibodies to p-IKKα/β, IKKα/β, p-IκBα or IκBα. Red numbers indicate band intensity relative to total IKKα/β or IκBα. Arrowhead indicates specific band. Data are from one of three experiments giving similar results. Page 74 Having shown that TACI activates a PI3K-dependent mTORC1 complex, we verified whether selective inhibitors of PI3K activity and mTORRAPTOR interaction could attenuate the activation of IKK by APRIL. Consistent with this possibility, IB assays showed that Ly294002 or Torin 1 inhibited the induction of IKKα/β phosphorylation in splenic IgD+ B cells exposed to APRIL (Fig. 9). Figure 9. TACI enhances IKK activation via PI3K-dependent activation of the mTORC1 complex. Splenic IgD+ B cells were cultured in the medium only (Ctrl) and treated with 500 ng/mL APRIL for 15 min in the presence or absence of 25 µM Ly294002 or 10 nM Torin 1. IBs were performed with antibodies to pIKKα/β or IKKα/β. Red numbers indicate band intensity relative to total IKKα/β or IκBα. Arrowhead indicates specific band. Data are from one of three experiments giving similar results. To determine whether mTOR influences the interaction of TACI-induced NF-κB to DNA, we performed electrophoretic mobility shift assay (EMSA) and NF-κB-specific supershift assays using a radidolabeled NFκB-binding DNA sequence and nuclear protein extracts from splenic IgD+ B cells exposed to APRIL in the presence or absence of rapamycin. We found increased binding of p50 and p65 but not p52 and (not shown) cRel proteins to DNA in B cells exposed to APRIL (Fig. 10). In the presence of rapamycin, both constitutive and APRIL-induced binding of p50 and p65 to DNA decreased. Thus, TACI recruits and activates mTOR to enhance the activation of IRAK-1, IRAK-4 and IKK, three kinases functionally linked to NF-κB. Activation of NF-κB by TACI-induced mTORC1 increases the nuclear translocation of p50-p65 dimers and their Page 75 binding to target gene sequences. Figure 10. TACI enhances NF-κB binding to DNA through mTOR. Splenic IgD+ B cells were treated for 60 min with 500 ng/mL APRIL in the presence or absence of 10 nM rapamycin (rapa). EMSA and supershift assays involved the incubation of nuclear protein extracts with a radioactive probe encompassing a conserved NF-κB-binding sequence in the presence or absence of antibodies to p65, p50 or p52 subunits of NF-κB. Increasing concentrations of unlabeled (cold) probe were used to test the specificity of the reaction. Data are from one of two experiments giving similar results. TACI enhances NF-κB-dependent gene transcription through mTOR Having shown that TACI recruits mTOR to enhance nuclear translocation and DNA binding of NF-κB, we determined whether mTOR also influences the induction of NF-κB-dependent gene transcription by TACI. To verify this possibility, we co-transfected the IgD+ B cell line 2E2 with a TACI expression vector and a minimal NF-κB-responsive luciferase reporter vector driven by two κB sites. Transfection was followed by incubation of 2E2 B with APRIL in the presence or absence of rapamycin. We found that TACI induced NF-κB-dependent gene transcription through a pathway that was strongly inhibited by rapamycin (Fig. 11). Page 76 * Figure 11. TACI enhances NF-κB-dependent gene transcription through mTOR. IgD+ 2E2 B cells co-transfected with a TACI expression vector and a minimal NF-κB-responsive luciferase reporter vector were cultured with 500 ng/mL APRIL in the presence or absence of 10 nM rapamycin (rapa). Ctrl, control empty vector. Data summarize three experiments. Error bars, SEM. *P < 0.05 (two-tailed unpaired Student's t-test). Similar transient transfection and luciferase reporter assays were used in 293 cells to elucidate the molecular requirements underlying the enhancement of TACI-induced NF-κB-dependent gene transcription by mTOR. Initial assays determined the role of TCS-1 and TSC-2 proteins, which form a complex upstream of mTOR that negatively regulates the activation of mTORC1177. We found that TSC-1 or TSC-2 alone did not impair TACI-induced NF-κB-dependent gene transcription, whereas a combination of TSC-1 and TSC-2 did (Fig. 12). These data indicate that TACI enhances NF-κB-dependent gene transcription through an mTORdependent pathway negatively regulated by the TSC-1-TSC-2 complex. Page 77 Figure 12. TACI-induced NF-κB-dependent gene transcription is negatively regulated by the mTOR inhibitory proteins TSC-1 and TSC-2. 293 cells cotransfected with a minimal NF-κB-responsive luciferase reporter vector and with or without TACI, TSC-1 and/or TSC-2 expression vectors. Ctrl, control empty vector. Data summarize three experiments. Error bars, SEM. *P < 0.05 (twotailed unpaired Student's t-test). To characterize the regions of TACI, MyD88 and mTOR required for the induction of NF-κB-dependent gene transcription, we co-transfected 293 cells with a minimal NF-κB-responsive luciferase reporter vector and the TACI, MyD88 or mTOR deletion mutants described earlier. Compared to WT TACI, which induced strong NF-κB-dependent gene transcription, TACI D1 and D2 deletion mutants lacking the MyD88-TOR (but also TRAF2) binding site induced little or no NF-κB-dependent gene transcription (Fig. 13A). Of note, WT MyD88 and MyD88 D3 and D4 deletion mutants, which contained the mTOR-binding site, sustained TACI-mediated NF-κB-dependent gene transcription more vigorously than MyD88 D1 and D2 deletion mutants, which lacked the mTORbinding site (Fig. 13B). Compared to WT MyD88, D3 and D4 deletion mutants showed reduced TACI-mediated NF-κB-dependent gene transcription due to the lack of the IRAK-interacting DD domain. Finally, mTOR D1 deletion mutant, which lacked the MyD88-binding site, Page 78 1 2 sustained TACI-mediated NF-κB-dependent gene transcription as much as WT mTOR, probably due to its ability to retain an active KD (Fig. 13C). In contrast, mTOR D2 and D3 deletion mutants sustained TACI-mediated NF-κB-dependent gene transcription less effectively than WT mTOR or mTOR D1, probably due to the lack of the C-terminal HEAT region required for the interaction with RAPTOR. A B Figure 13. MyD88 and mTOR regulate TACI-induced NF-κB-dependent gene transcription. 293 cells co-transfected with a minimal NF-κB-responsive luciferase reporter vector and with or without WT TACI, TACI D1, TACI D2, WT MyD88, MyD88 D1, MyD88 D2, MyD88 D3, MyD88 D4, WT mTOR, mTOR D1, mTOR D2 or mTOR D3 expression vectors. Data summarize three experiments. Ctrl, control empty vector. Data summarize three experiments. Error bars, SEM. *P < 0.05 (two-tailed unpaired Student's t-test). Page 79 Together with our earlier results, these data indicate that TACI amplifies NF-κB-dependent gene transcription by activating mTORC1 through a ramamycin-sensitive pathway involving the interaction of TACI with MyD88 and mTOR. TACI enhances CSR through mTOR Having shown that TACI enhances NF-κB activation through mTOR and given the important role of TACI in TI antibody production205, 206 , we wondered whether mTOR enhances the activation of MZ B cells by TACI and TACI-cooperating molecules, including TLR9. This microbial CpG DNA receptor enhances the induction of MZ B cell activation by TACI and shares both MyD88 and mTOR with TACI. First, we compared TACI, TLR9, MyD88 and mTOR expression in splenic MZ and follicular B cells. As shown by flow cytometry, splenic IgDloCD27+ MZ B cells expressed more TACI and more canonical activation molecules such as CD69, CD80 and HLA-DR than splenic follicular IgDhiCD27– B cells (Fig. 14A). The activated state of MZ B cells was confirmed by QRT-PCR assays, which showed that MZ B cells expressed more TACI and TLR9 transcripts than follicular B cells (Fig. 14B). Also transcripts for the CSR-induced enzyme AID were somewhat increased in MZ B cells, whereas transcripts for MyD88, AKT, mTOR, RAPTOR and RICTOR were not (Fig. 14B,C). Thus, compared to follicular B cells, splenic MZ B cells display a pre-activated state that includes more elevated expression of TACI and TLR9, but comparable expression of signaling molecules downstream of TACI and TLR9, including MyD88 and mTOR. Page 80 A B C Page 81 Figure 14. MZ B cells express more TACI, TLR9 and other activationrelated receptors than follicular B cells. (A) Flow cytometry of CD69, CD80, HLA-DR and TACI on splenic MZ and follicular B cells. Solid gray profile, isotype control. FO, follicular. (B,C) QRT-PCR of transcripts for AID, MyD88, TACI, TLR9, mTOR, RAPTOR, RICTOR, and AKT in MZ and FO B cells. RE, relative expression. Data summarize three experiments. Error bars, SEM. *P < 0.005 (two-tailed unpaired Student's t-test). Having shown that MZ B cells express TACI and mTOR, we verified whether these cells use mTOR to activate NF-κB in response to TACI ligation. Consistent with earlier EMSA data from total splenic IgD+ B cells, immunofluorescence analysis (IFA) showed that APRIL increased p50 and p65 but not p52 nuclear translocation in MZ B cells (Fig. 15). This effect disappeared after exposing MZ B cells to APRIL in the presence of rapamycin. Thus, similar to total splenic IgD+ B cells, MZ B cells enhance TACI signaling via NF-κB through a mechanism involving mTOR. Figure 15. TACI enhances NF-κB activation in MZ B cells via mTOR. IFA of p65 (red), p50 (green), p52 (red) and DAPI (blue) in MZ B cells cultured in the medium only (Ctrl) and treated with 500 ng/ml APRIL for 60 min in the presence or absence of 10 nM rapamycin (rapa). Images are from one of two experiments yielding similar results. Original magnification, ×63. Given that NF-κB is critical for the induction of CSR, including germline Cγ and Cα gene transcription and AID expression207, 208 , we verified whether TACI induces CSR by stimulating MZ B cells through mTOR. Page 82 Germline IH-S-CH gene transcription precedes CSR to promote the recruitment of AID to Sµ and the targeted downstream SX region and yields a spliced germline IH-CH transcript that generates no protein. Following AID-mediated processing of DNA at Sµ and SX regions, CSR generates a reciprocal switch DNA recombination product known as switch circle. This excised extra-chromosomal DNA includes the IH promoter 5’ of the targeted CH gene, the DNA segment between Sµ and the targeted SX region, and Cµ. Under the influence of the IH promoter, the switch circle transcribes a chimeric IH-Cµ product referred to as switch circle transcript. Together with AID transcripts, germline IH-CH transcripts and switch circle transcripts constitute molecular hallmarks of ongoing CSR. To determine the involvement of mTOR in TACI-induced CSR, we measured germline IH-CH transcripts, switch circle IH-Cµ transcripts and AID in MZ B cells exposed to APRIL in the presence or absence of rapamycin. RT-PCR followed by Southern blotting, QRT-PCR and immunoblotting showed that, in the presence of APRIL, MZ B cells upregulated the expression of germline Iγ1-Cγ1, Iγ2-Cγ2, Iγ3-Cγ3, Iα1-Cα1 and Iα2-Cα2 transcripts, switch