Download Conservation of L and 3C proteinase activities across distantly

Journal
of General Virology (2002), 83, 3111–3121. Printed in Great Britain
...................................................................................................................................................................................................................................................................................
Conservation of L and 3C proteinase activities across distantly
related aphthoviruses
Tracey M. Hinton,1 Natalie Ross-Smith,2 Simone Warner,1 Graham J. Belsham2
and Brendan S. Crabb3
1
Department of Microbiology and Immunology and the Co-operative Research Centre for Vaccine Technology,
The University of Melbourne, Victoria 3010, Australia
2
BBSRC Institute for Animal Health, Pirbright, Woking, Surrey GU24 0NF, UK
3
The Walter and Eliza Hall Institute of Medical Research, PO The Royal Melbourne Hospital, Melbourne, Victoria 3050, Australia
The foot-and-mouth disease virus (FMDV) leader (L) proteinase is an important virulence
determinant in FMDV infections. It possesses two distinct catalytic activities : (i) C-terminal
processing at the L/VP4 junction ; and (ii) induction of the cleavage of translation initiation factor
eIF4G, an event that inhibits cap-dependent translation in infected cells. The only other member of
the Aphthovirus genus, equine rhinitis A virus (ERAV), also encodes an L protein, but this shares
only 32 % amino acid identity with its FMDV counterpart. Another more distantly related
picornavirus, equine rhinitis B virus (ERBV), which is not classified as an aphthovirus, also encodes
an L protein. Using in vitro transcription and translation analysis, we have shown that both ERAV
and ERBV L proteins have C-terminal processing activity. Furthermore, expression of ERAV L, but
not ERBV L, in BHK-21 cells resulted in the efficient inhibition of cap-dependent translation in
these cells. We have shown that the ERAV and FMDV L proteinases induce cleavage of eIF4GI at
very similar or identical positions. Interestingly, ERAV 3C also induces eIF4GI cleavage and again
produces distinct products that co-migrate with those induced by FMDV 3C. The ERBV L proteinase
does not induce eIF4GI cleavage, consistent with its inability to shut down cap-dependent
translation. We have also shown that another unique feature of FMDV L, the stimulation of
enterovirus internal ribosome entry site (IRES) activity, is also shared by the ERAV L proteinase but
not by ERBV L. The functional conservation of the divergent ERAV and FMDV proteinases indicates
the likelihood of a similar and important role for these enzymes in the pathogenesis of infections
caused by these distantly related aphthoviruses.
Introduction
Foot-and-mouth disease virus (FMDV) is arguably the
world’s most important pathogen of domesticated animals,
capable of causing devastating economic loss to the cattle,
sheep and pig industries in particular. It is a member of the
genus Aphthovirus in the family Picornaviridae, a classification
shared by only one other virus, equine rhinitis A virus (ERAV)
(Li et al., 1996 ; Pringle, 1997). ERAV, formerly known as
equine rhinovirus 1, is endemic in most if not all countries and
is emerging as an important cause of acute febrile respiratory
Author for correspondence : Brendan Crabb.
Fax j61 3 9347 0852. e-mail crabb!wehi.edu.au
0001-8466 # 2002 SGM
disease in horses (Carman et al., 1997 ; Li et al., 1997 ; Plummer,
1962 ; Studdert, 1996). The similarity of ERAV to FMDV
extends beyond primary sequence identity (Li et al., 1996 ;
Wutz et al., 1996) to include pathogenic features, such as the
primary site of infection (the nasopharynx) and the establishment of a persistent viraemic infection (Studdert, 1996),
physico-chemical properties (Newman et al., 1973, 1977 ;
Studdert & Gleeson, 1978) and functionally similar genetic
elements, such as the internal ribosomal entry site (IRES)
(Hinton et al., 2000). However, there are some important
differences between the two viruses. Most significant amongst
these is the different natural history and host range of ERAV
(which is primarily an infection of horses) and its inability to
cause the vesicular lesions that are so central to the pathology
and significance of FMDV infections.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 29 Apr 2017 22:36:45
DBBB
T. M. Hinton and others
Our laboratory is interested in identifying and characterizing the functions of putative pathogenic determinants of
ERAV with the long-term view of understanding the genetic
elements that govern the common (e.g. virus persistence) and
unique (e.g. tropism) biological features of these distantly
related aphthoviruses. For example, we have shown that
ERAV receptor binding does not occur via an arginine–
glycine–aspartic acid (RGD) motif in VP1 as is the case with
FMDV, although ERAV VP1 does appear to bind host
receptors (Warner et al., 2001). On the other hand, the IRES
elements of ERAV and FMDV appear to function similarly
(Hinton et al., 2000). Here, we describe an investigation into
the function of the leader (L) and 3C proteinases of ERAV. We
have also characterized the function of the L protein of the
more distantly related picornavirus equine rhinitis B virus
(ERBV) (Studdert, 1996 ; Wutz et al., 1996).
The aphthovirus L protein is the most N-terminal coding
region of the polyprotein. FMDV produces two forms of the
L proteinase, Lb and the less abundant Lab. These species differ
only at their N termini, the result of initiation at one of two inframe AUG codons, which are separated by 84 nucleotides
(Clarke et al., 1985 ; Sangar et al., 1987). FMDV L proteins are
papain-like cysteine proteinases, which fold into two globular
domains, placing the active residues in a cleft traversing the
centre of the molecule (Guarne! et al., 1998, 2000). FMDV L
proteinases have been shown to possess two distinct activities :
(i) self-cleavage at the L\VP4 junction to liberate L from the
growing polyprotein ; and (ii) inducing cleavage of eukaryotic
initiation factor 4G (eIF4G), an integral member of the
translation initiation machinery (Devaney et al., 1988 ; Medina
et al., 1993 ; Piccone et al., 1995b ; Strebel & Beck, 1986). The
latter activity inhibits cellular cap-dependent translation initiation. FMDV L protein processes eIF4GI removing the Nterminal domain responsible for binding eIF4E, the cap-binding
protein. Truncated eIF4GI retains the ability to bind to the
remainder of the eIF4F–eIF3–40S ribosomal subunit complex,
which is sufficient for internal initiation of protein synthesis on
a picornavirus IRES (Kirchweger et al., 1994 ; Pestova et al.,
1996). Shut-off of cap-dependent translation initiation may
promote the production of viral proteins and also inhibit
interferon (IFN)- α\β production, halting an antiviral response
in the infected cell (Chinsangaram et al., 1999, 2001 ; Mayr et
al., 2001). Interestingly, deletion of the L protein produces an
attenuated virus that is unable to spread efficiently to
secondary infection sites, highlighting the fact that this protein
is a major pathogenic determinant (Brown et al., 1996 ; Piccone
et al., 1995a). A further feature of FMDV L is its ability to
enhance translation initiation from type I picornavirus IRESs
present in enteroviruses (Ziegler et al., 1995 ; Roberts et al.,
1998).
