Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
DNA The Secrets it tells us about Evolution! Remember: Gene – Chromosome – 1 molecule of DNA = 1 chromosome What are the building blocks of DNA? What are the building blocks of protein? How do genes code for genetic traits? Answer: 1 gene code for one protein! Examples: Eye color Hair color Normal Blood clotting vs. hemophilia We know how the code works! CCCGATATTACGCTTAGGTACCGTC Every 3 bases code for one amino acid! (See board) DNA & Evolution Chimpanzees and Humans share 98-99% of their DNA! CCCGTCAGGCTAATACGAGCGGT CCCGTCGGGCTAATACGAGCGGT DNA & Evolution Who can read the human genetic code? The genetic code is UNIVERSAL! Practical Implication: Genetic engineering: Bacteria are programmed with HUMAN insulin gene to produce………….?