* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Document
Survey
Document related concepts
Transcriptional regulation wikipedia , lookup
List of types of proteins wikipedia , lookup
History of molecular evolution wikipedia , lookup
Molecular cloning wikipedia , lookup
Non-coding DNA wikipedia , lookup
Community fingerprinting wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Biochemistry wikipedia , lookup
Expanded genetic code wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Transcript
Chapter 2 Genes, Genetic Codes, and Mutation Chau-Ti Ting [email protected] Unless noted, the course materials are licensed under Creative Commons Attribution-NonCommercial-ShareAlike 3.0 Taiwan (CC BY-NC-SA 3.0) DNA Neucleotides { Phosphate Deoxyribose sugar Nitrogen base Adenine Guanine Cytosine Thymine Purine Pyrimidine 5‘ S A S S G C P S S T A P P 3‘ P T S 5‘ National Taiwan University Chau-Ti Ting 3‘ Source: National Institute of General Medical Sciences (NIGMS) http://images.nigms.nih.gov/index.cfm?event=viewDetail&imageID=2542 One-letter abbreviations for the DNA alphabet B x H A M x D C G R W S Y x K T x V National Taiwan University Chau-Ti Ting RNA Single-stranded nucleotides Ribose sugar in its nucleotides, rather than deoxyribose Four nitrogenous bases: A, C, G, U (uracil) A:U G:C DNA replication: semiconservative replication The polymerization process DNA polymerase 5' to 3' DNA polymerase acts at the replication fork Leading strand Lagging strand 1. RNA oligonucleotides (primer) copied from DNA 2. DNA polymerase elongates with new DNA Okazaki fragment 3. DNA polymerase moves 5' RNA at the end of neighboring fragment and fills gap 4. DNA ligase joins adjacent fragments http://en.wikipedia.org/wiki/DNA_replication Wikipedia Madprime The nature of genes (Fig. 2-4) Prokaryotes gene = regulatory region + coding region + transcription termination signals Eukaryotes gene = regulatory region + exons + introns + transcription termination signals Intron Intron Flanking region Flanking region 5’ Initiation codon GC box CAAT box TATA box 19-27 bp upstream of the transcription startpoint Exon Exon Exon Stop codon Transcription initiation AATAAA box Poly(A) site 30 bp upstream of the 3’ end of the intron Intron 5’ Transcription termination TACTAAC box Promoter region GT National Taiwan University Chau-Ti Ting 3’ 3’ AG GT-AG rule Pseudogenes A pseudogene is a nongenic DNA segment that exhibits a high degree of similarity to a functional gene but which contains defects, such as nonsense and frameshift mutations, that prevent it from being expressed properly. Source: Dan Graur and Wen-Hsiung Li 2000. Fundamentals of Molecular Evolution., p. 14. Sinauer Associates, Inc. Sunderland, MA, USA. Wikipedia Dhorspool Amino Acids The basic building blocks of proteins. There are 20 different amino acid types. Each protein consists of a different sequence of amino acids linked together according to the genetic information encoded in DNA. Source: Howard Hughes Medical Institute -NH2 (amine) group http://www.hhmi.org/genetictrail/glossary.html -COOH (carboxyl) group side chain (-R group) Proteins A molecule composed of amino acids linked together in a particular order specified by a gene's DNA sequence. Proteins perform a wide variety of functions in the cell; these include serving as enzymes, structural components, or signaling Source: Howard Hughes Medical Institute molecules. http://www.hhmi.org/genetictrail/glossary.html Peptide Residue two or more amino acids linked together Source: Howard Hughes Medical Institute http://www.hhmi.org/genetictrail/glossary.html each amino acid in a polypeptide http://en.wikibooks.org/wiki/Structural_Biochemistry/Proteins/Structures N terminus terminated with free amine group http://en.wikipedia.org/wiki/N-terminus C terminus terminated by a free carboxyl group http://en.wikipedia.org/wiki/C-terminus Genetic Code • Codon: a section of DNA (3 nucleotide pairs in length) that encodes a single amino acid. • Genetic code: The set of correspondences between nucleotide pair triplets in DNA and amino acid in protein. • Stop codons (termination codons) can be recognized by release factors. http://en.wikipedia.org/wiki/Stop_codon#cite_note-0 ATA TGT ATA AAG GCA Ile Cys Ile Lys Ala Source: A. J. F. Griffiths, J. H. Miller, D. T. Suzuki, R. C. Lewontin, and W. M. Gelbart. 