Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download point mutation - Northwest ISD Moodle
Document related concepts
Transcript
Mutations Changes to DNA 2009-2010 Mutations • Changes to DNA are called mutations – change the DNA – changes the mRNA – may change protein – may change trait DNA TACGCACATTTACGTACG mRNA AUGCGUGUAAAUGCAUGC protein aa aa aa aa aa aa aa trait Types of mutations • Changes to the letters (A,C,T,G bases) in the DNA – point mutation • change to ONE letter (base) in the DNA • may cause change to protein, may not – frameshift mutation • addition of a new letter (base) in the DNA sequence • deletion of a letter (base) in the DNA • both of these shift the DNA so it changes how the codons are read • big changes to protein! Point Mutations • One base change – can change the meaning of the whole protein THEFATCATANDTHEREDRATRAN THEFATCARANDTHEREDRATRAN OR THEFATCATENDTHEREDRATRAN Does this change the sentence? A LITTLE! Point Mutations • Missense mutation = changes amino acid AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGUAUGCGAGUGA MetArgValTyrValCysGluStop Does this change the protein? DEPENDS… Sickle Cell Disease Symptoms Caused by a genetic defect Anemia Pain Frequent infections Delayed growth Stroke Pulmonary hypertension Organ damage Blindness Jaundice gallstones Carried by 5% of humans Carried by up to 25% in some regions of Africa Life expectancy 42 in males 48 in females Sickle cell anemia • Hemoglobin protein in red blood cells – strikes 1 out of 400 African Americans – limits activity, painful & may die young Normal round cells Misshapen sickle cells Only 1 out of 146 amino acids Point Mutations • Silent mutation = no change to protein AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGCUUGCGAGUGA MetArgValTyrAlaCysGluStop The code Does this has change the protein? repeats in it! Why not? Point Mutations • Nonsense mutation = change to STOP AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Really destroyed that protein! AUGCGUGUAUAAGCAUGCGAGUGA MetArgValStop Frameshift Mutations • Add or delete one or more bases – changes the meaning of the whole protein THEFATCATANDTHEREDRATRAN Delete Add one! one! Does this change the sentence? A LOT! THEFATCANTANDTHEREDRATRAN OR THEFATCAANDTHEREDRATRAN Frameshift Mutations • Addition = add one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGUCAUGCGAGUGA MetArgValTyrValMetArgValA Does this change the protein? A LOT! Frameshift Mutations • Deletion = lose one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGAUGCGAGUGA MetArgValTyrAspAlaSerGA Does this change the protein? A LOT! Cystic fibrosis • Broken salt channel in cells – strikes 1 in 2500 white births – gene codes for a protein channel that allows salt to flow across cell membrane • broken protein doesn’t work as channel • doesn’t allow salt out of cell, so water doesn’t flow out either • thicker & stickier mucus coating around cells • mucus build-ups in lungs & causes bacterial infections • destroys lung function – without treatment children die before 5; with treatment can live past their late 20s Salt channel transports salt through protein Effect on Lungs channel out of cell normal lungs airway salt channel salt normal mucus H 2O cells lining lungs cystic fibrosis salt H 2O Osmosis problems! thick mucus mucus & bacteria build up = lung infections & damage Deletion leads to Cystic fibrosis deletion Loss of one amino acid!
