Download modification of flowering time in osteospermum ecklonis l. by

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Transcriptional regulation wikipedia , lookup

Promoter (genetics) wikipedia , lookup

Gene expression profiling wikipedia , lookup

Gene expression wikipedia , lookup

Gene regulatory network wikipedia , lookup

RNA-Seq wikipedia , lookup

Silencer (genetics) wikipedia , lookup

Genetically modified organism wikipedia , lookup

Real-time polymerase chain reaction wikipedia , lookup

Genetic engineering wikipedia , lookup

Community fingerprinting wikipedia , lookup

Plant breeding wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Transcript
MODIFICATION OF FLOWERING TIME IN OSTEOSPERMUM ECKLONIS L.
BY CONSTANS GENE
Annalisa Giovannini, Giacomo Morreale, Tilde Berio, Carlo Mascarello and
Andrea Allavena
Experimental Institute for Floriculture
Corso degli Inglesi 508
I-18038 Sanremo (Imperia)
Italy
[email protected]
Keywords: Asteraceae, flowering time genes, ornamental plants, flowering extension
Abstract
Altered onset of flowering in crop plants can be achieved by modifying the expression of
flowering-time genes. In a few cases, these genes can change the flowering time of
species unrelated to the plant from which they were isolated. We pursued this strategy in
order to modify the flowering characteristics of the ornamental plant Osteospermum
ecklonis. The flowering-time gene CONSTANS (CO) from Arabidopsis thaliana
Landsberg erecta was the candidate in our work. This choice was based on literature
demonstrating that A. thaliana transgenic plants containing extra copies of the CO gene
flower earlier than wild type plants, suggesting that CO expression is sufficient to trigger
flowering irrespective of day length. The CO cDNA was cloned in the expression vector
pGREEN under the control of the constitutive promoter 35S. Genetic transformation of
leaf tissue was performed using Agrobacterium tumefaciens strain AGL1. CO constitutive
expression was detected in a checked transgenic clone. The flowering performance of
potted transgenic plants was monitored in the greenhouse in comparison to control plants.
35SCO plants produced 30% more flowers than control, retained their ability to flower in
June when control plants entered vegetative phase and were still able to produce new
flower buds in August.
1. Introduction
Flowering depends on the co-ordinated expression of several classes of genes that
may interact with environmental factors. The flowering-time gene CONSTANS (CO) has
been cloned from A. thaliana Landsberg erecta (Putterill et al., 1993). This gene encodes
a putative transcription factor that is required to promote flowering under long day
conditions in the original species (Putterill et al., 1995). It has been also observed that
transgenic plants of A. thaliana Landsberg erecta, containing extra copies of the gene
(35S::CO), flower earlier than wild type plants even in short day conditions, suggesting
that CO activity limits flowering time (Suarez-Lopez et al., 2000). O. ecklonis
(Compositae) is a popular pot plant native to South Africa. The plant, also known under
the common name “African Daisy”, is a half-hardy perennial characterised by vigorous
growth and plenty of flowers. The flowering time of cultivated varieties is late-winter to
early-spring, and in summer the plants enter a vegetative phase. This is likely to be a
consequence of either long day length condition or high temperature. Ornamental trait
modification and virus tolerance have been achieved in Osteospermum by genetic
engineering (Allavena et al., 2000). In this work we have transformed O. ecklonis with
the CO gene with the aim to modify the flowering time of the species.
Proc. XX EUCARPIA Symp. on New Ornamentals II
Eds. J. Van Huylenbroeck et al.
Acta Hort. 572, ISHS 2002.
163
2. Material and methods
The CO cDNA, kindly provided by Dr. George Coupland from John Innes Centre,
Norwich U.K., was cloned in the pGREEN vector (a gift of Dr. Phil Mullineaux, John
Innes Centre, Norwich, U.K.) under the control of the 35S promoter (cauliflower mosaic
virus (CaMV) constitutive promoter) besides the NPTII gene. Genetic transformation of
leaf tissue was performed using the engineered A. tumefaciens AGL1 strain, according to
Giovannini et al. (1999). O. ecklonis leaf fragments of micropropagated plants were cocultivated with the bacterial suspension culture and after three days they were transferred
to the regeneration medium (MS basal salts and vitamins, 30 g/l sucrose plus 2.8 µM IAA