circle Iγ1/2-Cµ, Iγ3-Cµ and Iα1/2-Cµ transcripts as well as AID transcripts and protein (Fig. 16A-C). The upregulation of all these transcripts and that of AID protein decreased when MZ B cells were exposed to rapamycin. Along with earlier data, these findings indicate that TACI recruits mTOR to enhance NF-κB-dependent induction of AID expression and CSR from IgM to IgG1, IgG2, IgG3, IgG4, IgA1 or IgA2 in MZ B cells. Page 83 A B C Figure 16. TACI enhances AID expression and CSR from IgM to IgG or IgA in MZ B cells. MZ B cells were treated for 72 h with 500 ng/mL APRIL in the presence or absence of 10 nM rapamycin. (A) Southern blot analysis of RT-PCRamplified Iγ1/2-Cµ, Iγ3-Cµ, Iα1/2-Cµ, Iγ1/2-Cγ1, Iγ1/2-Cγ2, Iγ3-Cγ3, Iα1-Cα1 and Iα2-Cα2 transcripts. The Iµ-Cµ amplicon corresponds to a loading control. Red numbers indicate band intensity relative to unstimulated MZ B cells. (B) qRT-PCR of transcripts for AID. Results are normalized to β-actin mRNA. RE, relative expression compared to unstimulated (Ctrl) MZ B cells. (C) IB of AID and control actin proteins. Arrowhead indicates specific band. Data are from one of three experiments giving similar results (A,C) or summarize three experiments (B). Error bars, SEM. *P < 0.05 (two-tailed unpaired Student's t-test). N.S., not significant. Page 84 TACI enhances MZ B cell proliferation through mTOR CSR is usually functionally coupled with the proliferation of activated B cells209. Given that TACI signaling via mTOR enhances NF-κB-dependent CSR in MZ B cells, we wondered whether this pathway also modulates MZ B cell proliferation. In initial experiments, we took advantage of phospho-protein arrays to identify proliferation-associated rapamycinsensitive gene products in MZ B cells exposed to APRIL. We found that APRIL up-regulated the phosphorylation of key residues of mitogenactivated protein kinase p38 (p38), tyrosine protein kinase Src (Src), signal transducer and activator of transcription 5 (STAT5) and cAMP response element-binding protein (CREB) (Fig. 17A). These signaling proteins regulate multiple processes in activated B cells, including proliferation210-212. As expected, APRIL also up-regulated the phosphorylation of enzymes linked to PI3K-mediated activation of mTORC1, including AKT and p70S6K (Fig. 17B). Of note, rapamycin decreased APRIL-induced phosphorylation of p38, Src, STAT5, CREB, AKT and p70S6K (Fig. 17A,B). These data suggests that TACI recruits mTOR to enhance the phosphorylation of proliferation-related enzymes in MZ B cells. Page 85 A B Page 86 Figure 17. TACI uses mTOR to enhance the activation of proliferationrelated signaling proteins in MZ B cells. Total proteins from splenic MZ B cells cultured in the medium only (Ctrl) and treated with 500 ng/mL APRIL for 15 min in the presence or absence of 10 nM rapamycin (rapa) were analyzed through a phospho-proteome profile kit. Bars indicate the mean pixel density of dot blots from gels positioned underneath each graph. The protein phosphorylation site is indicated in brackets. O.D., optical density. Error bars, SEM. *P < 0.05 (two-tailed unpaired Student's t-test). Page 87 Additional QRT-PCR experiments demonstrated that MZ B cells exposed to APRIL up-regulated the expression of transcripts encoding Cyclin D1 (Fig. 18), a protein the controls cell entry into the cell cycle. This upregulation did not occur in follicular B cells and was inhibited in MZ B cells by rapamycin. These data indicate that TACI uses mTOR to promote signaling and transcriptional events favoring MZ B cell entry into the cell cycle. Flow cytometric analysis of proliferation-induced dilution of carboxyfluorescein succinimidyl ester (CFSE) demonstrated that TACI engagement by APRIL was not sufficient to stimulate the proliferation of MZ or follicular B cells (Fig. 19A,B). This result was not unexpected, because TACI requires co-signals from TLRs, BCR and/or cytokines to induce MZ B cell proliferation, CSR and antibody production65, 163. Thus, we performed additional proliferation assays by stimulating MZ or follicular B cells with a combination of APRIL and CpG DNA, a TLR9 ligand that provides powerful mitogenic signals to B cells. Figure 18. TACI uses mTOR to enhance Cyclin D1 expression in MZ B cells. QRT-PCR of Cyclin D1 transcripts in MZ B cell and treated for 6h with 500 ng/mL APRIL in the presence or absence of 10 nM rapamycin (rapa). Results are normalized to β-actin transcripts. RE, relative expression compared to control (Ctrl) unstimulated MZ B cells. Data summarize three experiments. Error bars, SEM. *P < 0.05 (two-tailed unpaired Student's t-test). n.s.., not significant. Page 88 We found that a combination of APRIL and CpG DNA induced more MZ and follicular B cell proliferation than APRIL alone or CpG DNA alone (Fig. 19A,B). Consistent with earlier results showing that MZ B cells expressed more TACI and TLR9 than follicular B cells did, we also found that a combination of APRIL and CpG DNA stimulated more proliferation in MZ B cells than in follicular B cells (Fig. 19A,B). In agreement with the ability of both TACI and TLR9 to recruit mTOR, rapamycin inhibited the proliferation of MZ B cells exposed to either a combination of APRIL and CpG DNA or CpG DNA alone (Fig. 19A). Rapamycin had a more modest inhibitory effect on follicular B cells (Fig. 19B), which again reflected the lower expression of both TACI and TLR9 by follicular B cells as compared to MZ B cells. Overall, these data indicate that TACI recruits mTOR to enhance TLR9-driven proliferation in MZ B cells. A Page 89 B C Page 90 Figure 19. TACI recruits mTOR to enhance TLR9-mediated MZ B cell proliferation. (A,B) Splenic MZ and follicular B cells were stained with CFSE , cultured in the medium only (Ctrl) and treated with 500 ng/mL APRIL and/or 0,1 µg/mL CpG DNA in the presence or absence of 10 nM rapamycin. Numbers indicate the frequency of proliferating B cells that have diluted CFSE. (C) Summary of three experiments. Error bars, SEM. *P < 0.05 (two-tailed unpaired Student's t-test). Given that TACI and TLR9 functionally cooperate in MZ B cells through a pathway involving MyD88 and mTOR, we wondered whether TACI and TLR9 could undergo physical interaction in response to cognate ligands. This interaction must occur in an intracellular compartment, because TLR9 inhabits endosomes and needs to traffic into endolysosomes to signal via MyD88. Ligand-induced endolysosomal trafficking of TLR9 promotes proteolytic cleavage of its ectodmain by cathepsin L and recruitment of MyD88 to the TIR domain of truncated TLR9. This implies that TACI-TLR9 cooperation may involve ligandinduced endocytosis of TACI and subsequent endolysosomal interaction of TACI with truncated TLR9. Consistent with this possibility, TACIrelated molecules such as Fas have been previously shown to signal from intracellular compartments after engagement by cognate ligands213. Co-IP assays followed by IB demonstrated ligand-induced intracellular association of TACI with truncated TLR9 in splenic B cells exposed to a combination of APRIL and CpG DNA (Fig. 20). Of note, TACI interacted with truncated TLR9 also in response to APRIL alone, possibly due to the ability of signals from TACI to induce cleavage of TLR9. Conversely, truncated TLR9 interacted with TACI in response to CpG DNA alone, possibly due to the ability of CpG DNA to induce autocrine B cell release of APRIL. Alternatively, a pool of TACI proteins may constitutively inhabit endosomes and subsequently move to endolysosomes to interact with truncated TLR9 in response to CpG DNA. Ongoing experiments are testing these various possibilities as well as the involvement of mTOR in the intracellular interaction of TACI with truncated TLR9. Page 91 Figure 20. TACI interacts with truncated TLR9. Splenic B cells were cultured in the medium only (Ctrl) and stimulated with 500 ng/ml APRIL in the presence or absence of 0,1 µg/ml CpG DNA for 30 min. Whole cell extracts were subjected to IB with antibodies to TLR9 or TACI following IP with a control (IgG) antibody or an antibody to TACI. Truncated TLR9 is shown as a 65-kDa band. Arrowhead indicates specific band. Data are from one of three experiments yielding similar results. Collectively, these experiments indicate that TACI recruits mTOR to enhance MZ B cell proliferation through a TLR9-cooperative pathway that may involve intracellular interaction of TACI with truncated TLR9. TACI enhances antibody production through mTOR MZ B cells co-stimulated via TACI and TLR9 rapidly differentiate into antibody-secreting plasma cells. This maturation process usually requires up-regulation of the plasma cell master plasma cell differentiation transcription factor BLIMP-1, up-regulation of the secretory apparatusstimulating protein XBP-1, and down-regulation of the B cellspecification transcription factor PAX-5104, 100 . To determine the involvement of mTOR in TACI-induced plasma cell differentiaton and antibody production, we stimulated MZ B cells with APRIL and CpG DNA in the presence or absence of rapamycin. QRT-PCRs demonstrated the up-regulation of transcripts for BLIMP-1 and XBP-1 and the down- Page 92 regulation of transcripts for PAX-5 in MZ B cells exposed to APRIL alone, CpG DNA alone or a combination of APRIL and CpG DNA (Fig. 21). These plasma cell differentiation-related transcriptional changes were inhibited by rapamycin, indicating that TACI and TLR9 recruit mTOR to enhance the differentiation of MZ B cells into antibody-secreting plasma cells. Figure 21. TACI and TLR9 induce plasmablast-related transcriptional changes by activating MZ B cells through mTOR. (A) Schematics of transcriptional regulation of plasma cell differentiation. (B) QRT-PCRs of BLIMP-1, XBP-1 and PAX-5 transcripts in MZ B cells cultured for 72 h in the presence or absence of 500 ng/ml, APRIL, 0,1 µg/ml CpG DNA and/or 10 nM rapamycin (rapa). Results are normalized to β-actin mRNA. RE, relative expression compared to unstimulated (Ctrl) MZ B cells. The data summarize three experiments (error bars, SEM). *P < 0.05 (two-tailed unpaired Student's t- Page 93 test). N.S., not significant. We then used flow cytometry to quantify the differentiation of MZ or follicular B cells into plasmablasts expressing elevated surface CD27 and CD38. Neither MZ nor follicular B cells differentiated into plasmablasts in response to APRIL alone, suggesting that APRIL-induced transcriptional changes of BLIMP-1, XBP-1 and PAX-5 are insufficient to induce a full-blown plasma cell differentiation program (Fig. 22 A-C). Consistent with their higher expression of TLR9, a fraction of MZ B cells underwent plasmablast differentiation in response to CpG DNA, whereas follicular B cells did not (Fig. 22 A-C). A B Page 94 C Figure 22. TACI and TLR9 enhance the differentiation of MZ B cells into plasmablasts through mTOR. (A,B) Flow cytometry of viable DAPI– CD27hiCD38hi plasmablasts from MZ and follicular B cells