* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Genes- PRACTICE PROBLEMS- ANSWERS
DNA repair protein XRCC4 wikipedia , lookup
Homologous recombination wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Microsatellite wikipedia , lookup
DNA replication wikipedia , lookup
DNA polymerase wikipedia , lookup
DNA nanotechnology wikipedia , lookup
Genes-Answers 1. 2. 3. 4. 5. 6. 7. 8. Adenine, Guanine, Thymine, Cytosine Double helix Hydrogen Bonds Daughter strand DNA replication Phosphate group 3’ to 5’ direction a. 3’ GAATCGTAT 5’ made right to left b. 3’ TTTGGACAA 5’ made right to left c. 5’ GCTAACCGG 3’ made left to right d. 5’ ACACGCTAG 3’ made left to right 9. adenine to thymine; guanine to cytosine 10. covalent bonds 11. parent strand 12. DNA polymerase 13. Sugar group 14. 5’ to 3’ direction 15. Each new DNA double helix contains one “old” strand from the original DNA molecule and one “new” synthesized strand. So each new helix has a parent strand and a daughter strand. 16. a. 5’ CCGAATTGC 3’ made right to left b. 3’ GGATACCGG 5’ made left to right c. 5’ TTGATAAGG 3’ made right to left d. 5’ AATTCGAAT 3’ made right to left 17. Guanine, Cytosine, Adenine, Uracil 18. Gene 19. Non-template strand 20. 5’ to 3’ 21. 3’ to 5’ 22. DNA replication results in two new daughter strands, and transcription only results in one new RNA strand. DNA replication synthesizes the whole DNA strand, transcription makes RNA only from the DNA strand with the genes. In DNA replication adenine pairs with thymine, in transcription the adenine on DNA pairs with uracil on RNA. Both processes synthesis DNA and RNA respectively in the 5’ to 3’ direction. 23. Initiation, Elongation, Termination 24. Attaches to the promoter sequence on DNA, brings the RNA nucleotides to the DNA, unwinds the DNA double helix, and recognizes the stop sequence on DNA 25. a. 3’ AAAUGGCCU 5’ made right to left b. 3’ UUGGCAGUC 5’ made right to left c. 5’ UGCUAAUUG 3’ made left to right 26. Adenine to Uracil; Guanine to Cytosine 27. The process by with RNA is synthesized from DNA 28. Template strand 29. Phosphate group 30. Sugar group 31. RNA polymerase attaches at the promoter sequence on DNA 32. RNA polymerase moves down the DNA while unwinding it and reads the bases of DNA and brings in the new complementary RNA bases 33. RNA polymerase reaches a stop sequence and falls off the DNA. The new RNA strand separates from DNA. The DNA strands reform their double helix. 34. a. 5’ UUGCUAAAG 3’ made left to right b. 5’ AUAUGGCUA 3’ made left to right 35. The sequence of DNA that codes for protein 36. 64 37. Codons on DNA contain Thymine and condons on RNA contain Uracil 38. 61 39. a. stop b. aspartic acid c. valine d. proline e. threonine 40. transcription and translation 41. Watson and Crick 42. The process of taking the code of nucleic acids and making the product for it in amino acids, leading to proteins 43. Codon 44. Every organism uses the same 64 codons. The codes is the same for everything, it is the results that are different. 45. They are STOP codons, they signal the end of translation 46. It is a START codon, it signals the start of translation 47. a. Leucine b. Phenylalanine c. Methionine- START d. Lysine e. Proline 48. The idea that DNA is transcribed to make RNA, which is then translated to make protein. 49. Messenger RNA or mRNA, transfer RNA or tRNA, ribosomal RNA or rRNA 50. In ribosomes 51. It helps make covalent bonds between the amino acids 52. T-shaped 53. 20 54. mRNA 55. False, changes in mRNA or in protein do not affect the DNA. The central dogma proceeds from DNA to RNA to protein and does not circle back to DNA. 56. The ribosome has a small subunit and a large subunit and is made of rRNA and protein 57. To transfer amino acids from the surrounding area to the ribosome 58. The amino acid attachment site is where the specified amino acid will attach to the tRNA. The anticodon loop is the three base sequence that is complementary to the codon on the mRNA 59. Initiation, elongation, termination 60. The P site is where the new protein emerges from and the A site is where the amino acids are delivered to 61. AUG 62. UAC 63. Covalent bonds 64. When the ribosome reaches a STOP codon 65. Translation is the process by which the mRNA code is used to create protein 66. Amino acids, tRNA, mRNA, rRNA 67. The mRNA becomes sandwiched between the large and small subunits of the ribosome at the start codon. 