Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
THE EPIGENETIC DISTURBANCES IN HUMAN BLOOD LEUKOCYTES IN REMOTE PERIOD AFTER RADIATION EXPOSURE Nina Kuzmina, Nellya Lapteva, Aleksandr Rubanovich N.I. Vavilov Institute of General Genetics, Russian Academy of Sciences, Moscow, Russia [email protected] DNA methylation - a main epigenetic genomic modification CpG islands (CGIs) short genomic regions (500 bp to a few kb) C+G ≥ 0.5, CpG obs ≥ 0.6 CpG exp located in the proximal promoter region of approximately 75% of human genes unmethylated CpG dinucleotides of CGIs are associated with active promoters hypermethylation of CGIs leads to transcriptional repression and gene inactivation Radiation-induced changes in DNA methylation patterns The investigations in vivo using animal models (rodents) The investigations in vitro using cells Main results Authors 1. DNA hypomethylation LINE-1 and Alu repetitive elements in Aupar et al., 2011 various cell lines (16-20 population doublings). Goetz et al., 2011 DNA hypermethylation at SAT2 and MLT1A repetitive elements in Kaup et al., 2006 HPV-G cells (20 population doublings,), but hypomethylation, which is not identified with respect to the sequence context Association with genomic instability. 2. Promoter hypermethylation Antwih et al., 2013 Association of promoter methylation with radiosensitivity of malignant Zhou et al., 2007; Leung et al., cells 2008; Xu et al., 2008 1. Reduction of the levels of various epigenetic indicators : a) global genomic hypomethylation, tri-methylation of histone H4-Lys20, methyltransferases Dnmt1 and Dnmt3a/b, methyl-binding proteins MeCP2 and MBD2) b) loss of imprinting с) relationship between methylation disturbances, genomic instability, and bystander effect 2. promoter hypermethylation and its locus-specific and tissue-specific character Koturbash et al., 2006; Pogribny et al., 2005; Loree et al., 2006; Raiche et al., 2004 Zhu et al., 2006 Bernal et al., 2013; Nandakumar et al., 2011; Kovalchuk et al., 2004; Wang et al., 2014; Lima et al., 2014 The results of the study of methylation pattern changes in blood cells of BALB/c mice exposed chronic irradiation The most pronounced effects to were observed in blood cells.(Х-rays, 0,05 Gy/d x 10d) These changes were sustained after 1 month. Jingzi Wang, Youwei Zhang, Kai Xu et al. Genome-wide screen of DNA methylation changes induced by low dose X-ray radiation in mice // PLoS One. 2014; 9(3) Most pronounced effect Most pronounced revealed effect in 1. Significant loss of global DNA methylation was blood cells 2 h postirradiation. However, these changes had been repaired after 1 month 2h (HPLC-method). 2. Hypermethylation of 811 promoter regions, which covered almost all key biological processes, was revealed 1 month 2 h postirradiation (MeDIP-on-chip). Eight hypermethylated genes (Rad23b, Tdg, Ccnd1, Ddit3, Llgl1, RasI11a, Tbx2, Scl6a15) were verified by MeDIP-qPCR. 3. The hypermethylation of Rad23b and Ddit3 genes was revealed in cells of blood and other tissues 2 hours and 1 month postirradiation (bisulfate sequencing) Actuality of problem In the several wide-genome investigations the association between hypermethylation and chronological age (r = 0.80 - 0.95 for different tissues) was established (Day K. et al., Genome Biology, 2013; Johansson Asa et al., PLoS One, 2013; Horvath S., Genome Biology, 2013; Hannum G, et al., Mol Cell, 2013). The accuracy of the age forecast based on hypermethylation estimation of 353 CpG sites is +/- 3.6 years (Horvath S., Genome Biology, 2013) Hypermethylation of some genes