cultured for 5 d with 500 ng/ml APRIL, 0,1 µg/ml of CpG DNA and/or 10 nM rapamycin (rapa). Data are from one of three experiments with similar results. (C) Summary of three plasmablast induction experiments. Error bars, SEM. *P < 0.05 (two-tailed unpaired Student's t-test). Of note, a combination of APRIL and CpG DNA stimulated more plasmablast differentiation than did APRIL or CpG DNA alone (Fig. 22 A-C). Finally, rapamycin inhibited the induction of plasmablast differentiation by CpG DNA alone or combined with APRIL (Fig. 22 AC). These data indicate that TACI and TLR9 recruit mTOR to enhance the Page 95 formation of MZ B cells into plasmablasts via a BLIMP-1-dependent differentiation program. Next, we verified whether TACI and TLR9 could enhance antibody secretion through mTOR. Consistent with earlier transcriptional and phenotypic data, ELISAs demonstrated that a combination of APRIL and CpG DNA induced MZ B cells to secrete some IgM as well as classswitched IgG and IgA antibodies (Fig. 23A). CpG DNA alone stimulated less antibody secretion than APRIL and CpG DNA, whereas APRIL alone showed no antibody-inducing effect. Of note, rapamycin inhibited antibody secretion in MZ B cells exposed to APRIL and CpG DNA or CpG DNA alone (Fig. 23A). Page 96 Figure 23. TACI and TLR9 enhance antibody secretion through mTOR. ELISAs of total IgM, IgG and IgA released by MZ B cells after incubation for 5 d with 500 ng/mL APRIL, 0,1 µg/ml CpG DNA and/or 10 nM rapamycin (rapa). Data summarize three experiments. Error bars, SEM. *P < 0.05 (two-tailed unpaired Student's t-test). Finally, we used flow cytometry to verify whether rapamycin inhibits plasmablast differentiation by impacting on the survival of MZ B cells. We found that APRIL alone or CpG DNA alone enhanced the survival of MZ B cells, but this effect was not inhibited by rapamycin (Fig. 23A,B). When combined with CpG DNA, APRIL did not further increase MZ B cell survival (Fig. 23A,B). These results indicate that mTOR enhances plasmablast differentiation by influencing the transcriptional programs rather than the survival of MZ B cells stimulated via TACI and TLR9. Page 97 A B B Figure 24. mTOR does not interfere with the survival of MZ B cells stimulated through TACI and TLR9. (A) Flow cytometry of viable AnnexinV–PI– MZ B cells cultured for 5 d with 500 ng/mL APRIL, 0,1 µg/ml CpG DNA and/or 10 nM rapamycin (rapa). PI, propidium iodide. Numbers indicate frequency of viable cells. (B) Summary of three experiments. Error bars, SEM. *P < 0.05 (two-tailed unpaired Student's t-test). Page 98 CHAPTER 5 DISCUSSION 99 Discussion Page 100 DISCUSSION We have shown that APRIL activated MZ B cells through mTORdependent signals emanating from TACI. APRIL induced the recruitment of mTOR to the intracellular domain of TACI via a rapamycin-sensitive pathway that required the TLR-associated adaptor protein MyD88. Indeed, TACI used a MyD88-binding site to recruit mTOR through a mechanism that involved the interaction of the central-terminal region of mTOR with the TIR domain of MyD88. In addition to triggering a classical signaling cascade encompassing P70S6K and 4E-BP1, mTOR enhanced the induction of NF-κB by TACI, thereby augmenting CSR and antibody production in MZ B cells exposed to APRIL. These responses further increased in the presence of co-signals from TLR9, a CpG DNA sensor that shares MyD88 and mTOR with TACI. Accordingly, TACI interacted with TLR9 in MZ B cells exposed to APRIL and CpG DNA. By showing that TACI uses mTOR to activate MZ B cells, our data indicate that mTOR has a nodal position in the signaling networks underlying innate-like antibody responses. TACI links MZ B cells with the innate immune system Splenic MZ B cells serve as professional sentinels in an anatomical area continually exposed to small amounts of blood-borne antigens derived from apoptotic cells and commensal bacteria. MZ B cells provide additional protection against blood-borne pathogens, including viruses and encapsulated bacteria. Unlike follicular B cells, MZ B cells are poised to rapidly mount low-affinity IgM as well as class-switched IgG responses without requiring help from T cells. Our findings indicate that this innatelike function involves the expression of elevated levels of both TACI and TLRs. Accordingly, microbial products not only directly stimulate MZ B cells by triggering B cell-intrinsic TLRs, but also induce the production of Page 101 TACI ligands (i.e., BAFF and APRIL) by engaging TLRs in DCs, macrophages, neutrophils and possibly ILCs152. Furthermore, TLR ligands up-regulate TACI expression in MZ B cells200,143, a finding that echoes other studies showing the central role of TLR signals in the autoimmune pathology arising in transgenic mice overexpressing BAFF214. Of note, innate immune cells express TACI ligands also in response to TLRinduced cytokines such as IFN-α, IFN-γ, IL-10 and granulocyte colony stimulating factor (G-CSF)152,155. In general, the convergence of TACI and TLR ligands into B cell-stimulating signaling pathways engenders the optimization of TI antibody responses in the MZ. By highlighting the central role of TACI in the stimulation of NF-κB in MZ B cells, our data extend previous studies showing that TACI elicits the recruitment of TRAF2 and TRAF6 adaptor proteins in B cells exposed to BAFF or APRIL. Similar to CD40, TACI recruits TRAF2 and TRAF6 to stimulate the canonical IKK-dependent NF-κB pathway, which is required to induce B cell proliferation, CSR and plasma cell differentiation. We found that TACI further enhanced these NF-κBdependent responses by inducing a TLR-like pathway involving the MyD88 adaptor protein as well as IRAK1 and IRAK4 kinases positioned downstream of MyD88. This TLR-like signaling mode likely permits TACI to optimize its cooperation with TLRs, which are powerful inducers of canonical NF-κB signals in MZ B cells. Together with dual BCR and PRR engagement by conserved TLR ligands or carbohydrates, engagement of TACI by BAFF and APRIL may be pivotal to the formation of extrafollicular short-lived plasmablasts secreting large amounts of IgM and IgG. In addition to eliciting CSR and antibody production in MZ B cells, BAFF and APRIL would provide survival signals to MZ B cell-derived plasmablasts, possibly through a mechanism involving BAFF-R. By inducing rapid low-affinity antibody Page 102 responses to TI antigens, the combination of these BAFF-APRILdependent pathways would enable MZ B cells to bridge the temporal gap required for the induction of high-affinity IgG production by follicular B cells50. mTOR enhances TACI-TLR cooperation The molecular mechanism underlying the cooperation between TACI and TLRs pathways have been recently elucidated by our group65. BAFF and APRIL elicit CSR by inducing the recruitment of MyD88 to a highly conserved motif positioned in the intracellular domain of TACI. This MyD88-binding motif is different from the canonical TIR motif of TLRs and its position nearby a TRAF2-binding motif underscores the relevance of MyD88 to the activation of NF-κB in MZ B cells65. As recently published163, the cooperation between TACI and TLRs would further entail their physical interaction. Indeed, we found that TACI interacted with the cleaved (i.e., activated) form of TLR9 in B cells exposed to both APRIL and CpG DNA163. Given that TLR9 becomes signaling-competent following protease-mediated cleavage in a MyD88-containing 215 endolysosomal compartment , cooperative TACI-TLR9 interaction and signaling likely take place in the endolysosome following liganddependent endocytosis of TACI. Consistent with this possibility, the cytoplasm of B cells displaying robust TACI signaling contains abundant TACI-expressing vesicles. By showing that TACI recruits mTOR via a rapamycin-sensitive MyD88-dependent pathway, our findings add further complexity to the signaling network underlying the cooperation between TACI and TLRs. The kinase mTOR is a central regulator of cell metabolism, growth, proliferation and survival. However, mTOR also has immunological functions and indeed has been recently linked to the induction of IFN-α, a key antiviral and immunoenhancing cytokine, by pDCs exposed to TLR9 Page 103 ligands195. In these studies, genetic deletion of mTOR or p70S6K through RNA interference impaired the production of IFN-α by disrupting both TLR9-MyD88 interaction and downstream IRF7 signaling. Additional studies have recently shown that TLRs use an mTOR-dependent rapamycin-sensitive pathway to stimulate the production of the antiinflammatory cytokine IL-10 by DCs, monocytes and macrophages216, 217. The use of TLR-like signaling modules by TACI prompted us to hypothesize that TACI recruits mTOR via MyD88. Consistent with this possibility, we found that engagement of TACI by APRIL elicited mTOR, 4E-BP1, p70S6 kinase and S6 phosphorylation through a pathway that was specifically inhibited by rapamycin. By using specific inhibitors, we also found that TACI activates mTOR through a pathway involving PI3K and Akt. These results clearly indicate that TACI delivers B cellstimulating signals by using a signaling complex that includes mTORC1. More in general, these data suggest that TACI enhances MZ B cell responses by linking immunological and metabolic pathways via mTOR. Recent studies show that mTOR-regulated pathways controlling nutrient sensing and metabolic stress act as crucial regulators of innate immunity218 219 . While strong evidence supports the involvement of mTOR in protection against infections198, 220-222 , it remains unclear how microbial signals activate mTOR and whether microbes have evolved mechanisms to evade mTOR-dependent immune responses. Our analysis of TACI-mTOR interaction provides a molecular framework to better understand the complex crosstalk between immunity and metabolism. Molecular requirement of TACI-mTOR interaction Our studies show that the mTOR inhibitor rapamycin severely mitigates TACI signaling in MZ B cells. But does TACI physically interact with mTOR? This is an important question, because previous studies have provided little or no evidence of mTOR interaction with immune Page 104 receptors, including TLRs. By performing challenging co- immunoprecipitation studies, we obtained evidence that APRIL enhances the association of TACI with MyD88, mTOR, IRAK-1, IRAK-4, and TRAF2. Rapamycin, which is a specific mTORC1 inhibitor, attenuated the recruitment of mTOR, MyD88 and TRAF2 but not IRAK1 and IRAK4 to TACI. These findings suggest that the ternary mTORrapamycin-FKBP12 complex not only blocks the kinase activity of mTOR, but also modifies the composition of the TACI signaling complex, preventing the binding of MyD88, TRAF2 and mTOR to TACI. By taking advantage of TACI deletion mutants selectively missing specific functional domains, we found that TACI required its MyD88binding site, also known as THC domain, to interact with mTOR. This evidence