Like FMDV, ERAV appears to utilize two in-frame initiation
codons resulting in two forms of the L protein (Hinton et al.,
2000). However, in contrast to FMDV, the ERAV Lab AUG
codon is utilized far more frequently than the Lb AUG. ERAV
DBBC
L proteins are predicted to be of similar length to their FMDV
counterparts and have maintained the key catalytic residues
and predicted secondary structure of FMDV L proteins (Skern
et al., 1998). However, these two proteins share only 32 %
amino acid identity raising doubts as to the likelihood of
extensive functional conservation. ERBV is not an aphthovirus
but is a member of the related Erbovirus genus (Pringle,
1999 ; Wutz et al., 1996). ERBV also encodes an L protein,
which is predicted to be of similar length to FMDV Lab.
However, ERBV L shares only 18 % amino acid identity with
FMDV L and is predicted to fold differently (Wutz et al., 1996).
ERBV L does appear to possess some key catalytic residues,
suggesting that it may function as a proteinase (Skern et al.,
1998).
In addition to extensively processing the viral polyprotein
(reviewed by Ryan & Flint, 1997), FMDV 3C proteinase also
cleaves two important eukaryotic initiation factors, eIF4G and
eIF4A (Belsham et al., 2000). FMDV 3C is the only picornavirus
3C protein that has been shown to function in this way. ERAV
3C shares 40 % amino acid identity with its FMDV counterpart
but its function has not yet been characterized.
In this paper we have shown that the distinctive properties
of the FMDV L and 3C proteinases are shared by their ERAV
counterparts. In contrast, although we demonstrated that
ERBV L is a proteinase that cleaves at the L\VP4 junction, this
enzyme does not appear to possess the other specific functions
attributed to the aphthovirus L proteinases.
Methods
Virus growth and metabolic labelling. ERAV strain 393\76
(Studdert & Gleeson, 1978) and ERBV strain 1436\71 (Steck et al., 1978)
were used throughout this study. Vero, BHK-21 and RK-13 cell
monolayers were grown essentially as described elsewhere (Warner et al.,
2001). For metabolic labelling, Vero cells were cultured in six-well trays
(35 mm# per well) and infected with ERAV at an m.o.i. of 20 TCID per
&!
cell. At 0, 3, 6 or 9 h post-infection (p.i.), cells were starved of methionine
by the addition of methionine-free medium for 1 h, incubated with
30 µCi\ml [$&S]methionine (Amersham) for 30 min and the cells lysed in
500 µl SDS–PAGE reducing sample buffer. Samples were separated using
12 % SDS–PAGE gels, which were fixed in a 7 % acetic acid, 10 %
methanol solution and treated with Amplify (Amersham). Dried gels
were either exposed to Kodak Hyperfilm MP or underwent phosphoimager analysis.
Plasmid construction. Plasmids were constructed using standard
techniques with only slight modifications (Sambrook et al., 1989). The
plasmids pA-NTRj5hL and pB-NTRj5hL contained most of the first
half of the ERAV and ERBV genomes, respectively (S. Warner & B. S.
Crabb, unpublished data). These were subjected to PCR amplification in
the presence of the relevant oligonucleotides (Table 1) using 35 cycles of
94 mC for 45 s, 54 mC for 30 s and 68 mC for 45 s, and using Taq HiFi
according to the manufacturer’s instructions (Gibco BRL). PCR products
were digested with NcoI and XhoI before ligation into similarly digested
pET-28a plasmid. These plasmids included pEA\L, pEA\L-VP4, pEA\
∆L-VP4, pEB\L-VP4 and pEA\3C. pB-NTRj5hL was renamed pEB\LVP1 for use in experiments described in this paper. Construction of
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 29 Apr 2017 22:36:45
Aphthovirus L and 3C proteinase activity
Table 1. Oligonucleotides used to construct L and 3C protein plasmids
Oligonucleotide
EA-LproF
EA- ∆LproF
EA-LproR
EA-VP4R
EB-LproF
EB-LproR
EA-3CF
EA-3CR-cmyc
Position
Sequence (5h
5h end of ERAV L protein, mutates out AUG1\sense
396 nt downstream of 5h end of ERAV L protein\sense
3 nt upstream of ERAV L protein cleavage site\antisense
21 nt upstream of ERAV VP4 C-terminal cleavage site\antisense
5h end of ERBV L protein\sense
105 nt downstream of ERBV L protein cleavage site\antisense
5h end of ERAV 3C protein\sense
3h end of ERAV 3C protein fused to c-myc tag\antisense
3h)*
ACTGACACCATGG*CGGCGTCTAAG
GCCCCATGGTGTGTCTTTC
CTCGAGTGCTTTTTC
CAAGCTCGAGCTAACTAGAGAA
TGTTCCATGGTGACAATGGC
CCTCGAGGTCCACTGAATTTTG
AAACCATGGAGATTAGGACTG
CTCGAGTCACAGGTCCTCCTCGCTGATCAGCTT
CTGCTCCTGTTTCTGGGGCCA GAG
* Nucleotides in bold type represent restriction sites utilized for cloning.
pEB\ ∆L-VP2 involved digestion of pEB\L-VP1 with XbaI\SacI and
ligation into NheI\SacI-digested pET-28a (note that digestion with XbaI
and NheI produce compatible ends). The C-terminal extension of pEA\LVP4 to produce pEA\L-VP1 involved digestion of pA-NTRj5hL with
SpeI\XhoI and ligation into similarly digested pEA\L-VP4. Inserts were
sequenced by primer extension and BigDye chain termination chemistry
(Applied Biosystems). pET.EA(1–965) and pET.EB(1–920) have been
described previously (Hinton & Crabb, 2001) and in this paper have been
renamed pCAT\EA\GFP and pCAT\EB\GFP, respectively. Both plasmids contain the CAT and GFP reporter genes separated by either the full
ERAV or ERBV 5h NTR in the pET-28a backbone. Expression of CAT
was used as a measure of cap-dependent translation.
