Download Development of Field-Based Real-Time Reverse Transcription

Am. J. Trop. Med. Hyg., 81(4), 2009, pp. 679–684
doi:10.4269/ajtmh.2009.09-0138
Copyright © 2009 by The American Society of Tropical Medicine and Hygiene
Development of Field-Based Real-Time Reverse Transcription–Polymerase Chain Reaction
Assays for Detection of Chikungunya and O’nyong-nyong Viruses in Mosquitoes
Darci R. Smith, John S. Lee, Jordan Jahrling, David A. Kulesh, Michael J. Turell,
Jennifer L. Groebner, and Monica L. O’Guinn*
Virology Division and Diagnostic Systems Division, U.S. Army Medical Research Institute of Infectious Diseases,
Fort Detrick, Maryland
Abstract. Chikungunya (CHIK) and O’nyong-nyong (ONN) are important emerging arthropod-borne diseases.
Molecular diagnosis of these two viruses in mosquitoes has not been evaluated, and the effects of extraneous mosquito
tissue on assay performance have not been tested. Additionally, no real-time reverse transcription–polymerase chain reaction (RT-PCR) assay exists for detecting ONN virus (ONNV) RNA. We describe the development of sensitive and specific real-time RT-PCR assays for detecting CHIK and ONN viral RNA in mosquitoes, which have application for field
use. In addition, we compared three methods for primer/probe design for assay development by evaluating their sensitivity and specificity. This comparison resulted in development of virus-specific assays that could detect less than one plaqueforming unit equivalent of each of the viruses in mosquitoes. The use of these assays will aid in arthropod-borne disease
surveillance and in the control of the associated diseases.
mosquito vectors. In Africa, CHIKV is maintained through
a sylvatic transmission cycle between wild primates and Ae.
furcifer, Ae. africanus, Ae. luteocephalus, and Ae. taylori mosquitoes. In Asia, CHIKV is transmitted from human to human
primarily by Ae. aegypti and Ae. albopictus.8,9
A second re-emerging alphavirus, ONNV, was first isolated
in 1959 and has been associated with relatively few outbreaks.
However, several large-scale epidemics have occurred, including one during 1959–1962 in northern Uganda that involved
more than two million cases.10,11 In 1996, ONNV reappeared
after a 35-year hiatus and was responsible for causing another
epidemic in Uganda.12,13 The most recent outbreak of ONNV
was documented in the fall of 2003 and involved refugees from
Western Côte d’Ivoire, an area not normally associated with
ONNV transmission.14 In contrast to CHIKV, ONNV is transmitted primarily by anopheline mosquitoes such as Anopheles
gambiae and An. funestus and, as observed for Asian CHIKV,
it may be maintained in nature by human-to-human transmission by its mosquito vector.10,11,15
Currently, the diagnosis of CHIK and ONN is determined
by either virus isolation, detection of virus-specific antibodies by enzyme-linked immunosorbent assay, or by genomic
detection using reverse transcription–polymerase chain reaction (RT-PCR). Several groups have developed real-time
RT-PCR assays for the molecular diagnosis of CHIK involving human samples.16–23 However, these assays have not been
evaluated for detecting CHIKV RNA in infected mosquitoes.
Additionally, no real-time RT-PCR assay exists for detecting
ONNV RNA in human or mosquito samples.
The development of real-time RT-PCR assays for detecting viral RNA in mosquitoes requires primers and probes that
are able to specifically detect the virus of interest in the presence of potentially large amounts of mosquito nucleic acids.
Because infection rates in field-collected mosquitoes are typically very low, mosquitoes are usually pooled (often in pools
of 25 or 50 mosquitoes each) before being homogenized.
Depending on the nucleic acid extraction procedure used,
varying amounts of mosquito DNA and RNA are co-purified
with the targeted viral nucleic acids. We describe the development of real-time RT-PCR assays for detecting CHIKV and
ONNV in laboratory-infected mosquitoes. Three approaches
were used to design the real-time RT-PCR primers and probes.
INTRODUCTION
Alphaviruses (family Togaviridae) are an important cause
of disease worldwide with geographic distributions that are
divided into the Old and New World viruses. Old World alphaviruses generally cause rash, arthritis, and arthralgia in affected
humans and are distributed throughout Africa, Asia, and
Europe. New World alphaviruses may cause an acute febrile
illness and encephalitis in affected humans and are widely distributed throughout the Americas. Two important re-emerging Old World alphaviruses, Chikungunya virus (CHIKV)
and O’nyong-nyong virus (ONNV), are responsible for causing millions of recent cases of disease worldwide. CHIKV and
ONNV are members of the Semliki Forest antigenic complex
and contain a linear, positive-sense, single-stranded RNA
genome that is approximately 11.8 kb in length.1 Four nonstructural proteins (NSP1–NSP4) are encoded at the 5′ end
of the genome, and the structural proteins are encoded at the
3′ end of the genome and are expressed from a subgenomic
26S RNA. The structural proteins consist of the viral capsid
(C), two envelope glycoproteins (E1 and E2), and two peptides (E3 and 6K).2 Three genotypes of CHIKV are known
and include the West African, Asian, and the East/Central/
South African genotypes. The Asian strains comprise a distinct
group within the southern and East African/Asian genotype.