and 1.3 µM BA) added with kanamycin sulfate (100 mg/l) and cefotaxime (100 mg/l).
Shoots regenerated from several independent transformation events were further
propagated and rooted on basal medium and then acclimatised in the greenhouse to
provide transgenic plant clones; plants regenerated from non co-cultivated leaves were
used as control material. Ten clones were screened for the presence of the foreign CO
gene by PCR analysis. DNA amplification was carried out on alkali treated leaf tissue
using the procedure of Klimyuk et al. (1993). Based on the sequence of A. thaliana
mRNA for CO protein (Gene bank accession number X94937) two synthetic primers
were designed: 5' end primer 5'GTTCACTCTGCCAATCGCGT, 3' end primer
(complementary strand shown) 5'AGCGGAACAACTCTATCTCCCC. PCR conditions
were: thirty-five cycles of denaturation at 94°C, annealing at 56°C (1 min) and extension
at 72°C (1 min), followed by a final extension of 7 min at 72°C. The PCR reactions were
conducted in a total volume of 50 µl. Buffers and Taq DNA polymerase purchased from
Life Technologies Italia S.r.l. (Italy) and the thermocycler PTC100 (MJ Research, Inc.,
USA) were used. The presence of the expected 509 bp DNA fragment was checked by
electrophoretic agarose gel analysis (2% agarose, 1X TAE, 10µg/ml ethidium bromide).
CO gene expression was investigated in clone 301 by RT-PCR analysis. Total RNA was
isolated from micropropagated plants of control and transgenic clone 301; 100 mg of leaf
tissue were used for each sample according to the RNeasy Plant Mini Kit protocol
(Quiagen, Germany). RNA concentrations were determined by absorbance at 260 nm, and
purity was verified by the 260/280 nm absorption ratio. Contaminating DNA was
eliminated in RNA samples using Sigma's Amplification Grade Deoxyribonuclease I.
Approximately 1 µg of total RNA was used in reverse-transcriptase reactions to generate
cDNA. Two-step RT-PCR reactions of Sigma's Enhanced Avian RT-PCR Kit (SigmaAldrich S.r.l., Italy) were performed; 5 µl of cDNA was finally amplified by AccuTaq LA
DNA polymerase with the primers previously indicated and the following PCR
conditions: thirty cycles of denaturation at 94°C, annealing at 56°C (1 min) and extension
at 72°C (1 min), with a final extension of 5 min at 72°C. The amplified DNA fragments
were visualised by electrophoretic agarose gel analysis (2% agarose, 1X TAE, 10µg/ml
ethidium bromide). The flowering performance of transgenic clone 301 (8 plants) was
monitored in comparison with the parent variety (6 plants), in a well-lit greenhouse, from
19th February to the end of April 2001. The number of flower buds per plant, the number
of flowers at anthesis and the total number of flowers per plant (buds, flowers at anthesis
and wilted flowers) were counted weekly, during all the flowering time. At the beginning
of May plants were potted in larger vases and data were collected until June, when O.
ecklonis enters the vegetative phase (not permissive conditions for flowering). The
monitored period covered the normal flowering time of O. ecklonis in our environment.
Data were reported as means ± standard errors.
3. Results
The specific primers, designed for the CO gene, amplified the expected 509 bp
DNA fragment in eight out of ten transgenic clones (Fig. 1). CO constitutive expression
was detected in micropropagated plants of clone 301 by amplification of cDNA sample
with the same set of primers (Fig. 2). Transgenic plants were successfully acclimatised
164
and cultivated in the greenhouse. The average number of flowers at anthesis per plant
(Fig. 3B) was higher in the transgenic plants of clone 301 as a consequence of a more
profuse flower bud production (Fig. 3A). The transgenic plants produced 30% more
flowers per plant than control (Fig. 3C). Moreover, transgenic plants retained their ability
to flower in June whereas control plants flowered sporadically and entered vegetative
phase. In August only transgenic plants were still able to produce new flower buds (an
average number of 7.9 buds per plant).
4. Discussion
The non-conventional breeding program based on genetic engineering was
successful in Osteospermum to modify ornamental traits by using rol genes of
Agrobacterium rhizogenes (Giovannini et al., 1999), and to obtain virus tolerant plants
with the N protein gene of tomato spotted wilt virus (Vaira et al., 2000). Preliminary
results from this work show that constitutive expression of a single Arabidopsis flowering