In vitro translation assays. Coupled transcription and rabbit
reticulocyte lysate (RRL) translation reactions were performed essentially
according to the manufacturer’s instructions (Promega). Briefly, 0n5 µg
(except where indicated) of plasmid DNA and [$&S]methionine (10 µCi)
were added to an RRL reaction mixture and incubated at 30 mC for
90 min. If a single plasmid was to be compared with samples containing
two plasmids, 0n25 µg of parental vector (pET-28a) was added to the mix
such that the final amount of DNA in all reactions was 0n5 µg. Samples
were separated on 15 % SDS–PAGE gels, fixed for 30 min in a 7 % acetic
acid, 10 % methanol solution and incubated for 30 min in 1M sodium
salicylate, 50 % methanol for fluorography. Dried gels were analysed
using a phosphoimager (Molecular Dynamics Inc.) and\or using X-ray
film.
Transient expression assays to assess inhibition of capdependent translation. For T7-mediated transcription, 0n5 µg of
plasmid DNA was transfected into BHK-21 cells that had been infected
with the recombinant vaccinia virus vTF7-3, which expresses T7 RNA
polymerase (Fuerst et al., 1986). Lipofectamine Plus reagent (Life
Technologies)-mediated transfection was performed as described previously (Hinton et al., 2000). Inhibition of cap-dependent translation was
monitored by co-transfection of pCAT\EA\GFP or pCAT\EB\GFP
with the respective L protein expression vector. Cell extracts were
prepared 20 h post-transfection. Each experiment was performed at least
twice. Transfected cells were harvested by trypsin treatment, resuspended
in PBS and separated for relevant assays. CAT activity was determined
by thin-layer chromatography as directed by the manufacturer (Promega).
GFP expression was monitored by FACS analysis as described previously
(Hinton et al., 2000). For each sample, the GFP : CAT value represented
the ratio of total GFP fluorescence (mean) to CAT activity ( % acetylation
in a linear range) from an equivalent number of cells.
Transient expression assays to assess IRES activation.
Transient expression assays were performed as described previously
(Roberts et al., 1998). Briefly, BHK-21 cells (35 mm dishes) were infected
with vTF7-3 (Fuerst et al., 1986) and transfected with 2 µg of the
dicistronic reporter plasmids of the form pGEM-CAT\IRES\LUC
(Roberts et al., 1998) alone or together with 0n5 µg of the test plasmids
using lipofectin (8 µg ; Life Technologies). Luciferase (LUC) activity in the
samples was detected using a luciferase assay kit (Promega) and a
luminometer. When required, the FMDV Lb proteinase was expressed
from plasmid pLb (Medina et al., 1993).
Cell extracts were analysed by SDS–PAGE and immunoblotting.
Specific proteins were recognized using the following antibodies : sheep
anti-eIF4GI (C terminus) (Li et al., 2001), rabbit anti-CAT (5prime-3prime
Inc.) and goat anti-LUC (Promega). Detection on X-ray film was achieved
using the appropriate peroxidase-labelled anti-species antibodies (Amersham Pharmacia Biotech) and chemiluminescence reagents.
Results
Infection with ERAV leads to a reduction in host cell
protein synthesis
Infection of cells with FMDV results in the rapid inhibition
of host cell protein synthesis (Belsham et al., 2000 ; Chinsangaram et al., 1999). To investigate if this is also the case with
ERAV, Vero cells were infected at a high m.o.i. (20 TCID per
&!
cell) and pulse-labelled with [$&S]methionine at various times
p.i. The percentage reduction in protein synthesis was
calculated by quantification of the radioactivity in the 36–
200 kDa range for each time-point and compared with that in
the 1 h lane. From this analysis, it was evident that by 7 h p.i.
with ERAV, host cell protein synthesis had reduced to almost
half the level seen at the 1 h time-point (Fig. 1). No further
decrease was observed at a later time-point. Hence, ERAV
infection resulted in a pronounced inhibition of host protein
synthesis in these cells, although this inhibition appeared to be
less rapid than that observed in FMDV-infected cells, in which
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 29 Apr 2017 22:36:45
DBBD
T. M. Hinton and others
Fig. 1. ERAV infection of Vero cells results in a rapid reduction in host
protein synthesis. Cells were pulse-labelled with [35S]methionine at 1, 4, 7
and 10 h p.i., lysed and samples were resolved on a 12 % SDS–PAGE gel,
which was subjected to fluorography. Samples from infected cells labelled
overnight (O/N) and mock-infected cells were also analysed. The
percentage reduction in host protein synthesis was determined by
quantification of the radioactivity in the 36–200 kDa range of each lane
(dashed boxes) by phosphoimager analysis. Most strongly labelled viral
proteins were below 36 kDa (arrows).
complete shutdown is observed within 4 h (Belsham et al.,
2000). Complete shutdown of host protein synthesis during
ERAV infection was not observed. Viral proteins (indicated by
arrows in Fig. 1) were first observed at 7 h with a substantial
increase in viral protein synthesis seen by 10 h. Cytopathic
effect was also observed for ERAV at 7 h p.i. with complete cell
death evident by 24 h. No inhibition of host protein synthesis
was seen in RK-13 cells infected with ERBV (data not shown),
although an inability to culture this virus to a sufficiently high
titre made interpretation of this result difficult.
The rapid reduction in host protein synthesis seen with
ERAV is consistent with eIF4GI processing, as has been
reported to occur in ERAV-infected cells (Wutz et al., 1996). In
FMDV-infected cells, the initial cleavage of eIF4GI is mediated
by the L proteinase. As indicated above, the L proteins of
ERAV and ERBV show low amino acid identity to the FMDV
L proteinase (Fig. 2).
Autocatalytic cleavage by ERAV and ERBV L proteins
To investigate the role of the L proteins from ERAV and
ERBV in the life cycle of these viruses, the properties of the
distinct L proteins were analysed. One function of the two
forms of the FMDV L proteinase (Lab and Lb) is to process the
polyprotein at a site between the C terminus of L and the N
DBBE
terminus of VP4 (Medina et al., 1993). We aimed to test
whether ERAV and ERBV L proteins functioned similarly. To
address this, several plasmids were constructed (Fig. 3), which
were designed to express the full-length leader protein from
these viruses fused to different lengths of polyprotein in the
context that occurs naturally in the viral genome. The plasmid
pEA\L-VP1 contained the sequence from AUG2, the major
initiating codon of ERAV (Hinton et al., 2000), to the fifth
encoded protein, VP1 (Fig. 3A). A downstream AUG can also
be utilized in ERAV such that, as with FMDV, two forms of the
L protein can be synthesized. pEA\L-VP4 contained the ERAV
sequence from AUG2 into the second protein, VP4. A third
plasmid, pEA\L, was constructed, which contained only the
predicted full-length ERAV Lab sequence. These ERAV
plasmids did not contain the ERAV IRES. ERBV plasmids for
this analysis included pEB\L-VP1, which contained the viral
sequence from the poly(C) tract to VP1 and hence contained
the ERBV IRES (Fig. 3B). pEB\L-VP4 contained the ERBV
sequence from the major initiation codon (AUG2) into VP4
(Hinton & Crabb, 2001).