observed in malignant cells in patients with oncological diseases, was revealed in leukocytes peripheral blood of these subjects also (Al-Moundhri M. S. et al., PLoS One, 2010; Flanagan J. M., et al., Human Molecular Genetics, 2009; Tahara T. et al., Cancer Prev. Res., 2013) Ionizing radiation may make additional contribution in the hypermethylation processes Hypermethylation of some genes in leukocytes blood DNA samples was revealed in patients with nononcological age-related disease, above all with cardiovascular (Lakshmi Sana V. et al., Molecular and Cellular Biochemistry, 2013; Kim G. H. et al., Antioxid Redox Signal, 2013 Radiation-induced premature aging and age – related disease «epigenetic clock» of irradiated organism The aim of investigation: to evaluate long-term epigenetic consequence associated with hypermethylation promoter of genes of basic protective functions of cells in human body exposed to radiation Examined subjects I. Irradiated subjects: from 24 to 78 years, n=124 1. Liquidators of the ChNPP accident in 1986-1987: n=83 The individual doses ranged from 50 to 460 mSv (average dose 221 mSv). 2. Nuclear specialists (All-Russian Research Institute of Experimental Physics, Sarov, Russia): n=21 The summarized accumulated doses over a period of work with tritium and tritium oxide ranged from 37 to 994 mSv 3. Residents of territories with radioactive contamination Novozybkov town and Novozybkov district, Bryansk region, 135-688 kBq/m2 , 137Cs): n=20 II. Offsprings born from irradiated parents: from 2,5 to 49 years, n=74 III. Unirradiated subjects (control group): from 19 до 76 years, n=208 The collection of peripheral blood and DNA samples (2003 – 2007) 1. Federal State Institution Russian Scientific Center of Roentgenology and Radiolology Rosmedtechnology (Dr. Galina P. Snigiryova) 2. Federal Unitary State Enterprise “Russian Federal Nuclear Center All-Russian Scientific Research Institute of Experimental Physics” (Dr. Tatyana I. Khaimovich) 3. Federal Children’s Scientific and Practical Centre of Radiation Safety (Dr. Larisa S. Baleva) DNA methylation analysis Genomic DNA was isolated from blood leukocytes Restriction Methylated DNA Unmethylated DNA AciI (5'…C↓C GC…3') Restriction sites are cleaved Restriction sites are not cleaved PCR no product of amplification Amplification of DNA fragment electrophoresis in 2% agarose gel Nucleotide sequence of analysed fragment of promoters of p16/CDKN2A gene (as example) F GGATTTCTTTTTAACAGAGTGAACGCACTCAAACACGCCTTTGCTGGCAGGCGG GGGAGCGCGGCTGGGAGCAGGGAGGCCGGAGGGCGGTGTGGGGGGCAGGTGG GGAGGAGCCCAGTCCTCCTTCCTTGCCAACGCTGGCTCTGGCGAGGGCTGCTTC CGGCTGGTGCCCCCGGGGGAGACCCAACCTGGGGCGACTTCAGGGGTGCCACA TTCGCTAAGTGCTCGGAGTTAATAGCACCTCCTCCGAGCACTCGCTCACGGCGT CCCCTTGCCTGGAAAGATACCGCGGTCCCTCCAGAGGATTTGAGGGACAGGGTC GGAGGGGGCTCTTCCGCCAGCACCGGAGGAAGAAAGAGGAGGGGCTGGCTGGT R CACCAGAGGGTGGGGCGGACCGCGTGCGCTCGGCGGCTGCGGAGAGGGGGAG AGCAGGCAGCGGGCGGCGGGGAGCAGCATG The analysed CpG - dinucleotides in gene promoters The total number of АсіІ sites in the studied fragments of promoters The total number of CpG - dinucleotides in analyzed fragments of promoters The analysed CpG dinucleotides (%) Gene Function р16/CDKN2A Cell cycle 2 23 8,7 % р14/ARF Cell cycle 3 35 8,6 % RASSF1A Cell cycle 7 32 21,9 % GSTP1 Xenobiotic 4 31 12,9% detoxification The analysis of promoter methylation of p14/ARF and RASSF1A genes in five liquidators (as an example) 1 - 5: undigested DNA samples; 1a – 5a: digested DNA samples. A - RASSF1A gene, B p14/ARF gene, C - RAR-β2 gene (control of DNA preservation after restriction), D - ING1 