Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download 14-1, 2 - greinerudsd
Document related concepts
Medical genetics wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Genomic imprinting wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Segmental Duplication on the Human Y Chromosome wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Down syndrome wikipedia , lookup
Genome (book) wikipedia , lookup
Skewed X-inactivation wikipedia , lookup
Y chromosome wikipedia , lookup
Transcript
What do you see? Colorblindness is an example of a sex-linked disorder Human Genetics Chapter 14-1, 14-2 Human Heredity The Human Genome ATGGGTCGCGTATCGTAGCTGATGGGGGTAGTATTT TATATGCTGGTAGACAAAACGGTGTACTGCCGTC GTCGTAGTGATGTGCGGCGCCAAAAATTATACTG TGACTGATCGTAGTGTAAAAAAAAAAGTCGTGCT GCTTTTTTCGATCGCGCGTAGTAGCTACGCCGCG GTTCGCGCGTAAGAGACTGATGCGACTGATATATA TACGCGCTAGCATATATCTCTCGATCTGATCGTAGA TGCTTAAGTTACTAGCTGTCGTATACGTAGTTAGT CGGGTGATGATGCTGTATATATCGCGCTCTATATGC TAGCTAGTGTTGTAGCTAGCTGATTCCCTCGAAGT CTCGTGAATAATCGCGCTTTCGGGGGCTCTCTATA Human Genome • 3 billion base pairs – 6 billion individual bases • “4 million pages” • Bases (letters) spell out genes (words) that result in the phenotype (the story) • Some spell out bad stories (diseases) Gene count source: Wellcome Trust. Unveiling your genome. Wellcome News Supplement Q1:13-23(2001). Chromosome Chromosome 1 Chromosome 2 Chromosome 3 Chromosome 4 Chromosome 5 Chromosome 6 Chromosome 7 Chromosome 8 Chromosome 9 Chromosome 10 Chromosome 11 Chromosome 12 Chromosome 13 Chromosome 14 Chromosome 15 Chromosome 16 Chromosome 17 Chromosome 18 Chromosome 19 Chromosome 20 Chromosome 21 Chromosome 22 Chromosome X Chromosome Y # Genes 2968 2288 2032 1297 1643 1963 1443 1127 1299 1440 2093 1652 748 1098 1122 1098 1576 766 1454 927 303 288 1184 231 # of Bases 279 million bases 251 million bases 221 million bases 197 million bases 198 million bases 176 million bases 163 million bases 148 million bases 140 million bases 143 million bases 148 million bases 142 million bases 118 million bases 107 million bases 100 million bases 104 million bases 88 million bases 86 million bases 72 million bases 66 million bases 45 million bases 48 million bases 163 million bases 51 million bases Humans have 22 pairs of AUTOSOMES Why is the 23rd pair different? What is it called? What is this picture called? When was this cell photographed? Is this a man or a woman? How do you know? Answers… 2. The “23rd” pair are the sex chromosomes 3. This picture is a karyotype 4. It was taken during mitosis (likely metaphase) 5. It is a man • He has one X chromosome (larger) and one Y chromosome (smaller) What do you see? Colorblindness is an example of a sex-linked disorder • h = hemophilia, a sex-linked disorder • • • • For each, can you answer… Is the dad affected? Is the mom affected? How many children have the disease? • How many children are carriers? • How many children are healthy? (careful!) PEDIGREES another way to study inheritance • What do you think the F1 generation (line II) # 2 and #5 offspring represent? • Can you draw the Punnett Square for the Parent generation? (I) How to read a pedigree… Carrier female Carrier male Pedigrees • Show how traits are passed down through many generations • Based mostly on phenotypes • Show the actual offspring – Punnett squares show the possible offspring • Really only works well for single traits – Not polygenic traits • Only works for inherited traits – Environmental factors play a large role in who we are Inheriting Diseases • Just like physical traits, some diseases can be inherited on our chromosomes. • And, just like physical traits, some are X-linked, some are recessive, some are dominant or codominant. Genetic Disorder Project topics Fragile x syndrome Gaucher disease Duschene Muscular Dystrophy Marfan syndrome Color blindness Hurler syndrome Tay-Sachs Albinism Cystic Fibrosis Sickle cell anemia PKU Lou Gehrig’s disease Cri du Chat syndrome Huntington Disease Turner’s syndrome Klinefelter syndrome Down syndrome Fanconi anemia Other Chromosomal Actions • X-Inactivation if men only need one X chromosome, do women need both X’s? – If not, which one “works”? • Non-disjunction how gametes can end up with the wrong # of chromosomes in meiosis X-Chromosome Inactivation • Men are XY: One X chromosome is enough • Women are XX: The “extra” copy is not needed. It condenses into a “Barr body.” • Remember, you have trillions of cells. Which X chromosome that “switches off” can vary in each cell! Mosaicism Nondisjunction • “Not coming apart” • Homologous chromosomes fail to separate in meiosis • Result in Trisomy or Monosomy • Examples: – Klinefelter syndrome (trisomy X) – Down syndrome (trisomy 21) – Turners syndrome (X_ monosomy) Video 2 Nondisjunction • Click the image to play the video segment.