RNA transcribed from these plasmids was used to programme rabbit reticulocyte lysates in the presence of [$&S]methionine. Proteins were separated by SDS–PAGE and subjected
to fluorography. ERAV L proteins synthesized from pEA\LVP1 and pEA\L-VP4 demonstrated in cis self-cleavage activity
as evidenced by their co-migration with the full-length ERAV
Lab synthesized from pEA\L (Fig. 3C). The VP4-VP1 cleavage
product of the expected size was also observed in the pEA\LVP1 lane. No unprocessed products were observed in any
ERAV lane, indicating that the ERAV L protein functions
efficiently in C-terminal processing. The 20 kDa species
observed probably represented a non-specific degradation
rather than Lb, since when the Lb initiation codon in pEA\LVP4 was modified to AUA it was still produced (data not
shown). This species may represent a unique cleavage product
of the ERAV L protein.
Using the same approach, ERBV L demonstrated partial
self-processing ability, as bands visible at the expected
molecular mass for active ERBV L were observed from both
pEB\L-VP1 and pEB\L-VP4 plasmids (Fig. 3D). A cleavage
product corresponding to the VP4-VP1 species was also
observed in the pEB\L-VP1 lane. In contrast to ERAV,
unprocessed products corresponding to the L-VP1 and L-VP4
species were visible in the respective lanes, indicating that
whilst ERBV L functions in an in cis C-terminal cleavage event,
it is less efficient than ERAV L in this system.
FMDV L proteins have also been shown to process the viral
polyprotein between L and VP4 in trans (Medina et al., 1993).
To determine whether the ERAV and ERBV L proteins were
similarly active, plasmids designed to express inactive L-VP4
substrate polypeptides were constructed. pEA\∆L-VP4 contained the C-terminal half of ERAV L (which does not encode
the predicted catalytic residues) fused to VP4 (Fig. 3A).
pEB\∆L-VP2 contained the C-terminal end of ERBV L fused to
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 29 Apr 2017 22:36:45
Aphthovirus L and 3C proteinase activity
Fig. 2. Alignment of the L proteinase amino acid sequences from FMDV (O1K), ERAV and ERBV. Identical residues are shaded
and key catalytic site residues are indicated (stars). The predicted folding of the FMDV L protein is shown above the sequence
(adapted from Skern et al., 1998 ; Guarne! et al., 1998). The methionine residues found at the N terminus of the various Lab
and Lb forms of L proteinase are underlined and italicized.
downstream viral sequences up to the third viral protein, VP2
(Fig. 3B). RNA transcripts from these plasmids were used to
programme RRLs, either individually or together with transcripts from pEA\L-VP4 or pEB\L-VP4, which encoded active
L proteinases. When the inactive L protein transcripts were
analysed in the absence of L proteinase expression, bands
representing full-length unprocessed substrates were observed
at 18 kDa for ERAV or 43 kDa for ERBV (indicated by the
asterisks in Fig. 4). ERAV L was able to process the ERAV
substrate in trans as the 18 kDa uncleaved product was absent
when these proteins were co-expressed (Fig. 4, lane 3). The
cleavage products, expected to migrate at 8n1 and 7n8 kDa,
were too small to be detected on this gel. ERBV L proteinase
synthesized from pEB\L-VP4 also demonstrated an ability to
cleave homologous substrate in trans with the 43 kDa ERBV
substrate processed to the expected 35 kDa product (Fig. 4,
band 4). ERBV substrate was not completely processed by
ERBV L, consistent with the partial activity seen in cis. An
unexpected band of 13 kDa (Fig. 4, band 3) was also visible and
probably represented a non-specific cleavage product.
To determine whether ERAV and ERBV L proteinases were
capable of processing heterologous substrates, plasmids expressing the active L proteinases from pEA\L-VP4 and pEB\LVP4 were analysed using in vitro transcription–translation
reactions in the presence of the vectors pEB\∆L-VP2 and
pEA\ ∆L-VP4, respectively. ERAV L proteinase was able to
process the ERBV substrate ; however, this occurred at a
different position to that targeted by ERBV L (Fig. 4, bands 1
and 2), indicating different cleavage specificities between the
two virus L proteins. The ERBV L proteinase did not appear to
process the ERAV substrate efficiently (Fig. 4, lane 8).
ERAV L proteinase inhibits cap-dependent translation
FMDV L proteinase activity inhibits host cell protein
synthesis by specific shutdown of cap-dependent translation
initiation (Devaney et al., 1988 ; Medina et al., 1993). To
determine whether ERAV and ERBV L proteinases function
similarly, these proteinases were expressed in the presence of
dicistronic RNAs synthesized from pCAT\EA\GFP and
pCAT\EB\GFP, respectively. From these RNAs, translation of
the CAT sequence is cap-dependent while translation of the
GFP sequence is directed by the IRES elements from ERAV and
ERBV, respectively (Hinton & Crabb, 2001 ; Hinton et al.,
2000). When transfected into vTF7-3-infected BHK-21 cells,
both plasmids induced strong CAT and GFP expression (data
not shown). Co-transfection of the pCAT\EA\GFP with the
ERAV L proteinase plasmid pEA\L-VP4 resulted in a dramatic
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 29 Apr 2017 22:36:45
DBBF
T. M. Hinton and others
Fig. 3. ERAV and ERBV L proteins have in cis proteinase activity, which processes the L/VP4 junction. The structures of the
ERAV (A) and ERBV (B) L protein expression plasmids are shown. All plasmids contained the T7 RNA polymerase promoter
(T7) and terminator (T7 term) as indicated. Amino acid numbers indicated above the diagrams begin from the first utilized AUG
in the ERAV and ERBV genomes (Hinton & Crabb, 2001 ; Hinton et al., 2000). Predicted molecular masses (in kDa) of the
various proteins expected to be synthesized from these plasmids are indicated. Bold arrows indicate the predicted L protein
cleavage site between L and VP4. Note that pEB/L-VP1 contains the ERBV IRES. ERAV (C) and ERBV (D) L protein plasmids
were analysed in coupled in vitro transcription–translation reactions in the presence of [35S]methionine. Samples were analysed
by SDS–PAGE and autoradiography. Cleavage products are labelled to the right of each panel.
decrease in CAT activity and hence a 10–40-fold increase in
the GFP : CAT ratio in two independent assays (Fig. 5A). A
minor increase in GFP expression was observed ; however,
compared with the decrease observed in CAT expression, this
was insignificant to the resultant ratio. This is consistent with
the specific inhibition of cap-dependent translation. A similar
result was also observed when these experiments were
performed in Vero cells, a cell line permissible for ERAV
infection (Fig. 5A).
