Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Gene desert wikipedia , lookup
Whole genome sequencing wikipedia , lookup
Expanded genetic code wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Non-coding DNA wikipedia , lookup
Genetic code wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Personalized medicine wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Human Genetic Variation Weibin Shi Genetic variations underlie phenotypic differences Wilt Chamberlain, a famous NBA basketball player (7 feet, 1 inch; 275 pounds) Willie Shoemaker, a famous horse racing jockey (4 feet, 11 inches; barely 100 pounds). Genetic variations cause inherited diseases Genetic Diseases Complex Diseases Environmental Diseases - Cystic fibrosis - Alzheimer disease - Influenza - Down syndrome - Cardiovascular Disease - Hepatitis - Sickle cell disease - Turner syndrome - Diabetes (type 2) - Measles - Parkinson Disease - Environment - Genes Basic terminology Locus – location of a gene/marker on the chromosome. Allele – one variant form of a gene/marker at a particular locus. Locus1 Possible Alleles: A1,A2 Locus2 Possible Alleles: B1,B2,B3 A little more basic terminology Polymorphism: - - Variations in DNA sequence (substitutions, deletions, insertion, etc) that are present at a frequency greater than 1% in a population. Have a WEAK EFFECT or NO EFFECT at all. Ancient and COMMON. Mutation: - - Variations in DNA sequence (substitutions, deletions, etc) that are present at a frequency lower than 1% in a population. Can produce a gain of function and a loss of function. Recent and RARE. Some Facts In human beings, 99.9% bases are same Remaining 0.1% makes a person unique Different attributes / characteristics / traits • how a person looks • diseases he or she develops These variations can be: Harmless (change in phenotype) Harmful (diabetes, cancer, heart disease, Huntington's disease, and hemophilia ) Latent (variations found in coding and regulatory regions, are not harmful on their own, and the change in each gene only becomes apparent under certain conditions e.g. susceptibility to heart attack) Forms of genetic variations Single nucleotide substitution: replacement of one nucleotide with another Microsatellites or minisatellites: these tandem repeats often present high levels of inter- and intra-specific polymorphism Deletions or insertions: loss or addition of one or more nucleotides Changes in chromosome number, segmental rearrangements and deletions How many variations are present in the average human genome ? SNPs appear at least once per 0.3-1-kb average intervals. Considering the size of entire human genome (3.2X109 bp), the total number of SNPs is around to 5-10 million Potentially polymorphic microsatellites are over 100,000 across the human genome The insertion/deletions are very difficult to quantify and the number is likely to fall in between SNPs and microsatellites How do we find sequence variations? • look at multiple sequences from the same genome region • use base quality values to decide if mismatches are true polymorphisms or sequencing errors Vcam1 : Coding-NonSynonymous AGGAAAAGAACATAACAAGAACTATTTTTCGCCCGAACTC B6 AGGAAAAGAACATAACAAGGACTATTTTTCGCCCGAACTC C3H B6 C3H Human Genetic Variation Most abundant type: SNPs-Single Nucleotide Polymorphisms GATTTAGATCGCGATAGAG GATTTAGATCTCGATAGAG ^ about 90% of all human genetic variations What is the difference between SNP and mutation? For a variation to be considered a SNP, it must occur in at least 1% of the population. Life cycle of SNP (long way from mutation to SNP) Appearance of new variant by mutation Survival of rare allele Increase in allele frequency after population expand New allele is fixed in population as novel polymorphism Basic facts about SNPs SNPs occur every 300-1000 bases in human genome; Two of every three SNPs involve the replacement of cytosine (C) with thymine (T); SNPs can occur in both coding (gene) and noncoding regions of the genome; Many SNPs have no effect on cell function, but others could predispose people to disease or influence their response to a drug. Single base changes Transitions Purine to purine