2000. An Introduction to Genetic Analysis, 7th edition. W. H. Freeman and Company. New York, USA. http://www.ncbi.nlm.nih.gov/books/NBK21878/ (a) (b) (c) (d) AGGCAAACCTACTGGTCTTAT AGGCAAATCTACTGGTCTTAT AGGCAAACCTACTGCTCTTAT AGGCAAACCTACTGCAAACAT original sequence C to T transition G to C transversion recombination GTCTT ACCTA (e) AGGCAACTGGTCTTAT deletion of ACCTA (f) AGGCAAACCTACTAAAGCGGTCTTAT insertion of AAAGC (g) AGGTTTGCCTACTGGTCTTAT inversion of GCAAAC Source: Dan Graur and Wen-Hsiung Li 2000. Fundamentals of Molecular Evolution., p. 26. Sinauer Associates, Inc. Sunderland, MA, USA. Substitution mutations Transition Transversion changes beween A and G, or between T and C changes between a purine and a pyrimidine Source: Marjorie A. Hoy 2003. Insect molecular genetics: an introduction to principles and applications, 2 nd edition, p. 23. Academic Press. USA. Synonymous (silent mutations) Nucleotide changes in the encoding part of a gene that do not result in a change in the amino acid sequence of the encoded protein. Source: A. J. F. Griffiths, J. H. Miller, D. T. Suzuki, R. C. Lewontin, and W. M. Gelbart. 2000. An Introduction to Genetic Analysis, 7th edition. W. H. Freeman and Company. New York, USA. Nonsynonymous (replacement mutations) Nucleotide changes in the encoding part of a gene that result in a change in the amino acid sequence of the encoded protein. Source: A. J. F. Griffiths, J. H. Miller, D. T. Suzuki, R. C. Lewontin, and W. M. Gelbart. 2000. An Introduction to Genetic Analysis, 7th edition. W. H. Freeman and Company. New York, USA. DNA mRNA Amino acid CCG CCG Proline CTG CUG Leucine CTC CUC Leucine Types of Mutation Nucleotide substitution Replacement mutations: Nucleotide changes in the encoding part of a gene that result in a change in the amino acid sequence of the encoded protein. Silent mutations: Nucleotide changes in the encoding part of a gene that do not result in a change in the amino acid Source: A. J. F. Griffiths, J. H. Miller, D. T. Suzuki, R. C. Lewontin, and sequence of the encoded protein. W. M. Gelbart. 2000. An Introduction to Genetic Analysis, 7th edition. W. H. Freeman and Company. New York, USA. DNA CCG CTG CTC mRNA CCG CUG CUC Amino acid Proline Leucine Leucine Addition or deletion (frameshift mutations) Deletion Wild type UUG CUG AGG CCC GAG U…. Deletion UUG CGA GGC CCG AGU …… (a) synonymous Ile Cys Ile ATA TGT ATA Lys AAG Ala GCA Leu CTG ATA Ile Val GTC GTA Val Leu CTG Leu TTA Thr ACA CTG Leu TTA Leu ACA Thr Leu CTG Leu TTA Thr ACA CTG Leu TTA Leu ACA Thr Leu CTG Leu TTA Thr ACA TGT Cys ATA Ile AAG Lys GCA Ala CTG Leu (b) missense Ile Cys ATA TGT Ile ATA Lys AAG Ala GCA Leu CTG ATA Ile TGT Cys ATA Ile AAG Lys GCA Ala CTG Leu Val GTC TTA Phe (c) nonsense Ile Cys ATA TGT Ile ATA Ala GCA Leu CTG Val GTC ATA Ile ATA Ile Lys AAG TAG Stop TGT Cys GCACTGGTACTGTTAACA Source: Dan Graur and Wen-Hsiung Li 2000. Fundamentals of Molecular Evolution., p. 27. Sinauer Associates, Inc. Sunderland, MA, USA. Recombination Crossing over (reciprocal recombination) Gene conversion (non-reciprocal recombination) Deletions and insertions mechanisms unequal crossing over intrastrand deletion replication slippage indel = insertion-or-deletion frameshift mutation Deletion Wild type UUG CUG AGG CCC GAG U…. Deletion UUG CGA GGC CCG AGU …… Copyright Declaration Work Licensing Author/Source Page P3 National Taiwan University Chau-Ti Ting National Institute of General Medical Sciences (NIGMS) http://images.nigms.nih.gov/index.cfm?event=viewDetail&imageID=2542 2012/02/24 visited This work is used subject to the fair use doctrine of : •Article 46, 52 & 65 Taiwan Copyright Act. •Permission for Use NIGMS Image Gallery http://images.nigms.nih.gov/ P4 P5 National Taiwan University Chau-Ti Ting P8 Wikipedia Madprime http://en.wikipedia.org/wiki/File:DNA_replication_split.svg 2012/02/22 visited P10 National Taiwan University Chau-Ti Ting P. 11. “A pseudogene is a nongenic DNA segment that exhibits a high degree of … that prevent it from being expressed properly.” Dan Graur and Wen-Hsiung Li 2000. Fundamentals of Molecular Evolution., p. 14. Sinauer Associates, Inc. Sunderland, MA, USA. It is used subject to fair use doctrine in accordance with Articles 52 & 65 of Taiwan Copyright Act P11 Work Licensing Author/Source Page Wikipedia Dhorspool