68. 5’ 69. methionine 70. The first tRNA leaves the ribosome so the next tRNA can enter. 71. The ribosome moves the mRNA using energy and new amino acids are continually added by new tRNA molecules. Each new tRNA moves from the A site to the P site and then leaves the ribosome. 72. Termination occurs when the ribosome reaches a stop codon. The ribosome subunits separate from the mRNA and the protein is released. 73. A protein in its primary sequence Free Response Answers 1. a. DNA is made of the sugar deoxyribose, contains the base thymine, is double stranded, is helix shaped. RNA is made of the sugar ribose, contains the base uracil, is single stranded, can be many different shapes. b. In both DNA replication and transcription the new DNA strands and the new RNA strand respectively are synthesized in the 5’ to 3’ direction. In DNA replication both DNA strands are replicated, in transcription only the template strand is transcribed. DNA replication pairs adenine from one DNA strand with thymine on the new DNA strand, and in transcription adenine from the template DNA strand is paired with uracil on the new RNA strand. In DNA replication two new DNA molecules containing one parent and one daughter strand each are produced. In transcription only one new RNA strand is produced. 2. 3. 4. a. 3’ TGCATCTAATGC 5’ synthesized from right to left b. DNA polymerase c. It is semi-conservative because each new DNA molecule contains one parent strand and one daughter strand. a. Gene expression is the process of taking the code from DNA and transcribing it into mRNA, and then into the amino acids or proteins. b. Changes in RNA and protein do not affect DNA because the process of gene expression is not circular and is unidirectional. c. A change in DNA would result in a changed code for protein, so that the codons in mRNA would be altered, and therefore the amino acids coded for would be different. A change in the sequence of amino acids results in a change of the primary structure of protein, which would result in changes to the secondary and tertiary structure, and therefore the function of the protein. a. The steps of transcription are initiation, elongation, and termination. In initiation, the RNA polymerase attaches to the DNA template strand at the promoter sequence. In elongation, the RNA polymerase moves down the DNA while uncoiling it and brining in the new RNA nucleotide bases. In termination, the RNA polymerase reaches a termination sequence and detaches from the DNA, the DNA recoils, and the RNA strand is released. b. The end product is a single strand of RNA. c. The steps of translation are initiation, elongation, and termination. In initiation, that small and large ribosomal subunits attach to the start codon on the mRNA strand near the 5’ end, the tRNAs with the appropriate amino acids attach surround the ribosome, and the tRNA with the anticodon for AUG enters the A site and delivers the amino acid methionine. In elongation the tRNAs carrying the anticodons for the codons on mRNA continue to enter at the A site and deliver the appropriate amino acids which covalently bond together. In termination, a stop codon is reached, the ribosomal subunits detach releasing the mRNA strand and a chain of amino acids. d. A protein in its primary sequence. 5. 6. AUG a. Messenger RNA, transfer RNA, ribosomal RNA b. One significant part of tRNA is the anticodon loop, which is a three base sequence on the tip of the tRNA molecule that is complementary to a specific codon on the mRNA. The other significant part of tRNA is the amino acid attachment site, which is where the amino acid, specified by the codon complementary to the tRNA anticodon, is attached to the tRNA so that it can be transferred to the ribosome. c. During translation, mRNA carries the codons that specify the chain of amino acids. rRNA is found in the ribosomes and the ribosomes are responsible for covalently bonding the amino acids together, while separating the amino acids from their tRNAs. tRNA brings the specified amino acids to the ribosome during translation. a. 5’ AUGUUCCAGGAUCCCUGAUAA 3’ synthesized from left to right b. UUC CAG GAU CCC Methionine- Serine- Glutamine- Aspartic Acid- Proline- Tyrosine UGA UAA