points to a pivotal role of MyD88 in the recruitment of mTOR by TACI. Additional studies further defined the molecular requirements for TACI-MyD88-mTOR interaction. These studies showed that MyD88 interacted with mTOR through the TIR domain, which is located in the Cterminal region of MyD88 and is responsible for the binding of MyD88 to TLRs. The N-terminal death domain of MyD88, which accounts for the binding of MyD88 to IRAK4 and the propagation of downstream signals, was not involved in the interaction of MyD88 with mTOR. Finally, we found that mTOR uses its central-terminal region to bind MyD88. This region contains the FAT domain, which mediates the binding of mTOR to DEPTOR, which is a negative regulator of mTOR in both mTORC1 and mTORC2 complexes223. Importantly, DEPTOR undergoes proteasome-dependent degradation in the presence of signals that lead to the activation of mTOR224. When exposed to APRIL, B cells did not degrade DEPTOR (not shown), suggesting that the formation of the TACI-MyD88-mTOR complex simply displaces DEPTOR from mTOR to induce mTORC1 activation. Co-immunoprecipitation studies failed to evidence the presence of DEPTOR in the TACI signaling Page 105 complex, but this negative result could be due to technical reasons. Thus, further studies, including site-directed mutagenesis, will be necessary to define the precise composition and regulation of the TACI-MyD88mTOR complex. A recent work has characterized a S231R substitution in the THC motif of TACI from B cells of a patient with CVID, which is a primary immunodeficiency characterized by impaired antibody production225. The S231R substitution prevents the recruitment of MyD88 to TACI in response to APRIL, but its role in the recruitment of mTOR by TACI remains unknown. In future collaborative studies, we will take advantage of B cells from this CVID patient to further define the function of the TACI-MyD88-mTOR complex in B cell antibody production. Role of mTOR in TACI-mediated NF-κB activation TACI recruits TRAF2, TRAF6 and MyD88 adaptor proteins to induce activation of the IKK complex and nuclear translocation of NF-κB65, a transcription factor required for B cell proliferation, survival, CSR and antibody production. We found that this canonical NF-κB pathway further involved the recruitment and activation of mTOR by TACI. Indeed, inhibition of mTOR by rapamycin or torin1 inhibited the activation of IRAK-1, IRAK-4 and IKK, a kinase complex positioned downstream of TRAF2, TRAF6 and MyD88. Inhibition of mTOR also caused reduced TACI-dependent phosphorylation and degradation of IκBα, a cytoplasmic inhibitor of NF-κB. This inhibitory effect prevented TACI-induced nuclear translocation and DNA binding of NF-κB p65 and p50, two canonical NF-κB proteins required for the expression of AID and the induction of CSR. Accordingly, AID expression and CSR from IgM to IgG decreased in MZ B cells stimulated through TACI. Our findings in B cells are consistent with previously published studies in malignant prostate cells lacking PTEN, a phosphatase and Page 106 tumor suppressor that inhibits PI3K. These studies show that aberrant PI3K-mediated mTOR activation dysregulate NF-κB activation by causing interaction of mTOR with the IKK complex226. Along the same lines, tumors lacking PTEN appear to exhibit increased sensitivity to rapamycin227, 228 . In our study, mTOR amplified TACI-induced NF-κB activation through a rapamycin-sensitive mechanism that involved the formation of a TACI-MyD88-mTOR complex. Indeed, overexpression of TSC1 and TSC2, two physiological inhibitors of mTOR, interfered with the activation of NF-κB by TACI. A similar inhibitory effect followed the overexpression of the C-terminal or central but not N-terminal regions of mTOR. Owing to their ability to associate with TACI, the C-terminal and central segments of mTOR may exert a dominant-negative effect by preventing the recruitment of functionally intact mTOR to TACI (Fig. 25). Should this be the case, the activation of NF-κB by TACI may be highly dependent on the N-terminal region of mTOR. Figure 25. The N-terminal region of mTOR is required for the activation of NF-κB by TACI. (A,B) Co-transfection of 293 cells with plasmids encoding TACI and full-length or N-terminal mTOR is followed by the formation of a ternary TACI-MyD88-mTOR complex that activates NF-κB. (C,D) Cotransfection of 293 cells with plasmids encoding TACI and either central or Cterminal regions of mTOR interferes with the activation of NF-κB by TACI, possibly because the central and C-terminal regions of mTOR displace intact endogenous mTOR from the ternary TACI-MyD88-mTOR complex. Role of mTOR in TACI-induced CSR and antibody production Published studies indicate that engagement of TACI on MZ B cells by BAFF and APRIL triggers the induction of IgM as well as class-switched Page 107 Ig to inducing B cell prolG and IgA responses against TI antigens65. This pathway receives reinforcing signals from CpG DNA, which up-regulates TACI expression on MZ B cells. In agreement with these findings and with the known pre-activated state of MZ B cells, we detected more elevated expression of TACI and TLR9 in MZ B cells than follicular B cells. Furthermore, we found that TACI and TLR9 synergistically cooperate to induce antibody production, a process highly dependent on NF-κB. In addition to inducing B cell proliferation and survival, NF-κB elicits the expression of AID, a DNA-editing enzyme required for the induction of CSR from IgM to IgG or IgA65. By showing that TACI activated the transcription factor CREB through a rapamycin-sensitive pathway, our findings suggest that TACI finely tunes canonical NF-κB signals via mTOR. Indeed, published works show that the transcriptional activation of several NF-κB-responsive genes involves the interaction of NF-κB with CREB co-activators, including CREB binding protein (CBP) and p300229, 230 . Among other effects, these proteins enhance the acetylation of NF-κB (namely p65), which stabilizes the binding of NF-κB to DNA202, 203. However, the NF-κB region that binds CBP and p300 also interacts with CREB. Given that CREB attenuates NF-κB-dependent gene activation by competing with CBP and p300 for binding to NF-κB231, 232, TACI may activate CREB via mTOR to restrain NF-κB-mediated gene transcription. Should this be the case, TACI may use mTOR to establish both positive (at the level of IKK) and negative (at the level of CBP/p300) checkpoints along the antibody-inducing NF-κB signaling pathway. By up-regulating AID expression as well as germline Cγ and Cα transcription via NF-κB, mTOR enhanced the induction of IgG and IgA CSR in MZ B cells activated via TACI. Indeed, when exposed to APRIL in the presence of rapamycin, MZ B cells contained less abundant hallmarks of ongoing IgG and IgA CSR, including AID transcripts, Page 108 germline transcripts and switch circle transcripts. Besides helping TACImediated CSR through the induction of AID, mTOR might contribute to the post-translational modifications required for the DNA-editing function of AID, including AID oligomerization, nuclear-cytoplasmic translocation, phosphorylation and polyubiquitination233. Consistent with this possibility, mTOR is known to establish a functional interplay with protein kinase A (PKA), an enzyme required for AID function. Indeed, PKA phosphorylates AID at a serine residue involved in the recruitment of replication protein A (RPA), an AID co-factor required for the binding of AID to actively transcribed S regions234. Notably, AID expression positively correlates with B cell proliferation235. Accordingly, our data show that TACI used mTOR to induce some cell cycle-related gene products, including cyclin D1 and p38. Both these proteins are also involved in the induction of B cell proliferation by CD40236. Despite increasing cyclin D1 expression and p38 activation in a mTOR-dependent manner, TACI was not sufficient to trigger significant proliferation of MZ B cells. However, in the presence of TLR9 co-signals, TACI engagement by APRIL not only induced substantial B cell proliferation, but also triggered plasma cell differentiation as well as IgM, IgG and IgA secretion in a rapamycinsensitive manner. The mechanism whereby mTOR facilitates these synergistic effects remains to be elucidated. Following ligation-mediated endocytosis of TACI, MyD88 may recruit mTOR to form a molecular bridge that physically and functionally links TACI with TLR9. Consistent with this possibility, we recently found that TACI co-localizes with cleaved (i.e., active) TLR9 in a subcellular compartment of B cells coactivated by APRIL and CpG DNA. Interestingly, mTOR-dependent signals from TACI and TLR9 induced not only IgG1, which is an IgG subclass that predominantly targets protein antigens, but also IgG2 (data not shown), which is an IgG Page 109 subclass that predominantly targets polysaccharide antigens. However, IgG2 induction was mostly limited to MZ rather than follicular B cells. This finding points to the involvement of TACI and mTOR in IgG2 responses to polysaccharide-containing bacteria, including Streptococcus pneumoniae. This pathogen is developing increasing resistance to penicillins or macrolides and some of its strains are partially or totally resistant to multiple classes of antibiotics. Due to this problem, there is an urgent need for more efficacious vaccines. Our findings indicate that polysaccharide-containing vaccines capable to stimulate the TACI-mTOR axis may ameliorate protective IgM and IgG2 responses by MZ B cells. Clinical implications Rapamycin is usually considered an immunosuppressing and ntiproliferative drug that predominantly inhibits T cells. Indeed, rapamycin is being used as an immunosuppressive agent in transplants recipients237. Rapamycin is also used as an anti-proliferative agent in certain cancers and cardiological disorders, including aortic stenosis237. By showing that mTOR contributes to the activation of B cells via TACI, our findings indicate that rapamycin could also have beneficial effects in B cell disorders. In agreement with this possibility, a recently published study indicates that rapamycin ameliorates antiviral responses by B cells. Indeed, treatment with rapamycin during primary infection with influenza virus H3N2 protected mice against a lethal, heterosubtypic, secondary infection with H5N1, H7N9 or H1N1198. In this setting, rapamycin impaired IgG class switching and decreased the frequency of antibodies reactive against specific viral epitopes, while increasing the frequency of antibodies reactive against conserved neutralizing epitopes. Combined, these effects yielded a unique broadly reactive antibody repertoire that generated heterosubtypic protection198. Thus, rapamycin may help to develop a “universal” vaccine against influenza. Page 110 Rapamycin could also be utilized to restrain the growth of B cell tumors such as chronic