Download DNA Mutations PPT

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project

Document related concepts

Genome evolution wikipedia , lookup

Replisome wikipedia , lookup

Gel electrophoresis of nucleic acids wikipedia , lookup

Silencer (genetics) wikipedia , lookup

Genetic code wikipedia , lookup

DNA repair wikipedia , lookup

Molecular cloning wikipedia , lookup

Community fingerprinting wikipedia , lookup

Non-coding DNA wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

Nucleic acid analogue wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Deoxyribozyme wikipedia , lookup

Molecular evolution wikipedia , lookup

Mutation wikipedia , lookup

Transcript
DNA Mutations
What if this DNA…
CACGTGGACTGAGGACTCCTC
…was changed to this DNA?
CACGTGGACTGAGGACACCTC
What if this DNA…
CACGTGGACTGAGGACTCCTC
…was changed to this DNA?
CACGTGGACTGAGGACACCTC
What does it matter???
CACGTGGACTGAGGACTCCTC
Codon for CTC =
glutamate
CACGTGGACTGAGGACACCTC
Codon for CAC =
valine
What does it matter???
Mutation = any change in a DNA sequence
- usually happens during DNA replication
- in sex cells, it may affect individual’s
offspring/children
- in body cells, it may affect the individual
Mutations can:
- be bad, leading to cancer, aging, birth
defects, self-aborted embryos
- be good, making an organism survive
better in its environment
- Example: bacteria becoming antibiotic-resistant
The ability to drink milk
as an adult is a helpful
mutation.
- have no effect
- Example:
- CAC =
valine
- CAT =
valine
Types of Mutations
1. gene mutations – only affects one gene
a. point mutation
- a substitution of a single base pair
- changes only one amino acid (if any!)
Types of Mutations
b. frameshift mutation
- a single base is added or deleted
- changes every amino acid after mutation site
- also called a nonsense mutation
http://highered.mcgraw-hill.com/sites/0072552980/student_view0/chapter9/animation_quiz_5.html
Types of Mutations
2.
Chromosomal mutation – may affect
more than one gene
Examples: nondisjunction, deletion,
insertion, inversion, translocation
What can cause a mutation?
***A mutation can be inherited, caused by
environmental agents, or happen spontaneously
Mutagen – anything environmental that can cause
a change in DNA
Mutagens
 Radiation – UV, X-rays, nuclear
Mutagens

Chemicals – asbestos, formaldehyde,
chemicals in tobacco products
(many mutagens are also carcinogens – cancer causing)
Mutation Repair
Note: Our DNA mutates all
the time, but our cells
have repair
mechanisms. It is the
overexposure to a
mutagen that causes the
worst problems, because
the cell cannot repair all
of it in time. Also, repair
effectiveness reduces
with age.
What’s Happening in Japan