Currently, only one genotype of ONNV is known.3
In recent years, CHIK has dramatically re-emerged as a disease affecting millions of persons throughout the countries
surrounding the southwest Indian Ocean.4 The virus was first
isolated in 1953 from a febrile human during an outbreak in
Tanganyika (now Tanzania)5 and has since been isolated frequently in both Africa and Southeast Asia.6 Previous large
outbreaks of CHIKV have included Thailand in 19584 and
India in 1963–1964.7 After a 30-year gap, the virus re-emerged
in the French islands of La Reunion, Mayotte, Mauritius, and
Seychelles, which are all located in the Indian Ocean. The normal transmission of CHIKV to humans involves Aedes sp.
* Address correspondence to Monica L. O’Guinn, Virology Division,
U.S. Army Medical Research Institute of Infectious Diseases, Fort
Detrick, MD 21702. E-mail: [email protected]
679
680
SMITH AND OTHERS
These approaches were manual design, use of AlleleID software (Premier Biosoft International, Palo Alto, CA), and the
use of the Applied Biosystems (ABI) (Foster City, CA) custom
gene expression assay service. After optimizing the real-time
RT-PCR assay conditions for each design approach, we evaluated the assays for ease of development (i.e., primer/probe
design and optimization), sensitivity, and specificity. Because
these assays were designed to detect viral RNA isolated from
mosquitoes collected in the field, adding extraneous mosquito
tissue was analyzed for its effects, if any, on the performance
of the assays.
MATERIALS AND METHODS
Viruses. CHIKV and ONNV were propagated in baby
hamster kidney cells, and cell culture supernatants were
harvested, distributed to vials, and stored at −70°C for later
use. Viral titers were determined by standard plaque assays
using Vero cells and were 8.4 and 7.2 log10 plaque-forming
units (PFU)/mL for CHIKV and ONNV, respectively. Sindbis
virus (SINV) (titer = 7.7 log10 PFU/mL), Semliki Forest virus
(SFV) (titer = 9.7 log10 PFU/mL), Mayaro virus (MAYV)
(titer = 9.7 log10 PFU/mL), Una virus (UNAV) (titer = 7.5 log10
PFU/mL), Ockelbo virus (OCKV) (titer = 8.4 log10 PFU/mL),
Aura virus (AURAV) (titer = 7.4 log10 PFU/mL), Ross
River virus (RRV) (titer = 6.2 log10 PFU/mL), Ndumu virus
(NDUV) (titer = 7.2 log10), Venezuelan equine encephalitis
virus (VEEV) (Trinidad donkey; titer = 9.7 log10 PFU/mL),
and eastern equine encephalitis virus (EEEV) (FL-91-4697;
titer = 9.3 log10 PFU/mL) were used to evaluate the specificity
of the real-time RT-PCR assays.
Primer and probe design. CHIKV primers and probes were
designed using the consensus sequence created by comparing
the S-27 African prototype strain (GenBank accession no.
NC_004162) and a strain isolated from the Indian Ocean islands
(GenBank accession no. DQ443544). The ONNV primers
and probes were designed by using Gulu strain sequences
(GenBank accession nos. M20303 and NC_001512).
Three different approaches were used to design the real-time
RT-PCR primers and probes for detecting CHIKV, ONNV, or
both CHIKV and ONNV RNA in mosquito samples. The first
approach involved designing the primers and probes without
the aid of specific primer/probe design software (i.e., manual design). This approach used the alignment of genomic
sequences followed by the selection of primers with the proper
characteristics.24 The second approach used the primer/probe
design software AlleleID version 5. In addition to the individual CHIKV and ONNV assays, a dual CHIKV/ONNV assay
was designed using this software. The third approach took
advantage of the ABI custom gene expression assay service.
This approach required the submission of a target sequence to
ABI, who then returned a custom-designed gene expression
assay that included optimal primers and probes in one tube.
The sequences of the different primers and probes determined
by the three different approaches are shown in Table 1. The
Basic Local Alignment Search Tool (BLASTn)25 was used for
a preliminary assessment of oligonucleotide specificity.