lymphocytic leukaemia (CLL), non-Hodgkin lymphoma, Waldenstrom macroglobulinemia and multiple myeloma. In these lymphoid cancers, the serum levels of BAFF and APRIL are increased238. In addition, malignant B cells express TACI, which stimulates neoplastic B cell growth and survival by generating signals in response to both autocrine and paracrine BAFF and APRIL239. Rapamycin may also have a role in the therapy of autoimmune and allergic disorders. In these inflammatory pathologies, the production of BAFF is increased and appears to contribute to the expansion of pathogenic B cells secreting pathogenic antibodies152,240, 241,242. In all these clinical settings, there is an active effort to develop novel BAFF and APRIL inhibitors. These inhibitors could be combined with existing drugs to reduce their side effects while obtaining a superior therapeutic advantage. Together with previous studies showing the involvement of mTOR in the BAFF-R pathway, our finding that mTOR contributes to TACI signaling strongly indicates that targeting of mTOR could be beneficial for the treatment of B cell disorders associated with dysregulated BAFF and APRIL production. Page 111 Page 112 CHAPTER 6 CONCLUSIONS Page 113 Page 114 CONCLUSIONS In this study we found that: • TACI enhances the activation of splenic MZ B cells through an mTOR pathway sensitive to rapamycin • TACI recruits mTOR through a mechanism involving the adaptor protein MyD88 • TACI, MyD88 and mTOR form a receptor complex involving THC, TIR and FAT motifs, respectively • TACI activates mTOR in the context of a PI3K-AKTmTORC1 signaling pathway • TACI activates mTOR to enhance signaling via a downstream IRAK1-IRAK4-IKK-NF-κB pathway • TACI activates mTOR to enhance NF-κB-dependent CSR • TACI activates mTOR to enhance BLIMP-1-dependent plasma cell differentiation and antibody production Page 115 Figure 26. Model of TACI signaling through mTOR. Engagement of TACI on MZ B cells by APRIL recruits mTOR through a mechanism involving interaction of the FAT domain of mTOR with the TIR domain of MyD88. The ID domain of MyD88 further interacts with the THC motif of TACI, thereby generating a TACI-MyD88-mTOR signaling complex. In this complex, mTOR is positively regulated by signals from PI3K and AKT, which remove the inhibitory activity of the TSC-1-TSC-2 complex on mTOR. The resulting activation of mTOR causes induction of a canonical mTORC1 pathway involving phosphoylation of 4E-BP1, p70S6K and S6 substrates. Furthermore, mTOR enhances the activation of IRAK-1 and IRAK-4, two kinases associated with MyD88 and functionally linked to the IKK complex. Thus, activated mTOR also enhances the activation of IKK, thereby inducing nuclear translocation of NF-κB, including p50-p65 dimers. Induction of NF-κB-responsive genes triggers B cell proliferation, AIDdependent CSR, and antibody production. The latter involves plasma cell differentiation, the induction of which may involve additional mTOR-activated Page 116 transcription factors, including BLIMP-1, STAT5 and CREB. Of note, TACI induces MZ B cell proliferation and antibody production in cooperation with TLR9, a CpG receptor located in endosomes. In the presence of CpG DNA, TLR9 traffics into endolysosomes and undergoes proteolytic cleavage to signal via MyD88 and mTOR. This process is associated with physical interaction of truncated (i.e., active) TLR9 with TACI, which may facilitate the formation of a shared MyD88-mTOR-IRAK signaling complex. Page 117 Page 118 PUBLICATIONS Original Articles • Gutzeit C, Nagy N, Gentile M, Lyberg K, Gumz J, Vallhov H, Klein E, Gabrielsson S, Cerutti A, and Annika Scheynius. Burkitt´s lymphoma cell lines induce proliferation, differentiation and class switch recombination in B cells Journal of Immunology, 192, 5852-5862 (2014). • Magri G, Miyajima M, Bascones S, Mortha A, Puga I, Cassis L, Barra CM, Comerma L, Chudnovskiy A, Gentile M, Llige D, Cols M, Serrano S, Aróstegui JI, Juan M, Yagüe J, Merad M, Fagarasan S, Cerutti A. Innate lymphoid cells integrate stromal and immunological signals to enhance antibody production by splenic marginal zone B cells. Nature Immunology, 15, 354-364 (2014). • Shan M, Gentile M, John R. Walland Y, Bomstein V, Kang, Chen K, He B, Cassis L, Bigas A, Cols M, Comerma L, Blander M, Xiong X, Meyer L, Berin C, Augenlicht L, Velchic A, Cerutti A. Mucus Imprints Intestinal Dendritic Cells with Tolerogeni Properties Science, 342, 447-453 (2013). • Romberg N, Nicolas C, Saadoun D, Gentile M, Kinnunen T, Shing NY, Virdee M, Menard L, Cantaert T, Morbach H, Rachid R, Martinez-Pomar N, Matamoros N, Geha R, Grimbacher B, Cerutti A, Cunningham-Rundles C, Meffre E. TACI mutations associated with CVID affect autoreactive B-cell selection and activation Journal Clinical Investigation, 123, 4283-4293 (2013). • Melchers M, Bontjer I, Tong T, Chung NP, Klasse PJ, Eggink D, Montefiori DC, Gentile M, Cerutti A, Olson WC, Berkhout B, Binley JM, Moore JP, Sanders RW. Targeting HIV-1 envelope glycoprotein trimers to B cells by using APRIL inproves antibody responses. Journal of Virology, 86, 2488-2500 (2012). • Puga I, Cols M, Barra CM, He B, Cassis L, Gentile M, Comerma L, Chorny A, Shan M, Xu W, Magri G, et al. B cell-helper neutrophils stimulate the diversification and production of immunoglobulin in the marginal zone of the spleen. Nature Immunology, 13, 170-180 (2012). Page 119 • • Calvayrac O, Rodríguez-Calvo R, Alonso J, Orbe J, MartínVentura JL, Guadall A, Gentile M, et al. CCL20 is increased in hypercholesterolemic subjects and is upregulated by LDL in vascular smooth muscle cells: role of NF-κB. Arteriosclerosis Thrombosis and Vascular Biology, 31, 27332741 (2011). • Gentile M*, Martorell Ll*, Rius J, Rodríguez C, Badimon L, Martínez-González J. The HIF-NOR1 axis regulates the survival response of endothelial cells to hypoxia. Molecular Cell Biology, 29, 5828-5842 (2009). • Martorell Ll, Martínez-González J, Rodríguez C, Gentile M, Calvayrac O, Badimon L. Thrombin and protease-activated receptors (PARs) in atherothrombosis. Journal of Thrombosis and Haemostasis, 99, 305-315 (2008). • Martorell Ll, Rodríguez C, Calvayrac O, Gentile M, Badimon L, Martínez-González J. Vascular effects of thrombin: involvement of NOR-1 in thrombin-induced mitogenic stimulus in vascular cells. Frontiers in Bioscience, 13, 2909-2915 (2008). Reviews • Cerutti A, Cols M, Gentile M, Cassis L, Barra CM, He B, Puga I, Chen K. Regulation of mucosal IgA responses: lessons from primary immunodeficiencies. Annals of New York Academy of Science 2011, 1238, 132-144 (2011). Books • Cerutti A, Magri G, Cols M, Cassis L, Gutzeit C, Chorny A, Gentile M, Barra CM and Puga I.The Immune System. Knowles’ Neoplastic Hematopathology. Wolters Kluwer Health Editorial, 2012. Page 120 References 1. Janeway, C.A., Jr. Approaching the asymptote? Evolution and revolution in immunology. Cold Spring Harb Symp Quant Biol 54 Pt 1, 1-13 (1989). 2. Janeway, C.A., Jr. & Medzhitov, R. Innate immune recognition. Annu Rev Immunol 20, 197-216 (2002). 3. Hoebe, K., Janssen, E. & Beutler, B. The interface between innate and adaptive immunity. Nat Immunol 5, 971-974 (2004). 4. Cooper, M.D. & Alder, M.N. The evolution of adaptive immune systems. Cell 124, 815-822 (2006). 5. Janeway, C.A., Jr. The immune system evolved to discriminate infectious nonself from noninfectious self. Immunol Today 13, 1116 (1992). 6. Fearon, D.T. & Locksley, R.M. The instructive role of innate immunity in the acquired immune response. Science 272, 50-53 (1996). 7. Iwasaki, A. & Medzhitov, R. Regulation of adaptive immunity by the innate immune system. Science 327, 291-295 (2010). 8. Macpherson, A.J. & Harris, N.L. Interactions between commensal intestinal bacteria and the immune system. Nat Rev Immunol 4, 478-485 (2004). 9. Bottazzi, B., Doni, A., Garlanda, C. & Mantovani, A. An integrated view of humoral innate immunity: pentraxins as a paradigm. Annu Rev Immunol 28, 157-183 (2010). 10. Kufer, T.A., Fritz, J.H. & Philpott, D.J. NACHT-LRR proteins (NLRs) in bacterial infection and immunity. Trends Microbiol 13, 381-388 (2005). 11. Martinon, F., Mayor, A. & Tschopp, J. The inflammasomes: guardians of the body. Annu Rev Immunol 27, 229-265 (2009). Page 121 12. Rehwinkel, J. & Reis e Sousa, C. RIGorous detection: exposing virus through RNA sensing. Science 327, 284-286 (2010). 13. Geijtenbeek, T.B. & Gringhuis, S.I. Signalling through C-type lectin receptors: shaping immune responses. Nat Rev Immunol 9, 465-479 (2009). 14. Kawai, T. & Akira, S. Toll-like receptors and their crosstalk with other innate receptors in infection and immunity. Immunity 34, 637-650 (2011). 15. Botos, I., Segal, D.M. & Davies, D.R. The structural biology of Toll-like receptors. Structure 19, 447-459 (2011). 16. Palm, N.W. & Medzhitov, R. Pattern recognition receptors and control of adaptive immunity. Immunol Rev 227, 221-233 (2009). 17. Aderem, A. & Ulevitch, R.J. Toll-like receptors in the induction of the innate immune response. Nature 406, 782-787 (2000). 18. Sansonetti, P.J. The innate signaling of dangers and the dangers of innate signaling. Nat Immunol 7, 1237-1242 (2006). 19. Borregaard, N. Neutrophils, from marrow to microbes. Immunity 33, 657-670 (2010). 20. Caligiuri, M.A. Human natural killer cells. Blood 112, 461-469 (2008). 21. Serbina, N.V., Jia, T., Hohl, T.M. & Pamer, E.G. Monocytemediated defense against microbial pathogens. Annu Rev Immunol 26, 421-452 (2008). 22. Geissmann, F. et al. Development of monocytes, macrophages, and dendritic cells. Science 327, 656-661 (2010). 23. Adams, D.O. & Hamilton, T.A. The cell biology of macrophage activation. Annu Rev Immunol 2, 283-318 (1984). 24. Sallusto, F. & Lanzavecchia, A. The instructive role of dendritic cells on T-cell responses. Arthritis Res 4 Suppl 3, S127-132 (2002). Page 122 25. Steinman, R.M. & Hemmi, H. Dendritic cells: translating innate to adaptive immunity. Curr Top Microbiol Immunol 311, 17-58 (2006). 26. Hashimoto, D., Miller, J. & Merad, M. Dendritic cell and macrophage heterogeneity in vivo. Immunity 35, 323-335 (2011). 27. Kita, H. Eosinophils: multifaceted biological properties and roles in health and disease. Immunol Rev 242, 161-177 (2011). 28. Pulendran, B. Modulating TH1/TH2 responses with microbes, dendritic cells, and pathogen recognition receptors. Immunol Res 29, 187-196 (2004). 29. Kool, M., Hammad, H. & Lambrecht, B.N. Cellular networks controlling Th2 polarization in allergy and immunity. F1000 Biol Rep 4, 6 (2012). 30. Sleckman, B.P. et al. Accessibility control of variable region gene assembly during T-cell development. Immunol Rev 165, 121-130 (1998). 31. Ehlich, A. & Kuppers, R. Analysis of immunoglobulin gene rearrangements in single B cells. Curr Opin Immunol 7, 281-284 (1995). 32. Cornall, R.J., Goodnow, C.C. & Cyster, J.G. The regulation of self-reactive B cells. Curr Opin Immunol 7, 804-811 (1995). 