In contrast, the ERBV L proteinase expressed from pEB\LVP4 produced only a small decrease in CAT activity
synthesized from pCAT\EB\GFP. This resulted in a 0n5–3fold increase in the GFP : CAT ratio indicating that ERBV L was
unable to substantially inhibit cap-dependent translation
initiation (Fig. 5B). Transfection of these ERBV plasmids into
an ERBV-permissive cell line, RK-13, produced similar results
(Fig. 5B).
DBBG
ERAV L protein activation of poliovirus and coxsackie
B4 virus IRESs
FMDV L and the 2A proteinase of enteroviruses have the
ability to stimulate poliovirus and coxsackie virus IRES activity
(Roberts et al., 1998). To examine if this property is shared by
ERAV and ERBV L proteinases, the relevant expression
plasmids were co-transfected into BHK-21 cells together with
pGEM-CAT\IRES\LUC bicistronic vectors described previously (Roberts et al., 1998). These plasmids express mRNAs
with CAT requiring cap-dependent translation initiation and
luciferase (LUC) driven by either the PV (pGEM-CAT\P25h\
LUC), CBV4 (pGEM-CAT\CB4\LUC) or FMDV IRES
(pGEM-CAT\FMD\LUC). Co-transfection of plasmids expressing FMDV L (pLb ; Medina et al., 1993) and PV 2A
(pA ∆802 ; (Kaminski et al., 1990) were also performed as
controls. Cell lysates were assayed for CAT and LUC
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 29 Apr 2017 22:36:45
Aphthovirus L and 3C proteinase activity
Fig. 4. In trans cleavage of L/VP4 substrates by ERAV and ERBV L
proteinases. L proteinase expression plasmids (pEA/L-VP4 and pEB/LVP4) were analysed by in vitro transcription–translation either alone or
together with the substrate plasmids pEA/∆L-VP4 and pEB/∆L-VP2 in the
presence of [35S]methionine. When a plasmid was to be assayed alone, an
equal amount of parental vector pET-28a was added. Samples were
analysed on SDS–PAGE and autoradiography. Asterisks indicate the band
corresponding to the full-length substrates. Various cleavage products
referred to in the text are numbered.
expression by Western blot (Fig. 6A, B) and for LUC expression
activity (Fig. 6C). Expression of the ERAV L protein from both
pEA\L-VP4 and pEA\L enhanced PV IRES expression twofold
and CBV4 IRES activity fourfold, similar to FMDV L. In
contrast, ERBV L was unable to enhance the activity of either
the PV or CBV4 IRES. Neither ERAV L nor ERBV L proteinases
stimulated FMDV IRES activity in BHK-21 cells, as observed
here and previously with the FMDV L proteinase. This
approach also provided further evidence for the ability of
ERAV but not ERBV L to inhibit cap-dependent translation
initiation with a reduction in CAT expression seen in the
presence of ERAV L, FMDV L and PV 2A but not ERBV L (Fig.
6A, B).
ERAV L proteinase processing of eIF4GI
The inhibition of host cell protein synthesis observed in
FMDV-infected cells is linked to the processing of eIF4G. As
ERAV inhibits cap-dependent translation initiation similarly to
FMDV, we aimed to determine whether ERAV L was able to
process eIF4G in a similar way. pEA\L-VP4 and pEA\L, which
express the active ERAV L proteinase, were transfected into
vTF7-3-infected BHK-21 cells. This was also performed for the
ERBV L plasmid, pEB\L-VP4. FMDV L protein expressed from
pLb as described previously (Medina et al., 1993) was also
transfected as a control. Proteins were extracted at 20 h posttransfection, separated by SDS–PAGE and subjected to
Western blotting with anti-eIF4GI antibody. From this analysis, it was apparent that expression of ERAV L produced a Cterminal cleavage product of eIF4GI very similar to that
induced by FMDV Lb, indicating that these two proteins
Fig. 5. Specific inhibition of cap-dependent translation initiation by ERAV
and ERBV L proteinases. vTF7-3-infected BHK-21 cells were cotransfected with ERAV L proteinase and ERAV bicistronic plasmids (A) or
ERBV L proteinase and ERBV bicistronic plasmids (B). Parental pET-28a
plasmid was used as a control. Each experiment was performed in two
different cell types as indicated below the panels and on two different
days (Assays 1 and 2).
induced cleavage at an adjacent or identical place (Fig. 7A). As
indicated above, this is consistent with reported cleavage of
eIF4GI in ERAV-infected cells. In contrast, ERBV L was unable
to induce cleavage of eIF4GI consistent with its inability to
efficiently inhibit cap-dependent translation.
ERAV 3C processing of eIF4GI
A unique feature of the FMDV 3C proteinase is its ability
to process both eIF4G and eIF4A (Belsham et al., 2000). To
determine whether ERAV 3C shares this function, a plasmid
expressing ERAV 3C fused to a C-terminal c-myc tag was
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 29 Apr 2017 22:36:45
DBBH
T. M. Hinton and others
Fig. 6. Activation of PV and CBV4 IRESs
by ERAV but not ERBV L proteinases.
(A) Cells were co-transfected with plasmids
expressing either the ERAV L, ERBV L,
FMDV L or poliovirus 2A protein together
with the bicistronic construct pGEMCAT/P25h/LUC, which expresses CAT by
a cap-dependent mechanism and LUC by
PV IRES-directed translation initiation. Cell
extracts were separated by SDS–PAGE,
transferred to a membrane and probed
with anti-CAT or anti-LUC antibodies as
indicated to the left. (B) As in (A) except
that the bicistronic plasmid used to cotransfect cells (pGEM-CAT/CB4/LUC)
possessed the coxackie B4 virus IRES.
