Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Candy Bar Code - WordPress.com
Document related concepts
Transcript
Candy Bar Code In this activity you will act as RNA polymerase by copying a sequence of DNA into an mRNA strand. Your desk is the nucleus. When you are done you will travel into the cytoplasm in search of a ribosome (a lab station). Code for your protein at the ribosome, then bring the completed protein to the endoplasmic reticulum (teacher’s desk) to have your protein modified into its properly folded structure. 1. Choose ONE type of “DNA” to decode. 2. At your desk (nucleus) code the DNA into mRNA. 3. Then travel to the lab station (ribosome) to decode your mRNA into a protein sequence 4. Bring your completed amino acid sequence (protein) to your teacher’s desk (E.R.) to have your protein “folded” Milk DNA TACTTTGCGGTCGGTCCCCAGGTTACT Good DNA TACGCTCCGGAAGTGCAAAGGACAATT Krackle DNA TACAGTCCTACCTATCGTGTAGGTATT Dark DNA TACTGGCTAATAGGTTATACAGCAATT Candy Bar Code In this activity you will act as RNA polymerase by copying a sequence of DNA into an mRNA strand. Your desk is the nucleus. When you are done you will travel into the cytoplasm in search of a ribosome (a lab station). Code for your protein at the ribosome, then bring the completed protein to the endoplasmic reticulum (teacher’s desk) to have your protein modified into its properly folded structure. 1. Choose ONE type of “DNA” to decode. 2. At your desk (nucleus) code the DNA into mRNA. 3. Then travel to the lab station (ribosome) to decode your mRNA into a protein sequence 4. Bring your completed amino acid sequence (protein) to your teacher’s desk (E.R.) to have your protein “folded” Milk DNA TACTTTGCGGTCGGTCCCCAGGTTACT Good DNA TACGCTCCGGAAGTGCAAAGGACAATT Krackle DNA TACAGTCCTACCTATCGTGTAGGTATT Dark DNA TACTGGCTAATAGGTTATACAGCAATT Candy Bar Code In this activity you will act as RNA polymerase by copying a sequence of DNA into an mRNA strand. Your desk is the nucleus. When you are done you will travel into the cytoplasm in search of a ribosome (a lab station). Code for your protein at the ribosome, then bring the completed protein to the endoplasmic reticulum (teacher’s desk) to have your protein modified into its properly folded structure. 1. Choose ONE type of “DNA” to decode. 2. At your desk (nucleus) code the DNA into mRNA. 3. Then travel to the lab station (ribosome) to decode your mRNA into a protein sequence 4. Bring your completed amino acid sequence (protein) to your teacher’s desk (E.R.) to have your protein “folded” Milk DNA TACTTTGCGGTCGGTCCCCAGGTTACT Good DNA TACGCTCCGGAAGTGCAAAGGACAATT Krackle DNA TACAGTCCTACCTATCGTGTAGGTATT Dark DNA TACTGGCTAATAGGTTATACAGCAATT