33. Zerrahn, J., Held, W. & Raulet, D.H. The MHC reactivity of the T cell repertoire prior to positive and negative selection. Cell 88, 627-636 (1997). 34. Zhang, J., Liu, Y.J., MacLennan, I.C., Gray, D. & Lane, P.J. B cell memory to thymus-independent antigens type 1 and type 2: the role of lipopolysaccharide in B memory induction. Eur J Immunol 18, 1417-1424 (1988). 35. Janeway, C.A., Jr., Ron, J. & Katz, M.E. The B cell is the initiating antigen-presenting cell in peripheral lymph nodes. J Immunol 138, 1051-1055 (1987). Page 123 36. von Boehmer, H. & Melchers, F. Checkpoints in lymphocyte development and autoimmune disease. Nat Immunol 11, 14-20 (2010). 37. Orkin, S.H. & Zon, L.I. Hematopoiesis: an evolving paradigm for stem cell biology. Cell 132, 631-644 (2008). 38. Cooper, M.D., Raymond, D.A., Peterson, R.D., South, M.A. & Good, R.A. The functions of the thymus system and the bursa system in the chicken. J Exp Med 123, 75-102 (1966). 39. Alt, F.W., Blackwell, T.K. & Yancopoulos, G.D. Development of the primary antibody repertoire. Science 238, 1079-1087 (1987). 40. LeBien, T.W. & Tedder, T.F. B lymphocytes: how they develop and function. Blood 112, 1570-1580 (2008). 41. Kondo, M. et al. Biology of hematopoietic stem cells and progenitors: implications for clinical application. Annu Rev Immunol 21, 759-806 (2003). 42. Busslinger, M. Transcriptional control of early development. Annu Rev Immunol 22, 55-79 (2004). 43. Oettinger, M.A., Schatz, D.G., Gorka, C. & Baltimore, D. RAG-1 and RAG-2, adjacent genes that synergistically activate V(D)J recombination. Science 248, 1517-1523 (1990). 44. Schwarz, K. et al. RAG mutations in human B cell-negative SCID. Science 274, 97-99 (1996). 45. Yancopoulos, G.D. & Alt, F.W. Developmentally controlled and tissue-specific expression of unrearranged VH gene segments. Cell 40, 271-281 (1985). 46. Lewis, S.M. The mechanism of V(D)J joining: lessons from molecular, immunological, and comparative analyses. Adv Immunol 56, 27-150 (1994). 47. Herzog, S., Reth, M. & Jumaa, H. Regulation of B-cell proliferation and differentiation by pre-B-cell receptor signalling. Nat Rev Immunol 9, 195-205 (2009). Page 124 B cell 48. Chen, K. & Cerutti, A. The function and regulation of immunoglobulin D. Curr Opin Immunol 23, 345-352 (2011). 49. Honjo, T., Kinoshita, K. & Muramatsu, M. Molecular mechanism of class switch recombination: linkage with somatic hypermutation. Annu Rev Immunol 20, 165-196 (2002). 50. Pone, E.J. et al. BCR-signalling synergizes with TLR-signalling for induction of AID and immunoglobulin class-switching through the non-canonical NF-kappaB pathway. Nat Commun 3, 767 (2012). 51. Cerutti, A. et al. CD40 ligand and appropriate cytokines induce switching to IgG, IgA, and IgE and coordinated germinal center and plasmacytoid phenotypic differentiation in a human monoclonal IgM+IgD+ B cell line. J Immunol 160, 2145-2157 (1998). 52. Weller, S. et al. Human blood IgM "memory" B cells are circulating splenic marginal zone B cells harboring a prediversified immunoglobulin repertoire. Blood 104, 3647-3654 (2004). 53. William, J., Euler, C., Christensen, S. & Shlomchik, M.J. Evolution of autoantibody responses via somatic hypermutation outside of germinal centers. Science 297, 2066-2070 (2002). 54. Stavnezer, J., Guikema, J.E. & Schrader, C.E. Mechanism and regulation of class switch recombination. Annu Rev Immunol 26, 261-292 (2008). 55. Wagner, S.D. & Neuberger, M.S. Somatic hypermutation of immunoglobulin genes. Annu Rev Immunol 14, 441-457 (1996). 56. Rajewsky, K., Forster, I. & Cumano, A. Evolutionary and somatic selection of the antibody repertoire in the mouse. Science 238, 1088-1094 (1987). 57. Di Noia, J.M. & Neuberger, M.S. Molecular mechanisms of antibody somatic hypermutation. Annu Rev Biochem 76, 1-22 (2007). Page 125 58. Odegard, V.H. & Schatz, D.G. Targeting of hypermutation. Nat Rev Immunol 6, 573-583 (2006). 59. Pasqualucci, L. et al. BCL-6 mutations in normal germinal center B cells: evidence of somatic hypermutation acting outside Ig loci. Proc Natl Acad Sci U S A 95, 11816-11821 (1998). 60. Muschen, M. et al. Rare occurrence of classical Hodgkin's disease as a T cell lymphoma. J Exp Med 191, 387-394 (2000). 61. Pasqualucci, L. et al. Hypermutation of multiple proto-oncogenes in B-cell diffuse large-cell lymphomas. Nature 412, 341-346 (2001). 62. Stavnezer, J. Antibody class switching. Adv Immunol 61, 79-146 (1996). 63. Kehry, M. et al. The immunoglobulin mu chains of membranebound and secreted IgM molecules differ in their C-terminal segments. Cell 21, 393-406 (1980). 64. Chen, K. & Cerutti, A. New insights into the enigma of immunoglobulin D. Immunol Rev 237, 160-179 (2010). 65. He, B. et al. The transmembrane activator TACI triggers immunoglobulin class switching by activating B cells through the adaptor MyD88. Nat Immunol 11, 836-845 (2010). 66. Ravetch, J.V. & Bolland, S. IgG Fc receptors. Annu Rev Immunol 19, 275-290 (2001). 67. Nimmerjahn, F. & Ravetch, J.V. Fc[gamma] receptors as regulators of immune responses. Nat Rev Immunol 8, 34-47 (2008). 68. Cerutti, A. The regulation of IgA class switching. Nat Rev Immunol 8, 421-434 (2008). 69. Fagarasan, S., Kawamoto, S., Kanagawa, O. & Suzuki, K. Adaptive immune regulation in the gut: T cell-dependent and T cell-independent IgA synthesis. Annu Rev Immunol 28, 243-273 (2010). Page 126 somatic 70. Macpherson, A.J., McCoy, K.D., Johansen, F.E. & Brandtzaeg, P. The immune geography of IgA induction and function. Mucosal Immunol 1, 11-22 (2008). 71. Monteiro, R.C. & Van De Winkel, J.G. IgA Fc receptors. Annu Rev Immunol 21, 177-204 (2003). 72. van Egmond, M. et al. IgA and the IgA Fc receptor. Trends Immunol 22, 205-211 (2001). 73. Geha, R.S., Jabara, H.H. & Brodeur, S.R. The regulation of immunoglobulin E class-switch recombination. Nat Rev Immunol 3, 721-732 (2003). 74. MacGlashan, D., Jr. IgE receptor and signal transduction in mast cells and basophils. Curr Opin Immunol 20, 717-723 (2008). 75. Kinet, J.P. The high-affinity IgE receptor (Fc epsilon RI): from physiology to pathology. Annu Rev Immunol 17, 931-972 (1999). 76. Gould, H.J. & Sutton, B.J. IgE in allergy and asthma today. Nat Rev Immunol 8, 205-217 (2008). 77. Hagan, P. IgE and protective immunity to helminth infections. Parasite Immunol 15, 1-4 (1993). 78. Burton, O.T. & Oettgen, H.C. Beyond immediate hypersensitivity: evolving roles for IgE antibodies in immune homeostasis and allergic diseases. Immunol Rev 242, 128-143 (2011). 79. Kawakami, T. & Kitaura, J. Mast cell survival and activation by IgE in the absence of antigen: a consideration of the biologic mechanisms and relevance. J Immunol 175, 4167-4173 (2005). 80. Gauchat, J.F. et al. Induction of human IgE synthesis in B cells by mast cells and basophils. Nature 365, 340-343 (1993). 81. Acharya, M. et al. CD23/FcepsilonRII: molecular multi-tasking. Clin Exp Immunol 162, 12-23 (2010). 82. Pape, K.A., Catron, D.M., Itano, A.A. & Jenkins, M.K. The humoral immune response is initiated in lymph nodes by B cells Page 127 that acquire soluble antigen directly in the follicles. Immunity 26, 491-502 (2007). 83. Qi, H., Egen, J.G., Huang, A.Y. & Germain, R.N. Extrafollicular activation of lymph node B cells by antigen-bearing dendritic cells. Science 312, 1672-1676 (2006). 84. Tew, J.G., Phipps, R.P. & Mandel, T.E. The maintenance and regulation of the humoral immune response: persisting antigen and the role of follicular antigen-binding dendritic cells as accessory cells. Immunol Rev 53, 175-201 (1980). 85. Phan, T.G., Grigorova, I., Okada, T. & Cyster, J.G. Subcapsular encounter and complement-dependent transport of immune complexes by lymph node B cells. Nat Immunol 8, 992-1000 (2007). 86. Youd, M.E., Ferguson, A.R. & Corley, R.B. Synergistic roles of IgM and complement in antigen trapping and follicular localization. Eur J Immunol 32, 2328-2337 (2002). 87. Ferguson, A.R., Youd, M.E. & Corley, R.B. Marginal zone B cells transport and deposit IgM-containing immune complexes onto follicular dendritic cells. Int Immunol 16, 1411-1422 (2004). 88. Sonoda, K.H. & Stein-Streilein, J. CD1d on antigen-transporting APC and splenic marginal zone B cells promotes NKT celldependent tolerance. Eur J Immunol 32, 848-857 (2002). 89. Lankar, D. et al. Dynamics of major histocompatibility complex class II compartments during B cell receptor-mediated cell activation. J Exp Med 195, 461-472 (2002). 90. Garside, P. et al. Visualization of specific B and T lymphocyte interactions in the lymph node. Science 281, 96-99 (1998). 91. Okada, T. et al. Antigen-engaged B cells undergo chemotaxis toward the T zone and form motile conjugates with helper T cells. PLoS Biol 3, e150 (2005). 92. Fazilleau, N., Mark, L., McHeyzer-Williams, L.J. & McHeyzerWilliams, M.G. Follicular helper T cells: lineage and location. Immunity 30, 324-335 (2009). Page 128 93. MacLennan, I.C. et al. Extrafollicular antibody responses. Immunol Rev 194, 8-18 (2003). 94. Cyster, J.G. B cell follicles and antigen encounters of the third kind. Nat Immunol 11, 989-996 (2010). 95. Crotty, S. Follicular helper CD4 T cells (TFH). Annu Rev Immunol 29, 621-663 (2011). 96. Vinuesa, C.G., Tangye, S.G., Moser, B. & Mackay, C.R. Follicular B helper T cells in antibody responses and autoimmunity. Nat Rev Immunol 5, 853-865 (2005). 97. Cannons, J.L. et al. Optimal germinal center responses require a multistage T cell:B cell adhesion process involving integrins, SLAM-associated protein, and CD84. Immunity 32, 253-265 (2010). 98. Victora, G.D. & Nussenzweig, M.C. Germinal centers. Annu Rev Immunol 30, 429-457 (2012). 99. Shapiro-Shelef, M. et al. Blimp-1 is required for the formation of immunoglobulin secreting plasma cells and pre-plasma memory B cells. Immunity 19, 607-620 (2003). 100. Calame, K.L., Lin, K.-I. & Tunyaplin, C. Regulatory mechanisms that determine the development and function of plasma cells. Annu Rev Immunol 21, 205-230 (2003). 101. Ye, B.H. et al. Alterations of a zinc finger-encoding gene, BCL-6, in diffuse large-cell lymphoma. Science 262, 747-750 (1993). 102. Dent, A.L., Shaffer, A.L., Yu, X., Allman, D. & Staudt, L.M. Control of inflammation, cytokine expression, and germinal center formation by BCL-6. Science 276, 589-592 (1997). 103. Ye, B.H. et al. The BCL-6 proto-oncogene controls germinalcentre formation and Th2-type inflammation. Nat Genet 16, 161170 (1997). 104. Turner, C.A., Jr., Mack, D.H. & Davis, M.M. Blimp-1, a novel zinc finger-containing protein that can drive the maturation of B Page 129 lymphocytes into immunoglobulin-secreting cells. Cell 77, 297306 (1994). 105. Chu, V.T. et al. Eosinophils are required for the maintenance of plasma cells in the bone marrow. Nat Immunol 12, 151-159 (2011). 106. Dogan, I. et al. Multiple layers of B cell memory with different effector functions. Nat Immunol 10, 1292-1299 (2009). 107. Blink, E.J. et al. Early appearance of germinal center-derived memory B cells and plasma cells in blood after primary immunization. J Exp Med 201, 545-554 (2005). 