or pyrimidine to pyrimidine A to G or G to A T to C or C to T Transversions Purine to pyrimidine or pyrimidine to purine SNP Databases •NCBI dbSNP http://www.ncbi.nlm.nih.gov/SNP/index.html •Human Genome Variation Database (HGVbase) http://hgvbase.org/ International HapMap Project http://snp.cshl.org/ Classification of SNPs 1. Coding SNPs Synonymous: when single base substitutions do not cause a change in the resultant amino acid Non-synonymous: when single base substitutions cause a change in the resultant amino acid 2. Non-coding SNPs that influence gene expression 3. Non-coding silent SNPs SNPs as gene mapping markers SNPs are used as genetic markers to identify genes responsible for disease susceptibility or a particular trait. Point mutations Not all single base pair differences are SNPs They can be a mutation if least abundant allele has a frequency < 1% in a population Causes of gene mutations Consequences of mutations Most - mutations are neutral 97% DNA neither codes for protein or RNA, nor indirectly affects gene function A new variant in the 1.5% coding regions may not result in a change in amino acid Variants that change amino acid may not affect function Certain mutations have functional effect and even cause disease - Gain-of-function mutations often produce dominant disorders Loss-of-function mutations result in recessive disease Consequences of mutations Missense mutations differ in severity Nonsense mutation results in premature termination of translation conservative amino acid substitution substitutes chemically similar amino acid, less likely to alter function nonconservative amino acid substitution substitutes chemically different amino acid, more likely to alter function consequences for function often context-specific truncated polypeptides often are nonfunctional Point mutation in non-coding region may affect transcription, RNA splicing, and protein assembling Microsatellite di-, tri-, and tetra-nucleotide repeats TGCCACACACACACACACAGC TGCCACACACACA------GC TGCTCATCATCATCAGC TGCTCATCA------GC TGCTCAGTCAGTCAGTCAGGC TGCTCAGTCAG--------GC The second abundant genetic variation in the human genome Usually have no functional effect, but some do Trinucleotide repeats-associated diseases Characterized by expansion of threebase-pair repeats few repeats to hundreds of repeats expansion results in abnormal protein, disease number of repeats may expand in subsequent generations Triplet repeat expansion • Normal Disease Huntington disease Kennedy disease Spino-cerebellar Ataxia CAG 19-36 Machado Joseph D CAG 12-36 67-75 Myotonic dystrophy CTG 5-35 50-400 Fragile X CGG CCG GCC 6-50 200-1000 Gene CAG 9-35 37-100 Huntingtin CAG 17-24 40-55 androgen receptor 43-81 Ataxin 1 SCA DM FMR1 Many result in neurodegeneration Severity of many diseases increases with the number of repeats Minisatellite • 6-64 bp repeating pattern 1 61 121 181 241 301 361 421 tgattggtct attttttagg tggtatttta gatttcggga tacttgattt ggattttaag ttttaggatt ctgaatataa ctctgccacc aattttttta ggatttactt tttcaggatt tgggatttta ttttcttgat acgggatttt atgctctgct gggagatttc atggattacg gattttggga ttaagttttc ggattacggg tttatgattt agggtgctca gctctcgctg cttatttgga ggattttagg ttttaggatt ttgattttat attttagggt taagatttta ctatttatag atgtcattgt ggtgatggag gttctaggat gagggatttt gattttaaga ttcaggattt ggatttactt aactttcatg tctcataata gatttcagga tttaggatta agggtttcag ttttaggatt cgggatttca gattttggga gtttaacata cgttcctttg These occur at more than 1000 locations in the human genome Usually have no functional effect Transposon and mutation Transposons are interspersed DNA repeats that can cause mutations and change the amount of DNA in the genome Nondisjunction Trisomy Trisomy 21 Down Syndrome Down Syndrome 1 per 800 births Large tongue Flat face Slanted eyes Single crease across palm Mental retardation Some are not Turner Syndrome Turner Syndrome Short Absence of a menstrual period Produce little estrogen Sterile Extra skin on neck Polymorphism Mutation Gene confers an increased risk, but does not directly cause disorder Mendelian pattern of inheritance No clear inheritance pattern Rare Common in population Gene directly leads to disorder