(C) Quantification of IRES activation by the
ERAV L, ERBV L, FMDV L and poliovirus
2A proteinases. Results are the mean
(jSD) of at least three separate
experiments.
constructed (pEA\3C) and transfected. Previously described
plasmids pGEM3Z\JI∆ expressing an unrelated, inactive cmyc-tagged protein (Sakoda et al., 2001), pSKRH3C expressing
FMDV 3C (Belsham et al., 2000) and pLb were transfected as
controls. Cell lysates were prepared at 20 h and proteins were
separated on SDS–PAGE, transferred to PVDF membrane and
probed with either anti-eIF4GI C terminus antibody or anti cmyc tag antibody. ERAV 3C expression was shown to result in
eIF4GI cleavage and to yield a product that co-migrated with
that generated by the expression of FMDV 3C. The C-terminal
cleavage product of eIF4GI generated by the 3C proteinases
migrated slightly faster than that induced by the L proteinases
(Fig. 7B). However, ERAV 3C, at least in this myc-tagged form,
appeared significantly less active than FMDV 3C. ERAV 3C
was shown to be expressed from pEA\3C via detection of the
c-myc epitope (Fig. 7C). No eIF4A processing by ERAV 3C
synthesized from this plasmid was observed (data not shown).
Discussion
In this study we have demonstrated that ERAV L is a
proteinase that shares two distinct activities with FMDV L : Cterminal processing, which liberates L from the rest of the
DBBI
polyprotein, and the induction of site-specific cleavage of
eIF4GI. Expression of ERAV L effectively inhibits capdependent translation initiation (presumably as a result of
eIF4GI cleavage) and also stimulates the activity of enterovirus
(type I) but not aphthovirus (type II) IRES elements. These two
properties are also shared with the unrelated enterovirus 2A
proteinases (Roberts et al., 1998). It has been argued that these
functions reflect two distinct proteolytic activities (Roberts et
al., 1998 ; see Belsham & Jackson, 2000, for full discussion). The
conservation of L proteinase function across these distantly
related aphthoviruses is consistent with their predicted structural similarity (Guarne! et al., 1998, 2000) and indicates the
likelihood of a similar role for these enzymes in the pathogenesis of ERAV and FMDV infections.
So what is the biological role of the aphthovirus L
proteinases? A mutant FMDV lacking the L proteinase is still
viable, so FMDV L activity is not essential for virus replication
(Piccone et al., 1995a). This implies that L proteinase-mediated
shutdown of cap-dependent translation is not necessary for
translation of the viral polyprotein, although it probably
promotes it. However, the ‘ leaderless ’ FMDV mutant does
exhibit a reduced plaque size phenotype in vitro and displays
reduced pathogenicity when introduced into cattle and swine
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 29 Apr 2017 22:36:45
Aphthovirus L and 3C proteinase activity
Fig. 7. Cleavage of eIF4GI by ERAV L and ERAV 3C proteinases. (A) Leader protein plasmids for ERAV and ERBV were
transfected into vTF7-3-infected BHK-21 cells. Cell extracts were separated by SDS–PAGE, transferred to a PVDF membrane
and probed with anti-eIF4GI antibody. FMDV L protein synthesized from the plasmid pLb was used as a positive control. The
positions of the unprocessed (eIF4GI) and processed (CPC) eIF4GI fragments are indicated to the right. (B, C) The ERAV 3Cexpressing plasmid pEA/3C was transfected into vTF7-3-infected BHK-21 cells. Cell extracts were separated by SDS–PAGE
and proteins were transferred to a PVDF membrane and probed with either anti-eIF4GI antibody(B) or anti-c-myc antibody (C).
FMDV 3C and FMDV L proteinases expressed from pSKRH3C and pLb, respectively, were used as positive controls.
SVDV1D∆–2A∆ synthesized from pGEM3Z/JI∆ was used as a negative control for proteinase activity and as a positive control
for c-myc expression.
(Brown et al., 1996 ; Chinsangaram et al., 1998 ; Mason et al.,
1997). The proposition that the FMDV L proteinase is an
important virulence determinant is strengthened by evidence
that L proteinase-mediated eIF4G processing effectively downregulates the induction of type I interferon synthesis in
infected cells and by so doing promotes virus spread
(Chinsangaram et al., 1999, 2001). In the wake of these findings,
leaderless viruses have been proposed as live-attenuated
vaccine candidates for the control of FMD (Chinsangaram et
al., 1998 ; Mason et al., 1997). Given that ERAV L appears to
be functionally analogous to FMDV L, it is likely that an ERAV
L proteinase deletion mutant would be both viable and less
pathogenic that the wild-type virus. Such a mutant has clear
potential as a vaccine to control ERAV infections.
Interestingly, the L protein of ERBV, although a proteinase
capable of C-terminal processing (in contrast to the cardiovirus
L proteins), was unable to induce eIF4GI cleavage or to
efficiently inhibit cap-dependent translation initiation. Currently the role of the ERBV L protein is still unknown. Recent
work has shown that the L protein zinc-finger motif of the
cardiovirus Theiler’s murine encephalomyelitis virus is involved in the inhibition of IFN- α\β expression through
transcriptional regulation (van Pesch et al., 2001). As the two
unrelated L proteins from aphthoviruses and cardioviruses
result, by separate mechanisms, in the inhibition of IFN- α\β
production, this appears to be very important to the pathogenic
process of this broad group of picornaviruses. The enterovirus
2A proteinases also induce cleavage of eIF4GI (Krausslich et al.,
1987) and hence probably inhibit IFN production. Although a
zinc-finger motif similar to the cardioviruses has not been
identified in ERBV L, this protein may use another unidentified
mechanism to inhibit type I interferon production, possibly via
a distinct proteinase activity. Clearly, further investigation into
the role of the ERBV L proteinase is required to address this.
Recent studies have shown that a unique feature of the
FMDV 3C proteinase is the ability to cleave eIF4G and eIF4A
(Belsham et al., 2000). This ability has not been observed in any
other picornavirus 3C proteins, although processing of other
cellular proteins including various transcription factors has
been attributed to poliovirus 3C (Belsham et al., 2000 ; Clark et
al., 1991 ; Yalamanchili et al., 1997a, b). FMDV 3C has also
been shown to process histone H3 (Falk et al., 1990). This study
shows that the ERAV 3C protein is also able to cleave eIF4GI,
albeit inefficiently, at the same (or a very similar) site targeted
by FMDV 3C. Although this cleavage event has not been
investigated during ERAV infection, the fact that this event is
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 29 Apr 2017 22:36:45
DBBJ
T. M. Hinton and others
conserved across the distantly related aphthovirus 3C proteinases and is not observed in any other virus genus is consistent
with a biologically relevant role for this processing event.
Although ERAV has been classified as the only non-FMDV
member of the aphthovirus genus, it remains quite distantly
related. The results in this study show that although there is a
relatively low sequence identity between the virus species,
there are conserved functions such as the L and 3C proteinase
activities that are important to viral pathogenesis. This is
consistent with the shared pathogenic properties of the viruses,
including primary infection of respiratory epithelial cells and
establishment of a persistent viraemic infection. However,
there are important differences between the replication strategies adopted by ERAV and FMDV, such as initiation codon
usage and receptor binding. Features such as these are
presumably responsible for the host range and pathological
differences observed between ERAV and FMDV, including,
most particularly, the absence of vesicles in ERAV infection. It
remains a mystery as to whether the formation of vesicles is a
virus function or a host response due to the particular tissues
affected.