108. Tarlinton, D. B-cell memory: are subsets necessary? Nat Rev Immunol 6, 785-790 (2006). 109. Cerutti, A., Cols, M. & Puga, I. Activation of B cells by noncanonical helper signals. EMBO Rep 13, 798-810 (2012). 110. Chang, P.P. et al. Identification of Bcl-6-dependent follicular helper NKT cells that provide cognate help for B cell responses. Nat Immunol 13, 35-43 (2012). 111. Weill, J.C., Weller, S. & Reynaud, C.A. Human marginal zone B cells. Annu Rev Immunol 27, 267-285 (2009). 112. Baumgarth, N. The double life of a B-1 cell: self-reactivity selects for protective effector functions. Nat Rev Immunol 11, 34-46 (2011). 113. Magri, G. et al. Innate lymphoid cells integrate stromal and immunological signals to enhance antibody production by splenic marginal zone B cells. Nat Immunol 15, 354-364 (2014). 114. Cerutti, A., Puga, I. & Cols, M. Innate control of B cell responses. Trends Immunol 32, 202-211 (2011). 115. Chorny, A. & Cerutti, A. A gut triumvirate rules homeostasis. Nat Med 17, 1549-1550 (2011). 116. Covens, K. et al. Characterization of proposed human B-1 cells reveals pre-plasmablast phenotype. Blood 121, 5176-5183 (2013). Page 130 117. Puga, I. et al. B cell-helper neutrophils stimulate the diversification and production of immunoglobulin in the marginal zone of the spleen. Nat Immunol 13, 170-180 (2012). 118. Lesinski, G.B. & Westerink, M.A. Novel vaccine strategies to Tindependent antigens. J Microbiol Methods 47, 135-149 (2001). 119. Mond, J.J., Lees, A. & Snapper, C.M. T cell-independent antigens type 2. Annu Rev Immunol 13, 655-692 (1995). 120. Cinamon, G., Zachariah, M.A., Lam, O.M., Foss, F.W., Jr. & Cyster, J.G. Follicular shuttling of marginal zone B cells facilitates antigen transport. Nat Immunol 9, 54-62 (2008). 121. Song, H. & Cerny, J. Functional heterogeneity of marginal zone B cells revealed by their ability to generate both early antibodyforming cells and germinal centers with hypermutation and memory in response to a T-dependent antigen. J Exp Med 198, 1923-1935 (2003). 122. Kraal, G. & Mebius, R. New insights into the cell biology of the marginal zone of the spleen. Int Rev Cytol 250, 175-215 (2006). 123. Mebius, R.E. & Kraal, G. Structure and function of the spleen. Nat Rev Immunol 5, 606-616 (2005). 124. Steiniger, B., Timphus, E.M. & Barth, P.J. The splenic marginal zone in humans and rodents: an enigmatic compartment and its inhabitants. Histochem Cell Biol 126, 641-648 (2006). 125. Likhite, V.V. Immunological impairment and susceptibility to infection after splenectomy. JAMA 236, 1376-1377 (1976). 126. Cowan, M.J. et al. Pneumococcal polysaccharide immunization in infants and children. Pediatrics 62, 721-727 (1978). 127. Kruetzmann, S. et al. Human immunoglobulin M memory B cells controlling Streptococcus pneumoniae infections are generated in the spleen. J Exp Med 197, 939-945 (2003). 128. Carsetti, R., Pantosti, A. & Quinti, I. Impairment of the antipolysaccharide response in splenectomized patients is due to Page 131 the lack of immunoglobulin M memory B cells. J Infect Dis 193, 1189-1190 (2006). 129. Okumoto, K. et al. Differentiation of bone marrow cells into cells that express liver-specific genes in vitro: implication of the Notch signals in differentiation. Biochem Biophys Res Commun 304, 691-695 (2003). 130. Tanigaki, K. et al. Notch-RBP-J signaling is involved in cell fate determination of marginal zone B cells. Nat Immunol 3, 443-450 (2002). 131. Cerutti, A., Cols, M. & Puga, I. Marginal zone B cells: virtues of innate-like antibody-producing lymphocytes. Nat Rev Immunol 13, 118-132 (2013). 132. Spencer, J., Finn, T., Pulford, K.A., Mason, D.Y. & Isaacson, P.G. The human gut contains a novel population of B lymphocytes which resemble marginal zone cells. Clin Exp Immunol 62, 607-612 (1985). 133. Tierens, A., Delabie, J., Michiels, L., Vandenberghe, P. & De Wolf-Peeters, C. Marginal-zone B cells in the human lymph node and spleen show somatic hypermutations and display clonal expansion. Blood 93, 226-234 (1999). 134. Dono, M. et al. Heterogeneity of tonsillar subepithelial B lymphocytes, the splenic marginal zone equivalents. J Immunol 164, 5596-5604 (2000). 135. Martin, F., Oliver, A.M. & Kearney, J.F. Marginal zone and B1 B cells unite in the early response against T-independent bloodborne particulate antigens. Immunity 14, 617-629 (2001). 136. Balázs, M., Martin, F., Zhou, T. & Kearney, J.F. Blood Dendritic cells interact with splenic marginal zone B cells to initiate Tindependent immune responses. Immunity 17, 341-352 (2002). 137. Clarke, T.B. et al. Recognition of peptidoglycan from the microbiota by Nod1 enhances systemic innate immunity. Nat Med 16, 228-231 (2010). Page 132 138. Kool, J. et al. Detection of intestinal flora-derived bacterial antigen complexes in splenic macrophages of rats. J Histochem Cytochem 42, 1435-1441 (1994). 139. Bernasconi, N.L., Traggiai, E. & Lanzavecchia, A. Maintenance of serological memory by polyclonal activation of human memory B cells. Science 298, 2199-2202 (2002). 140. Lande, R. et al. Neutrophils activate plasmacytoid dendritic cells by releasing self-DNA-peptide complexes in systemic lupus erythematosus. Sci Transl Med 3, 73ra19 (2011). 141. Scapini, P. et al. G-CSF-stimulated neutrophils are a prominent source of functional BLyS. J Exp Med 197, 297-302 (2003). 142. Snapper, C.M. Mechanisms underlying in vivo polysaccharidespecific immunoglobulin responses to intact extracellular bacteria. Ann N Y Acad Sci 1253, 92-101 (2012). 143. Treml, L.S. et al. TLR stimulation modifies BLyS receptor expression in follicular and marginal zone B cells. J Immunol 178, 7531-7539 (2007). 144. Colino, J., Shen, Y. & Snapper, C.M. Dendritic cells pulsed with intact Streptococcus pneumoniae elicit both protein- and polysaccharide-specific immunoglobulin isotype responses in vivo through distinct mechanisms. J Exp Med 195, 1-13 (2002). 145. Cunningham, A.F. et al. Salmonella induces a switched antibody response without germinal centers that impedes the extracellular spread of infection. J Immunol 178, 6200-6207 (2007). 146. Mazmanian, S.K., Liu, C.H., Tzianabos, A.O. & Kasper, D.L. An immunomodulatory molecule of symbiotic bacteria directs maturation of the host immune system. Cell 122, 107-118 (2005). 147. Cobb, B.A., Wang, Q., Tzianabos, A.O. & Kasper, D.L. Polysaccharide processing and presentation by the MHCII pathway. Cell 117, 677-687 (2004). 148. Attanavanich, K. & Kearney, J.F. Marginal zone, but not follicular B cells, are potent activators of naive CD4 T cells. J Immunol 172, 803-811 (2004). Page 133 149. Dillon, S.R., Gross, J.A., Ansell, S.M. & Novak, A.J. An APRIL to remember: novel TNF ligands as therapeutic targets. Nat Rev Drug Discov 5, 235-246 (2006). 150. Li, X. et al. Immune opsonins modulate BLyS/BAFF release in a receptor-specific fashion. J Immunol 181, 1012-1018 (2008). 151. Liu, Y. et al. Ligand-receptor binding revealed by the TNF family member TALL-1. Nature 423, 49-56 (2003). 152. Mackay, F., Schneider, P., Rennert, P. & Browning, J. BAFF and APRIL: a tutorial on B cell survival. Annu Rev Immunol 21, 231264 (2003). 153. Schiemann, B. et al. An essential role for BAFF in the normal development of B cells through a BCMA-independent pathway. Science 293, 2111-2114 (2001). 154. Ingold, K. et al. Identification of proteoglycans as the APRILspecific binding partners. J Exp Med 201, 1375-1383 (2005). 155. Boule, M.W. et al. Toll-like receptor 9-dependent and independent dendritic cell activation by chromatinimmunoglobulin G complexes. J Exp Med 199, 1631-1640 (2004). 156. Darce, J.R., Arendt, B.K., Wu, X. & Jelinek, D.F. Regulated expression of BAFF-binding receptors during human B cell differentiation. J Immunol 179, 7276-7286 (2007). 157. Ng, L.G. et al. B cell-activating factor belonging to the TNF family (BAFF)-R is the principal BAFF receptor facilitating BAFF costimulation of circulating T and B cells. J Immunol 173, 807-817 (2004). 158. Crowley, J.E. et al. Homeostatic control of B lymphocyte subsets. Immunol Res 42, 75-83 (2008). 159. Scholz, J.L. et al. BLyS inhibition eliminates primary B cells but leaves natural and acquired humoral immunity intact. Proc Natl Acad Sci U S A 105, 15517-15522 (2008). Page 134 160. Castro, I. et al. B cell receptor-mediated sustained c-Rel activation facilitates late transitional B cell survival through control of B cell activating factor receptor and NF-kappaB2. J Immunol 182, 7729-7737 (2009). 161. Rothe, M., Pan, M.G., Henzel, W.J., Ayres, T.M. & Goeddel, D.V. The TNFR2-TRAF signaling complex contains two novel proteins related to baculoviral inhibitor of apoptosis proteins. Cell 83, 1243-1252 (1995). 162. Bossen, C. & Schneider, P. BAFF, APRIL and their receptors: structure, function and signaling. Semin Immunol 18, 263-275 (2006). 163. Romberg, N. et al. CVID-associated TACI mutations affect autoreactive B cell selection and activation. J Clin Invest 123, 4283-4293 (2013). 164. Patke, A., Mecklenbrauker, I., Erdjument-Bromage, H., Tempst, P. & Tarakhovsky, A. BAFF controls B cell metabolic fitness through a PKC beta- and Akt-dependent mechanism. J Exp Med 203, 2551-2562 (2006). 165. Woodland, R.T. et al. Multiple signaling pathways promote B lymphocyte stimulator dependent B-cell growth and survival. Blood 111, 750-760 (2008). 166. Heitman, J., Movva, N.R., Hiestand, P.C. & Hall, M.N. FK 506binding protein proline rotamase is a target for the immunosuppressive agent FK 506 in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 88, 1948-1952 (1991). 167. Sabatini, D.M., Erdjument-Bromage, H., Lui, M., Tempst, P. & Snyder, S.H. RAFT1: a mammalian protein that binds to FKBP12 in a rapamycin-dependent fashion and is homologous to yeast TORs. Cell 78, 35-43 (1994). 168. Sabers, C.J. et al. Isolation of a protein target of the FKBP12rapamycin complex in mammalian cells. J Biol Chem 270, 815822 (1995). 169. Sabatini, D.M. mTOR and cancer: insights into a complex relationship. Nat Rev Cancer 6, 729-734 (2006). Page 135 170. Goberdhan, D.C. & Boyd, C.A. mTOR: dissecting regulation and mechanism of action to understand human disease. Biochem Soc Trans 37, 213-216 (2009). 171. Harris, T.E. & Lawrence, J.C., Jr. TOR signaling. Sci STKE 2003, re15 (2003). 172. Yang, Q. & Guan, K.L. Expanding mTOR signaling. Cell Res 17, 666-681 (2007). 173. Sarbassov, D.D. et al. Rictor, a novel binding partner of mTOR, defines a rapamycin-insensitive and raptor-independent pathway that regulates the cytoskeleton. Curr Biol 14, 1296-1302 (2004). 174. Hresko, R.C. & Mueckler, M. mTOR.RICTOR is the Ser473 kinase for Akt/protein kinase B in 3T3-L1 adipocytes. J Biol Chem 280, 40406-40416 (2005). 175. Sarbassov, D.D., Guertin, D.A., Ali, S.M. & Sabatini, D.M. Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Science 307, 1098-1101 (2005). 176. Franke, T.F. Intracellular signaling by Akt: bound to be specific. Sci Signal 1, pe29 (2008). 