Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Genome evolution wikipedia , lookup
E. coli long-term evolution experiment wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Restriction enzyme wikipedia , lookup
Molecular evolution wikipedia , lookup
SNP genotyping wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Cystic fibrosis • the most common autosomal recessive (AR) disorder among Caucasians, carriers of cystic fibrosis are not affected by the disease • carrier frequency - 1 in 25 individuals of Northern European descent – ethnic variability – affecting both males and females equally • CFTR - cystic fibrosis transmembrane conductance regulator gene, localized on chromosome 7 • mutation in the CFTR gene • CFTR encodes a chloride channel; transport of chloride ions across plasma membrane of epithelial cells that line the lung airways, pancreas, sweat glands, and other tissues • disorder of epithelial ion transport Disease • chronic and progressive disease • pulmonary disease – damage to the lungs because of accumulation of thick mucus, improper function of water secretion and its cleaning function, breathing difficulties, frequent resp. infections, permanent lung damage – Viscous mucus in the lungs – chronic airway infection (pneumonia, Pseudomonas, Cephacia) – Damage to lungs shortens life expectancy – 30 - 40 years • digestive system – pancreatic secretion – leading to digestion problems, malabsorption of proteins and fats, retained enzymes causes fibrosis – liver – plugging of small bile ducts, cirrhosis – meconium ileus – intestinal obstruction (15-20% CF babies) • reproductive system – improper formation of the vas deferens leading to male sterility • sweat glands – uptake of chloride from sweat ducts – absence of functional CFTR causes increased sodium chloride content, excess salt loss Molecular causation of CF CFTR protein - cystic fibrosis transmembrane conductance regulator • cAMP-regulated chloride channel • transport of chloride ions across plasma membrane of epithelial cells (lungs, pancreas, sweat glands, and other tissues) • mutations in the CFTR gene Cllumen TM – transmembrane TM1 TM2 NBD1 cytoplasm NBD2 spanning domains NBD-nucleotide binding domains (ATP) R R-regulation domain (cAMPdep.) CFTR mutations • There is one the most commonly inherited allele which is known to cause up to 70% of all cystic fibrosis cases. This mutation is called the delta – F508 mutation • Δ F508 allele has 3 nucleotides deletion, which code for the amino acid phenylalanine (F) in the 508 position of the amino acid sequence of the chloride transporter • There are twelve other common mutations with a combined frequency of ~15% (in total 1967 mutations, http://www.genet.sickkids.on.ca/cftr/StatisticsPage.html) • Reverse hybridization kit (34 mutation) – detects about 91% of patients of Czech origin Mutation in the CFTR gene • • • • germinal mutations somatic mutations have not been described so far de novo mutation – rarely distribution of mutation shown population specificity Hemochromatosis • autosomal recessive disease affecting iron metabolism, carrier frequency - 1 in 15 individuals (Czech population), incomplete penetrance • excessive iron absorption, its deposition in organs (mainly parenchymal) and subsequent damage of the organism • hepatopathy (cirrhosis, hepatocellular carcinoma) • diabetes mellitus, arthropathy, hypogonadism, kardiomyopathy, amenorhea • serum iron, transferrin saturation, ferritin, liver biopsy • repeated phlebotomy HFE gene mutations RFLP Restriction Fragment Length Polymorphism restriction analysis of DNA by its digestion with restriction endonucleases (RE) in specific restriction sites in the case the sequence difference (polymorphism) creates or disturbs a specific site for RE, after restriction, fragments with different sizes are formed RFLP Restriction Fragment Length Polymorphism • Restriction endonucleases (RE) – known about 2100 bacterial RE – RE recognize variously short nucleotides sequences (4,6,8), in which then they digest covalent phosphodiester bonds • Principle of the analysis – starting DNA (genomic DNA, PCR product) – digestion with a restriction enzyme into fragments with different sizes – fragments electrophoresis separation Sequence of C282Y mutation (hemochromatosis) 5´- TGGCAAGGGTAAACAGATCCctctcctcatccttcctctttcctgtcaagtgccctcctttggtgaaggtgacacatcatgtgacctcttca gtgaccacactacggtgtcgggccttgaactactacccccagaacatcaccatgaagtggctgaaggataagcagccaatggatgccaaggagttcgaac GCcaggtgg ctaaagacgtattgcccaatggggatgggacctaccagggctggataaccttggctGTACcccctggggaagagcagagatatacGT agcacccaggcctggatcagcccctcattgtgatctggggtatgtgactgatgagagccaggagctgagaaaatctattgggGGTTGAGAGGAGTGC CTGAGgaggtaattatggcagtgagatgaggatctgctctttgttagggggtgggctgagggtggcaatcaaaggctttaacttgctttttctgttttagagccctca ccgtctggcaccctagtcattggagtcatcagtgga – 3´ Primers restriction endonucleasis RsaI restriction site (GTAC) mutation C282Y (GTGC → GTAC) RFLP – mutation C282Y - ELFO RFLP – mutation C282Y+H63D (hemochromatosis) • MIX – per 1 sample • 17 ul H2O • 2 ul buffer • 10 ul PCR product • 1 ul restriction endonuclease (add on ice) C282Y: restriction endonuclease RsaI H63D: restriction endonuclease BclI Evaluation of the results of the RFLP analysis Mutation C282Y (v bp) Healthy homozygote : 250 140 Homozygote with mutation : 250 Heterozygote: 250 140 111 111 Evaluation of the results of the RFLP analysis Mutation H63D (v bp) Healthy homozygote: Homozygote with mutation: Heterozygote: 208 208 138 70 138 70 Detection of ΔF508 mutation in CFTR gene This technique depends on the specificity of PCR primers ASO-PCR: 3 primers are made: General primer (G) Specific primer to normal sequence (N) Specific primer to mutated sequence (M) TARGET SEQUENCE G X N M PCR reaction is performed in 2 tubes: PCR mix M0 contains primer G and primer N PCR mix M1 contains primer G and primer M C/N C/M C/N C/M C/N C/M 1 2 1 2 1 2 Homozygous No Mutation Heterozygous Carrier Homozygous for Mutation PCR – deltaF508 (cystic fibrosis) PCR mix 0: • water • buffer • dNTP mix • MgCl2 • primers M0 • DNA 8,5 µl 2,0 µl 4,0 µl 2,0 µl 1,2 µl 2,0 µl • Taq polymerase0,4 µl (on ice) PCR mix 1: • water • buffer • dNTP mix • MgCl2 • primers M1 • DNA 8,5 µl 2,0 µl 4,0 µl 2,0 µl 1,2 µl 2,0 µl • Taq polymerase0,4 µl (on ice) Evaluation of the results of the CFTR gene analysis Mutation ΔF508 detection contingent upon the cystic fibrosis Allele specific PCR + gel electrophoresis M0 – PCR reaction detects non-mutated allele M1 – PCR reaction detects mutated allele M0 M1 M0 M1 M0 M1 M0 M1 M0 M1 PCR product for control gene PCR product for CFTR gene (ΔF508) Unutilized PCR chemicals (may not always be visible) healthy homozygote heterozygote homozygote with mutation