We thank Bernard Moss for the provision of the recombinant vaccinia
virus vTF7-3. We thank Carol Hartley, Nino Ficorilli and Michael
Studdert for the provision of viruses and for helpful advice throughout
the course of this study. T. M. H. and S. W. are the recipients of an
Australian Postgraduate Research Award and a Melbourne University
Postgraduate Scholarship, respectively, and both receive scholarship
support from the CRC for Vaccine Technology. B. S. C. is an International
Research Scholar of the Howard Hughes Medical Institute.
References
Belsham, G. J. & Jackson, R. J. (2000). Translation initiation in
picornavirus RNA. In Translational Control of Gene Expression, pp.
869–900. Edited by N. Sonenberg, J. W. B. Hershey & M. B. Mathews.
Cold Spring Harbor, NY : Cold Spring Harbor Laboratory Press.
Belsham, G. J., McInerney, G. M. & Ross-Smith, N. (2000). Foot-andmouth disease virus 3C protease induces cleavage of translation initiation
factors eIF4A and eIF4G within infected cells. Journal of Virology 74,
272–280.
involves double-stranded RNA-dependent protein kinase. Journal of
Virology 75, 5498–5503.
Clark, M. E., Hammerle, T., Wimmer, E. & Dasgupta, A. (1991).
Poliovirus proteinase 3C converts an active form of transcription factor
IIIC to an inactive form : a mechanism for inhibition of host cell
polymerase III transcription by poliovirus. EMBO Journal 10, 2941–2947.
Clarke, B. E., Sangar, D. V., Burroughs, J. N., Newton, S. E., Carroll,
A. R. & Rowlands, D. J. (1985). Two initiation sites for foot-and-mouth
disease virus polyprotein in vivo. Journal of General Virology 66,
2615–2626.
Devaney, M. A., Vakharia, V. N., Lloyd, R. E., Ehrenfeld, E. & Grubman,
M. J. (1988). Leader protein of foot-and-mouth disease virus is required
for cleavage of the p220 component of the cap-binding complex. Journal
of Virology 62, 4407–4409.
Falk, M. M., Grigera, P. R., Bergmann, I. E., Zibert, A., Multhaup, G. &
Beck, E. (1990). Foot-and-mouth disease virus protease 3C induces
specific proteolytic cleavage of host cell histone H3. Journal of Virology
64, 748–756.
Fuerst, T. R., Niles, E. G., Studier, W. & Moss, B. (1986). Eukaryotic
transient-expression system based on recombinant vaccinia virus that
synthesizes bacteriophage T7 RNA polymerase. Proceedings of the National
Academy of Sciences, USA 83, 8122–8126.
Guarne! , A., Tormo, J., Kirchweger, R., Pfistermueller, D., Fita, I. &
Skern, T. (1998). Structure of the foot-and-mouth disease virus leader
protease : a papain-like fold adapted for self-processing and eIF4G
recognition. EMBO Journal 17, 7469–7479.
Guarne! , A., Hampoelz, B., Glaser, W., Carpena, X., Tormo, J., Fita, I. &
Skern, T. (2000). Structural and biochemical features distinguish the
foot-and-mouth disease virus leader proteinase from other papain-like
enzymes. Journal of Molecular Biology 302, 1227–1240.
Hinton, T. M. & Crabb, B. S. (2001). The novel picornavirus equine
rhinitis B virus contains a strong type II internal ribosomal entry site
which functions similarly to that of encephalomyocarditis virus. Journal of
General Virology 82, 2257–2269.
Hinton, T. M., Li, F. & Crabb, B. S. (2000). Internal ribosomal entry sitemediated translation initiation in equine rhinitis A virus : similarities to
and differences from that of foot-and-mouth disease virus. Journal of
Virology 74, 11708–11716.
Kaminski, A., Howell, M. T. & Jackson, R. J. (1990). Initiation of
encephalomyocarditis virus RNA translation : the authentic initiation site
is not selected by a scanning mechanism. EMBO Journal 9, 3753–3759.
Brown, C. C., Piccone, M. E., Mason, P. W. & McKenna, T. S.-C. (1996).
Kirchweger, R., Ziegler, E., Lamphear, B. J., Waters, D., Liebig, H. D.,
Sommergruber, W., Sobrino, F., Hohenadl, C., Blaas, D., Rhoads, R. E.
& Skern, T. (1994). Foot-and-mouth disease virus leader proteinase :
Pathogenesis of wild-type and leaderless foot-and-mouth disease virus in
cattle. Journal of Virology 70, 5638–5641.
purification of the Lb form and determination of its cleavage site on eIF4 gamma. Journal of Virology 68, 5677–5684.
Carman, S., Rosendal, S., Huber, L., Gyles, C., McKee, S., Willoughby,
R. A., Dubovi, E., Thorsen, J. & Lein, D. (1997). Infectious agents in
Krausslich, H. G., Nicklin, M. J., Toyoda, H., Etchison, D. & Wimmer, E.
(1987). Poliovirus proteinase 2A induces cleavage of eucaryotic
acute respiratory disease in horses in Ontario. Journal of Veterinary
Diagnostic Investigation 9, 17–23.
Chinsangaram, J., Mason, P. W. & Grubman, M. J. (1998). Protection of
swine by live and inactivated vaccines prepared from a leader proteinasedeficient serotype A12 foot-and-mouth disease virus. Vaccine 16,
1516–1522.
Chinsangaram, J., Piccone, M. E. & Grubman, M. J. (1999). Ability of
foot-and-mouth disease virus to form plaques in cell culture is associated
with suppression of alpha\beta interferon. Journal of Virology 73,
9891–9898.
Chinsangaram, J., Koster, M. & Grubman, M. J. (2001). Inhibition of Ldeleted foot-and-mouth disease virus replication by alpha\beta interferon
DBCA
initiation factor 4F polypeptide p220. Journal of Virology 61, 2711–2718.
Li, F., Browning, G. F., Studdert, M. J. & Crabb, B. S. (1996). Equine
rhinovirus 1 is more closely related to foot-and-mouth disease virus than
to other picornaviruses. Proceedings of the National Academy of Sciences,
USA 93, 990–995.
Li, F., Drummer, H. E., Ficorilli, N., Studdert, M. J. & Crabb, B. S.