time CO gene increases the production of flowers in the ornamental plant O. ecklonis
during the normal flowering period (February-May) and extends the period of flowering
during not permissive conditions (June to August). The early flowering phenotype
reported over-expressing CO gene in Arabidopsis (Putterill et al., 1995) is not observed in
35SCO Osteospermum plants of clone 301, probably because in this species the transition
from vegetative to reproductive phase is under the control of a different genetic pathway
(e.g. vernalisation pathway). On the other hand the extension of flowering in the
transgenic plants could be related to the continuous expression of the CO gene and its
regulatory effect on other genes. It is our purpose to evaluate the behaviour of additional
transgenic clones expressing CO gelne and extend the evaluation period along the year.
The final aim is the understanding of the CO gene potential for the production of O.
ecklonis genotypes that flower even in not permissive conditions.
Acknowledgements
The authors would like to thank Dr. George Coupland and Dr. Phil Mullineaux for
providing the CONSTANS gene and the pGREEN vector, respectively. We are also
grateful to Jemma Miller for the English revision of this work.
References
Allavena A., Giovannini A., Berio T., Spena A., Zottini M., Accotto G.P., and Vaira
A.M., 2000. Genetic engineering of Osteospermum SPP: a case story. Acta Hort.
508:129-133.
Giovannini A., Zottini M., Morreale G., Spena A., and Allavena A., 1999. Ornamental
traits modification by rol genes in Osteospermum ecklonis transformed with
Agrobacterium tumefaciens. In Vitro Cell. Dev. Biol.-Plant 35:70-75.
Klimyuk V., Carrol B.J, Thommas C.M., and Jones GDJ, 1993, Alkali treatment for rapid
preparation of plant material for reliable PCR analysis, The Plant J.3: 493-494.
Putteril J., Robson F., Lee K., and Coupland G., 1993, Chromosome walking with YAC
clones in Arabidopsis : isolation of 1700 kb of contiguous DNA on chromosome 5,
including a 300kb region containing the flowering time gene CO. Mol.Gen.Genet. 239:
145-157.
Putteril J., Robson F., Lee K., Simon R., and Coupland G., 1995, The CONSTANS gene
of Arabidopsis promotes flowering and encodes a protein showing similarities to zinc
finger trancription factors, Cell 80: 847-857.
Suárez-López P, Wheatley K., Robson F., Onouchi H., Valverde F., and Coupland G,
2000, CONSTANS mediates between the circadian clock and the control of flowering
in Arabidopsis, Nature 410:1116-1120.
Vaira A.M., Berio T., Accotto G.P., Vecchiati M., and Allavena A., 2000. Evaluation of
165
resistance in Osteospermum ecklonis (DC) Norl. plants transgenic for the N protein
gene of tomato spotted wilt virus. Plant Cell Report 19(10): 983-988.
1 2 3 4 5 6 7 8 9 10 11 12 13 M
Figure 1. PCR analysis of O. ecklonis plants derived from independent transformation
events using A. tumefaciens Agl1 pGREEN NPTII 35SCO. 2% agarose gel showing the
DNA fragments amplified from CONSTANS gene (509 bp): 1 to 10 putative transgenic
plants (cl292, cl293, cl294, cl295, cl297, cl300, cl290, cl301, cl298, cl299); 11 pGREEN
NPTII 35SCO plasmid; 12 control plant of the parental variety; 13 sample without DNA;
M 1kb Ladder marker
1
2
3
4
5
6
Figure 2. Evaluation of CO expression. 2% agarose gel showing the PCR amplification
product (509 bp) of specific primers for CONSTANS gene: 1 and 6 pUC18 Hae III
marker; 2 control cDNA; 3 total RNA sample of cl301 with the amplified DNA
contamination; 4 total RNA sample of cl301 after Dnase I treatment; 5 cDNA of cl301
with the amplification fragment of 509 bp
166
Average no. Flower buds/plant
35
30
Clone 301
25
Control
20
15
10
5
0
Average no. Flowers at anthesis/plant
18
16
14
12
10
8
6
4
2
0
Average no. total flowers/plant
90
80
70
60
50
40
30
20
10
0
1
4
11
18
25
31
37
44
51
59
66
105 113 121
Days from the beginning of flowering
Figure 3. Flowering performance of O. ecklonis control and transgenic plants (clone 301)
from the beginning of flowering (19 February: day 1) to the end of the normal flowering
time (day 66). The number of flower buds per plant (A), the number of flowers at anthesis
(B) and the total number of flowers per plant (buds, flowers at anthesis and wilted
flowers) (C) were counted during all the flowering time. Following this, plants were
potted in larger vases. In June, 105 days from the beginning of flowering, transgenic
plants retained their ability to flower in not permissive conditions developing new flower
buds. Bars represent standard errors
167