177. Inoki, K., Li, Y., Zhu, T., Wu, J. & Guan, K.L. TSC2 is phosphorylated and inhibited by Akt and suppresses mTOR signalling. Nat Cell Biol 4, 648-657 (2002). 178. Shaw, R.J. et al. The LKB1 tumor suppressor negatively regulates mTOR signaling. Cancer Cell 6, 91-99 (2004). 179. Shaw, R.J. & Cantley, L.C. Ras, PI(3)K and mTOR signalling controls tumour cell growth. Nature 441, 424-430 (2006). 180. Goncharova, E.A. et al. mTORC2 is required for proliferation and survival of TSC2-null cells. Mol Cell Biol 31, 2484-2498 (2011). 181. Sen, B. et al. mTORC2 regulates mechanically induced cytoskeletal reorganization and lineage selection in marrowderived mesenchymal stem cells. J Bone Miner Res 29, 78-89 (2014). Page 136 182. Jacinto, E. et al. Mammalian TOR complex 2 controls the actin cytoskeleton and is rapamycin insensitive. Nat Cell Biol 6, 11221128 (2004). 183. Sarbassov, D.D. et al. Prolonged rapamycin treatment inhibits mTORC2 assembly and Akt/PKB. Mol Cell 22, 159-168 (2006). 184. Zeng, Z. et al. Rapamycin derivatives reduce mTORC2 signaling and inhibit AKT activation in AML. Blood 109, 3509-3512 (2007). 185. Bierer, B.E., Somers, P.K., Wandless, T.J., Burakoff, S.J. & Schreiber, S.L. Probing immunosuppressant action with a nonnatural immunophilin ligand. Science 250, 556-559 (1990). 186. Burnett, P.E., Barrow, R.K., Cohen, N.A., Snyder, S.H. & Sabatini, D.M. RAFT1 phosphorylation of the translational regulators p70 S6 kinase and 4E-BP1. Proc Natl Acad Sci U S A 95, 1432-1437 (1998). 187. Chung, J., Grammer, T.C., Lemon, K.P., Kazlauskas, A. & Blenis, J. PDGF- and insulin-dependent pp70S6k activation mediated by phosphatidylinositol-3-OH kinase. Nature 370, 71-75 (1994). 188. Pullen, N. et al. Phosphorylation and activation of p70s6k by PDK1. Science 279, 707-710 (1998). 189. Wilson, K.F., Wu, W.J. & Cerione, R.A. Cdc42 stimulates RNA splicing via the S6 kinase and a novel S6 kinase target, the nuclear cap-binding complex. J Biol Chem 275, 37307-37310 (2000). 190. Holz, M.K. & Blenis, J. Identification of S6 kinase 1 as a novel mammalian target of rapamycin (mTOR)-phosphorylating kinase. J Biol Chem 280, 26089-26093 (2005). 191. Delgoffe, G.M. & Powell, J.D. mTOR: taking cues from the immune microenvironment. Immunology 127, 459-465 (2009). 192. Mills, R.E. & Jameson, J.M. T cell dependence on mTOR signaling. Cell Cycle 8, 545-548 (2009). Page 137 193. Thomson, A.W., Turnquist, H.R. & Raimondi, G. Immunoregulatory functions of mTOR inhibition. Nat Rev Immunol 9, 324-337 (2009). 194. Weichhart, T. & Saemann, M.D. The multiple facets of mTOR in immunity. Trends Immunol 30, 218-226 (2009). 195. Cao, W. et al. Toll-like receptor-mediated induction of type I interferon in plasmacytoid dendritic cells requires the rapamycinsensitive PI(3)K-mTOR-p70S6K pathway. Nat Immunol 9, 11571164 (2008). 196. Zhang, S. et al. Constitutive reductions in mTOR alter cell size, immune cell development, and antibody production. Blood 117, 1228-1238 (2011). 197. Benhamron, S. & Tirosh, B. Direct activation of mTOR in B lymphocytes confers impairment in B-cell maturation andloss of marginal zone B cells. Eur J Immunol 41, 2390-2396 (2011). 198. Keating, R. et al. The kinase mTOR modulates the antibody response to provide cross-protective immunity to lethal infection with influenza virus. Nat Immunol 14, 1266-1276 (2013). 199. Donahue, A.C. & Fruman, D.A. Distinct signaling mechanisms activate the target of rapamycin in response to different B-cell stimuli. Eur J Immunol 37, 2923-2936 (2007). 200. Katsenelson, N. et al. Synthetic CpG oligodeoxynucleotides augment BAFF- and APRIL-mediated immunoglobulin secretion. Eur J Immunol 37, 1785-1795 (2007). 201. Hardenberg, G. et al. Specific TLR ligands regulate APRIL secretion by dendritic cells in a PKR-dependent manner. Eur J Immunol 37, 2900-2911 (2007). 202. Vogt, P.K. PI 3-kinase, mTOR, protein synthesis and cancer. Trends Mol Med 7, 482-484 (2001). 203. Thoreen, C.C. et al. An ATP-competitive mammalian target of rapamycin inhibitor reveals rapamycin-resistant functions of mTORC1. J Biol Chem 284, 8023-8032 (2009). Page 138 204. Sengupta, S., Peterson, T.R. & Sabatini, D.M. Regulation of the mTOR complex 1 pathway by nutrients, growth factors, and stress. Mol Cell 40, 310-322 (2010). 205. von Bulow, G.U., van Deursen, J.M. & Bram, R.J. Regulation of the T-independent humoral response by TACI. Immunity 14, 573582 (2001). 206. Mantchev, G.T., Cortesao, C.S., Rebrovich, M., Cascalho, M. & Bram, R.J. TACI is required for efficient plasma cell differentiation in response to T-independent type 2 antigens. J Immunol 179, 2282-2288 (2007). 207. Bhattacharya, D., Lee, D.U. & Sha, W.C. Regulation of Ig class switch recombination by NF-kappaB: retroviral expression of RelB in activated B cells inhibits switching to IgG1, but not to IgE. Int Immunol 14, 983-991 (2002). 208. Dedeoglu, F., Horwitz, B., Chaudhuri, J., Alt, F.W. & Geha, R.S. Induction of activation-induced cytidine deaminase gene expression by IL-4 and CD40 ligation is dependent on STAT6 and NFkappaB. Int Immunol 16, 395-404 (2004). 209. Muramatsu, M. et al. Class switch recombination and hypermutation require activation-induced cytidine deaminase (AID), a potential RNA editing enzyme. Cell 102, 553-563 (2000). 210. Yasuda, T. et al. Erk kinases link pre-B cell receptor signaling to transcriptional events required for early B cell expansion. Immunity 28, 499-508 (2008). 211. Neron, S. et al. B cell proliferation following CD40 stimulation results in the expression and activation of Src protein tyrosine kinase. Int Immunol 18, 375-387 (2006). 212. Johnson, S.E., Shah, N., Panoskaltsis-Mortari, A. & LeBien, T.W. Murine and human IL-7 activate STAT5 and induce proliferation of normal human pro-B cells. J Immunol 175, 7325-7331 (2005). 213. Hyer, M.L., Voelkel-Johnson, C., Rubinchik, S., Dong, J. & Norris, J.S. Intracellular Fas ligand expression causes Fasmediated apoptosis in human prostate cancer cells resistant to Page 139 monoclonal antibody-induced apoptosis. Mol Ther 2, 348-358 (2000). 214. Groom, J.R. et al. BAFF and MyD88 signals promote a lupuslike disease independent of T cells. J Exp Med 204, 1959-1971 (2007). 215. Park, B. et al. Proteolytic cleavage in an endolysosomal compartment is required for activation of Toll-like receptor 9. Nat Immunol 9, 1407-1414 (2008). 216. Weichhart, T. et al. The TSC-mTOR signaling pathway regulates the innate inflammatory response. Immunity 29, 565-577 (2008). 217. Schaeffer, V. et al. Role of the mTOR pathway in LPS-activated monocytes: influence of hypertonic saline. J Surg Res 171, 769776 (2011). 218. Cobbold, S.P. The mTOR pathway and integrating immune regulation. Immunology 140, 391-398 (2013). 219. Tsalikis, J., Croitoru, D.O., Philpott, D.J. & Girardin, S.E. Nutrient sensing and metabolic stress pathways in innate immunity. Cell Microbiol 15, 1632-1641 (2013). 220. Surviladze, Z., Sterk, R.T., DeHaro, S.A. & Ozbun, M.A. Cellular entry of human papillomavirus type 16 involves activation of the phosphatidylinositol 3-kinase/Akt/mTOR pathway and inhibition of autophagy. J Virol 87, 2508-2517 (2013). 221. Soares, J.A. et al. Activation of the PI3K/Akt pathway early during vaccinia and cowpox virus infections is required for both host survival and viral replication. J Virol 83, 6883-6899 (2009). 222. Bose, S.K., Meyer, K., Di Bisceglie, A.M., Ray, R.B. & Ray, R. Hepatitis C virus induces epithelial-mesenchymal transition in primary human hepatocytes. J Virol 86, 13621-13628 (2012). 223. Efeyan, A. & Sabatini, D.M. mTOR and cancer: many loops in one pathway. Curr Opin Cell Biol 22, 169-176 (2010). 224. Peterson, T.R. et al. DEPTOR is an mTOR inhibitor frequently overexpressed in multiple myeloma cells and required for their survival. Cell 137, 873-886 (2009). Page 140 225. Almejun, M.B. et al. Naturally occurring mutation affecting the MyD88-binding site of TNFRSF13B impairs triggering of class switch recombination. Eur J Immunol 43, 805-814 (2013). 226. Dan, H.C. et al. Akt-dependent regulation of NF-{kappa}B is controlled by mTOR and Raptor in association with IKK. Genes Dev 22, 1490-1500 (2008). 227. Neshat, M.S. et al. Enhanced sensitivity of PTEN-deficient tumors to inhibition of FRAP/mTOR. Proc Natl Acad Sci U S A 98, 10314-10319 (2001). 228. Podsypanina, K. et al. An inhibitor of mTOR reduces neoplasia and normalizes p70/S6 kinase activity in Pten+/- mice. Proc Natl Acad Sci U S A 98, 10320-10325 (2001). 229. Ghosh, S. & Hayden, M.S. New regulators of NF-kappaB in inflammation. Nat Rev Immunol 8, 837-848 (2008). 230. Medzhitov, R. & Horng, T. Transcriptional control of the inflammatory response. Nat Rev Immunol 9, 692-703 (2009). 231. Ollivier, V., Parry, G.C., Cobb, R.R., de Prost, D. & Mackman, N. Elevated cyclic AMP inhibits NF-kappaB-mediated transcription in human monocytic cells and endothelial cells. J Biol Chem 271, 20828-20835 (1996). 232. Parry, G.C. & Mackman, N. Role of cyclic AMP response element-binding protein in cyclic AMP inhibition of NF-kappaBmediated transcription. J Immunol 159, 5450-5456 (1997). 233. Zan, H. & Casali, P. Regulation of Aicda expression and AID activity. Autoimmunity 46, 83-101 (2013). 234. Chen, Y.J. et al. Interplay of PI3K and cAMP/PKA signaling, and rapamycin-hypersensitivity in TGFbeta1 enhancement of FSHstimulated steroidogenesis in rat ovarian granulosa cells. J Endocrinol 192, 405-419 (2007). 235. Rush, J.S., Liu, M., Odegard, V.H., Unniraman, S. & Schatz, D.G. Expression of activation-induced cytidine deaminase is regulated by cell division, providing a mechanistic basis for division-linked Page 141 class switch recombination. Proc Natl Acad Sci U S A 102, 13242-13247 (2005). 236. Craxton, A. et al. p38 MAPK is required for CD40-induced gene expression and proliferation in B lymphocytes. J Immunol 161, 3225-3236 (1998). 237. Li, Y., Zheng, X.X., Li, X.C., Zand, M.S. & Strom, T.B. Combined costimulation blockade plus rapamycin but not cyclosporine produces permanent engraftment. Transplantation 66, 1387-1388 (1998). 238. Mackay, F. & Tangye, S.G. The role of the BAFF/APRIL system in B cell homeostasis and lymphoid cancers. Curr Opin Pharmacol 4, 347-354 (2004). 239. Cols, M. et al. Stromal endothelial cells establish a bidirectional crosstalk with chronic lymphocytic leukemia cells through the TNF-related factors BAFF, APRIL, and CD40L. J Immunol 188, 6071-6083 (2012). 240. Jacob, N. et al. B Cell and BAFF dependence of IFN-alphaexaggerated disease in systemic lupus erythematosus-prone NZM 2328 mice. J Immunol 186, 4984-4993 (2011). 241. Kessel, A. et al. Elevated serum B-cell activating factor in patients with chronic urticaria. Hum Immunol 73, 620-622 (2012). 242. Toubi, E. et al. Elevated serum B-Lymphocyte activating factor (BAFF) in chronic hepatitis C virus infection: association with autoimmunity. J Autoimmun 27, 134-139 (2006). Page 142