(1997). Identification of noncytopathic equine rhinovirus 1 as a cause of
acute febrile respiratory disease in horses. Journal of Clinical Microbiology
35, 937–943.
Li, W., Belsham, G. J. & Proud, C. G. (2001). Eukaryotic initiation
factors 4A (eIF4A) and 4G (eIF4G) mutually interact in a 1 : 1 ratio in vivo.
Journal of Biological Chemistry 276, 29111–29115.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 29 Apr 2017 22:36:45
Aphthovirus L and 3C proteinase activity
Mason, P. W., Piccone, M. E., McKenna, T. S., Chinsangaram, J. &
Grubman, M. J. (1997). Evaluation of a live-attenuated foot-and-mouth
disease virus as a vaccine candidate. Virology 227, 96–102.
Mayr, G. A., O’Donnell, V., Chinsangaram, J., Mason, P. W. & Grubman,
M. J. (2001). Immune responses and protection against foot-and-mouth
disease virus (FMDV) challenge in swine vaccinated with adenovirus–
FMDV constructs. Vaccine 19, 2152–2162.
Medina, M., Domingo, E., Brangwyn, J. K. & Belsham, G. J. (1993). The
two species of the foot-and-mouth disease virus leader protein, expressed
individually, exhibit the same activities. Virology 194, 355–359.
Newman, J., Rowlands, D. J. & Brown, F. (1973). A physico-chemical
sub-grouping of the mammalian picornaviruses. Journal of General Virology
18, 171–180.
Newman, J. F. E., Rowland, D. J., Brown, F., Goodridge, D., Burrows,
R. & Steck, F. (1977). Physicochemical characterization of two
serologically unrelated equine rhinovirus. Intervirology 8, 145–154.
Pestova, T. V., Shatsky, I. N. & Hellen, C. U. (1996). Functional
dissection of eukaryotic initiation factor 4F : the 4A subunit and the
central domain of the 4G subunit are sufficient to mediate internal entry
of 43S preinitiation complexes. Molecular and Cellular Biology 16,
6870–6878.
Piccone, M. E., Rieder, E., Mason, P. W. & Grubman, M. J. (1995a). The
foot-and-mouth disease virus leader proteinase gene is not required for
viral replication. Journal of Virology 69, 5376–5382.
Piccone, M. E., Sira, S., Zellner, M. & Grubman, M. J. (1995b).
Expression in Escherichia coli and purification of biologically active L
proteinase of foot-and-mouth disease virus. Virus Research 35, 263–275.
Plummer, G. (1962). An equine respiratory virus with enterovirus
properties. Nature 195, 519–520.
Pringle, C. R. (1997). Virus taxonomy 1997. Archives of Virology 142,
1727–1733.
Pringle, C. R. (1999). Virus taxonomy at the XIth International Congress
of Virology, Sydney, Australia, 1999. Archives of Virology 144,
2065–2070.
Roberts, L. O., Seamons, R. A. & Belsham, G. J. (1998). Recognition of
picornavirus internal ribosome entry sites within cells : influence of
cellular and viral proteins. RNA 4, 520–529.
Ryan, M. D. & Flint, M. (1997). Virus-encoded proteinases of the
picornavirus super-group. Journal of General Virology 78, 699–723.
Sakoda, Y., Ross-Smith, N., Inoue, T. & Belsham, G. J. (2001). An
attenuating mutation in the 2A protease of swine vesicular disease virus,
a picornavirus, regulates cap- and internal ribosome entry site-dependent
protein synthesis. Journal of Virology 75, 10643–10650.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning : a
Laboratory Manual, 2nd edn. Cold Spring Harbor, NY : Cold Spring
Harbor Laboratory.
Sangar, D. V., Newton, S. E., Rowlands, D. J. & Clarke, B. E. (1987).
All foot and mouth disease virus serotypes initiate protein synthesis at
two separate AUGs. Nucleic Acids Research 15, 3305–3315.
Skern, T., Fita, I. & Guarne! , A. (1998). A structural model of picornavirus
leader proteinases based on papain and bleomycin hydrolase. Journal of
General Virology 79, 301–307.
Steck, F., Hofer, B., Schaeren, B., Nicolet, J. & Gerber, H. (1978).
Equine rhinoviruses : new serotypes. In Proceedings of the 4th International
Conference on Equine Infectious Diseases, pp. 321–328. Edited by J. T.
Bryans & H. Gerber. Basel : Karger Veterinary Publications.
Strebel, K. & Beck, E. (1986). A second protease of foot-and-mouth
disease virus. Journal of Virology 58, 893–899.
Studdert, M. J. (1996). Equine rhinovirus infections. In Virus Infections of
Equines, pp. 213–217. Edited by M. J. Studdert. Amsterdam : Elsevier.
Studdert, M. J. & Gleeson, L. J. (1978). Isolation and characterisation of
an equine rhinovirus. Zentralblatt fuer Veterinaermedizin Reihe B 25,
225–237.
van Pesch, V., van Eyll, O. & Michiels, T. (2001). The leader protein of
Theiler’s virus inhibits immediate-early alpha\beta interferon production.
Journal of Virology 75, 7811–7817.
Warner, S., Hartley, C. A., Stevenson, R. A., Ficorilli, N., Varrasso, A.,
Studdert, M. J. & Crabb, B. S. (2001). Evidence that equine rhinitis A
virus VP1 is a target of neutralizing antibodies and participates directly
in receptor binding. Journal of Virology 75, 9274–9281.
Wutz, G., Auer, H., Nowotny, N., Grosse, B., Skern, T. & Kuechler, E.
(1996). Equine rhinovirus serotypes 1 and 2 : relationship to each other
and to aphthoviruses and cardioviruses. Journal of General Virology 77,
1719–1730.
Yalamanchili, P., Datta, U. & Dasgupta, A. (1997a). Inhibition of host
cell transcription by poliovirus : cleavage of transcription factor CREB by
poliovirus-encoded protease 3Cpro. Journal of Virology 71, 1220–1226.
Yalamanchili, P., Weidman, K. & Dasgupta, A. (1997b). Cleavage of
transcriptional activator Oct-1 by poliovirus encoded protease 3Cpro.
Virology 239, 176–185.
Ziegler, E., Borman, A. M., Kirchweger, R., Skern, T. & Kean, K. M.
(1995). Foot-and-mouth disease virus Lb proteinase can stimulate
rhinovirus and enterovirus IRES-driven translation and cleave several
proteins of cellular and viral origin. Journal of Virology 69, 3465–3474.
Received 21 March 2002 ; Accepted 15 July 2002
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 29 Apr 2017 22:36:45
DBCB