http://en.wikipedia.org/wiki/File:Central_Dogma_of_Molecular_Biochemistry_with_Enz ymes.jpg 2012/02/22 visited P12 P. 13. “The basic building blocks of proteins … linked together according to the genetic information encoded in DNA.” Howard Hughes Medical Institute http://www.hhmi.org/genetictrail/glossary.html 2012/02/22 visited It is used subject to fair use doctrine in accordance with Articles 52 & 65 of Taiwan Copyright Act and copyright notice of HHMI (http://www.hhmi.org/popups/copyright.html) P13 P. 14. “A molecule composed of amino acids linked together in … structural components, or signaling molecules.” Howard Hughes Medical Institute http://www.hhmi.org/genetictrail/glossary.html 2012/02/22 visited It is used subject to fair use doctrine in accordance with Articles 52 & 65 of Taiwan Copyright Act and copyright notice of HHMI (http://www.hhmi.org/popups/copyright.html) P14 P. 14. “Peptide two or more amino acids linked together” Howard Hughes Medical Institute http://www.hhmi.org/genetictrail/glossary.html 2012/02/22 visited It is used subject to fair use doctrine in accordance with Articles 52 & 65 of Taiwan Copyright Act and copyright notice of HHMI (http://www.hhmi.org/popups/copyright.html) P14 Wikipedia National Human Genome Research Institute (NHGRI) http://en.wikipedia.org/wiki/File:Protein-primary-structure.png 2012/02/22 visited Wikipedia LadyofHats http://en.wikipedia.org/wiki/File:Main_protein_structure_levels_en.svg 2012/02/22 visited P. 17. “Codon: a section of DNA (3 nucleotide pairs in length) that encodes a single amino acid.” A. J. F. Griffiths, J. H. Miller, D. T. Suzuki, R. C. Lewontin, and W. M. Gelbart. 2000. An Introduction to Genetic Analysis, 7th edition. W. H. Freeman and Company. New York, USA. http://www.ncbi.nlm.nih.gov/books/NBK21878/ 2012/02/22 visited It is used subject to fair use doctrine in accordance with Articles 52 & 65 of Taiwan Copyright Act P15 P16 P17 24 Work P. 17. “Genetic code: The set of correspondences between nucleotide pair triplets in DNA and amino acid in protein.” Licensing Author/Source Page A. J. F. Griffiths, J. H. Miller, D. T. Suzuki, R. C. Lewontin, and W. M. Gelbart. 2000. An Introduction to Genetic Analysis. 7th edition. W. H. Freeman and Company. New York, USA. http://www.ncbi.nlm.nih.gov/books/NBK21878/ 2012/02/22 visited It is used subject to fair use doctrine in accordance with Articles 52 & 65 of Taiwan Copyright Act . P17 Dan Graur and Wen-Hsiung Li 2000. Fundamentals of Molecular Evolution., p. 26. Sinauer Associates, Inc. Sunderland, MA, USA. It is used subject to fair use doctrine in accordance with Articles 52 & 65 of Taiwan Copyright Act P18 P. 19. “Transition changes beween A and G, or between T and C Transversion changes between a purine and a pyrimidine” P19 Marjorie A. Hoy 2003. Insect molecular genetics: an introduction to principles and applications, 2 nd edition, p. 23. Academic Press. USA. http://books.google.com.tw/books?id=MPkwi-i33zYC&printsec=frontcover&hl=zhTW#v=onepage&q&f=false 2012/02/22 visited It is used subject to fair use doctrine in accordance with Articles 52 & 65 of Taiwan Copyright Act P. 19, 20. “Nucleotide changes in the encoding part of a gene that do not result in a change in the amino acid sequence of the encoded protein.” A. J. F. Griffiths, J. H. Miller, D. T. Suzuki, R. C. Lewontin, and W. M. Gelbart. 2000. An Introduction to Genetic Analysis, 7th edition. W. H. Freeman and Company. New York, USA. http://www.ncbi.nlm.nih.gov/books/NBK21878/ 2012/02/22 visited It is used subject to fair use doctrine in accordance with Articles 52 & 65 of Taiwan Copyright Act P19,20 P. 19, 20. “Nucleotide changes in the encoding part of a gene that result in a change in the amino acid sequence of the encoded protein.” A. J. F. Griffiths, J. H. Miller, D. T. Suzuki, R. C. Lewontin, and W. M. Gelbart. 2000. An Introduction to Genetic Analysis, 7th edition. W. H. Freeman and Company. New York, USA. http://www.ncbi.nlm.nih.gov/books/NBK21878/ 2012/02/22 visited It is used subject to fair use doctrine in accordance with Articles 52 & 65 of Taiwan Copyright Act P19,20 Dan Graur and Wen-Hsiung Li 2000. Fundamentals of Molecular Evolution., p. 27. Sinauer Associates, Inc. Sunderland, MA, USA. It is used subject to fair use doctrine in accordance with Articles 52 & 65 of Taiwan Copyright Act P21 25