gene (positive control methylation ), M - molecular ladder (step - 50 bp), K – water (no DNA). The arrows indicate the detected cases of methylation Frequency, % No significant differences were of the total number of foundThe in the distribution frequency of children born to irradiated and unirradiated hypermethylation cases in examined groups (control group) parents with the revealed promoter hypermethylation The frequency of individuals with of studied genes promoter methylation of at least one (power100 of the test is about 90%). of the analyzed genes in exposed 90 group is significantly higher 80 compared to the control group 70 (p = 3.9 • 10-7). 60 50 40 30 20 10 0 0 1 2 number of methylation genes control group offsprings of irradiated parents irradiated subjects Revealed cases of hypermethylation of studied gene promoters (%) in examined subjects (two age categories) 12 10 8 6 4 2 0 p14/ARF frequency, % frequency, % RASSF1A yes > 45 ≤ 45 no o exp age, years e sur 7 6 5 4 3 2 1 0 yes > 45 frequency, % frequency, % ye s ≤ 45 age , ye ars no s ur GSTP1 12 10 8 6 4 2 > 45 o exp age, years p16/CDKN2A 0 ≤ 45 no e sur o exp 12 10 8 6 4 2 0 ye s > 45 ≤ 45 age , ye ars no re su o p ex e General and private correlations* of hypermethylation with age and exposure status RASSF1A p14/ARF 0,102 (0,041) p16/CDKN2A Status 0,117 (0,018) Status (age is fixed) 0,011 (0,825) 0,032 (0,523) 0,186 (1,7 х 10-4) Age 0,216 (1,1 х 10-5) 0,149 (2,5 х 10-3) 0,171 (5,4 х 10-4) Age (status is fixed) 0,183 (2,0 х 10-4) 0,114 (0,021) 0,244 (6,5 х 10-7) 0,059 (0,238) * - Coefficient of correlation and two-tailed p-value are demonstrated GSTP1 0,214 (1,4 х 10-5) 0,182 (2,4 х 10-4) 0,115 (0,021) 0,010 (0,844) The multiple regression analysis of dependence of number of methylation genes on age and satus of subject (control/exposed) B* β** р-value 1. Methylation (RASSF1A + p14/ARF) ~ status +age -0,066±0,029 Constant Exposure 0,018±0,032 0,031 Age 0,003±0,001 0,242 Coefficient of determination R2 = 0,067 0,024 0,576 1,7 х 10-5 8,6×10-7 2. Methylation (p16/CDKN2A + GSTP1) ~ status + age Constant Exposure 0,655 -0,012±0,028 0,160±0,030 0,290 Age 0,001±0,001 0,053 Coefficient of determination R2 = 0,102 1,7 х 10-7 0,330 3,7×10-10 • *- coefficient of linear regression; • ** - standardized coefficient of linear regression (in units of standard deviations) Age-associated changes of DNA methylome. DNA containing three Schematic representation of DNA methylation patterns genes and three classes of in young (A) vs elderly (B) people interspersed repeats Besides extensive genome-wide hypomethylation, aging involves a progressive gain of DNA methylation, which is associated with CGI-promoters Zampieri, M., et al. Reconfiguration of DNA methylation in aging. Mech. Ageing Dev. (2015) http://dx.doi.org/10.1016/j.mad.2015.02.002 CONCLUSION 1. The reality of hypermethylation of CpG islands in promoters of genes of basic protective functions of cells is demonstrated in blood leukocytes in remote periods after irradiation of human body. 2. Differential role of age and radiation exposure factor in the hypermethylation of various genes was identified. 3. In present work in blood leukocytes of healthy subjects we observed methylation changes which reproduce gene hypermethylation found in malignant cells. 4. Additional studies with involvement in the analysis of a larger number of genes are required to identify epigenetic markers of radiation-induced premature aging of the organism and the development of age-associated oncological and nononcological disease. Thank you for attention!