Mosquito infection. Aedes aegypti (Rockefeller strain)
mosquitoes were reared in an insectary at 27°C and a relative
humidity of 80% using a light:dark cycle of 16:8 hours. Adult
female mosquitoes were infected intrathoracically 6–8 days
after emergence with 0.3 μL of viral suspension containing
Table 1
Real-time RT-PCR primers and probes for detecting CHIKV and ONNV*
Specificity
Manual
CHIK
Identification
CHIK 1F
CHIK 1R
CHIK 1P
ONN
ONN 1F
ONN 1R
ONN 1P
AlleleID Software
CHIK
CHIK 2F
CHIK 2R
CHIK 2P
ONN
ONN 2F
ONN 2R
ONN 2P
CHIK/ONN CHIK 3F
CHIK 3R
ONN 3F
ONN 3R
CHIK/ONNP
ABI Custom Assay
CHIK
CHIK 4F
CHIK 4R
CHIK 4P
ONN
ONN 4F
ONN 4R
ONN 4P
Sequence (5′→3′)
Sensitivity (PFUe)
Genome position
Size (bp)
CAGTGATCCCGAACACGGTG
CCACATAAATGGGTAGACGCC
6FAM-CCGTCATCCCGTCTCCGTACGTGAA-MGBNFQ
CAGTGATCCCGAACACGGTG
CCACATAAATGGGTAGACGCC
6FAM-CAATCACACCGTCCCCGTACGTAAA-MGBNFQ
28
E1 (10011–10264)†
253
1.8
E1 (10108–10361)‡
259
TTTGTGATCAAATGACCGGCATC
TCAGCCCCACCAACAGCTTC
6FAM-TTGCTACAGAAGTCAC-MGBNFQ
GGTATGCTGTAACTCATCATGCC
AGTACACACGGAGAATGATACCC
6FAM-AGTCGACAGATACAGTAG-MGBNFQ
ACACACGTAGCCTACCAGTTTC
GCTGTCAGCGTCTATGTCCAC
GATACACACACGCAGCTTACG
TACATACACTGAATCCATGATGGG
6FAM-TACTGCTCTACTCTG-MGBNFQ
0.3
nsP1 (1089–1163)†
74
0.02
nsP1 (984–1075)‡
91
0.3 (CHIKV)
1.8 (ONNV)
5′NTR (14–112)†
98
5′NTR (11–97)‡
80
CCGAAAGGAAACTTCAAAGCAACT
CAGATGCCCGCCATTATTGATG
6FAM-GGGAGGTGGAGCATG-NFQ
ACCCTGTTGGCACTGATAGC
TCGCCACAAAGTACGACCTT
6FAM-GGTTAGACCGCGTCAG-NFQ
0.3
nsP2 (3000–3070)†
70
0.2
nsP2 (2465–2523)‡
58
* RT-PCR = reverse transcription–polymerase chain reaction; CHIKV = chikungunya virus; ONNV = O’nyong-nyong virus; PFU = plaque-forming unit equivalent; bp = basepairs; E = envelope;
nsP = nonstructural protein; NTR = nontranslated region.
† Based on NC_004162.
‡ Based on NC_001512.
FIELD-BASED REAL-TIME RT-PCR ASSAYS FOR CHIKV AND ONNV
5.5 and 6.4 log10 PFU/mL (2.0 and 2.9 log10 PFU/mosquito) of
CHIKV and ONNV, respectively, and incubated at 27°C with
apple slices provided as a carbohydrate source.
Mosquitoes were killed in triplicate and a single, positive
mosquito body was homogenized with 0, 4, 14, or 24 negative
mosquitoes on days 0, 2, 4, and 7 after inoculation. In addition,
two legs from each of the above virus-inoculated mosquitoes
were added to specimens of uninfected mosquitoes to create
pools containing 0, 4, 14, or 24 negative mosquitoes on days 2,
4, and 7 after inoculation. Mosquito samples were triturated
in 2 mL of diluent (Medium 199 with Earle’s salts containing
10% heat-inactivated fetal bovine serum, 5 μg of amphotericin B, 50 μg of gentamicin, 100 units of penicillin, 100 μg of
streptomycin/mL, and 0.075% NaHCO3), split into two 1-mL
aliquots, and then stored at −70°C until used. A plaque assay
was conducted with the mosquito homogenates and used to
measure the virus present in a subset of the samples.
Extraction of RNA. Mosquito samples were thawed and
clarified by centrifugation (12,000 × g for 10 minutes at 4°C),
and then total RNA was extracted and purified using
a QIAamp viral RNA mini-kit (Qiagen, Valencia, CA)
according to manufacturer’s instructions. Viral RNA from cell
culture–derived virus was also extracted and purified using the
QIAamp viral RNA mini-kit. RNA was eluted from the kit
columns in 60 μL of nuclease-free water and stored at −70°C
until used.
Real-time RT-PCR assay. One-step RT-PCRs were performed using the SuperScript III one-step RT-PCR system with
platinum taq (Invitrogen, Carlsbad, CA) in a final volume of 20
μL containing 5 μL of RNA, 10 μL of 2× reaction mixture, an
additional 3 mM MgSO4, 5 μg of bovine serum albumin (Roche,
Pleasanton, CA), 0.9 μM of forward and reverse primers, and
0.2 μM of probe for the manual design, and AlleleID design
assays. The above concentrations of Mg SO4 and primers were
determined to be optimal for these assays. For the ABI custom
assay, 2 μL of 20× primer/probe stock (18 μM of forward and
reverse primers and 8 μM of probe) was substituted for the
forward and reverse primers and the probe.
Real-time RT-PCR assays were carried out using the
Ruggedized Advanced Pathogen Identification Device
(RAPID) (Idaho Technology, Salt Lake City, UT) using the
following cycling conditions: reverse transcription at 50°C for
20 minutes, denaturation at 95°C for 5 minutes, 40 cycles at
95°C for 1 second (15 second for the ABI custom assay only)
and 60°C for 20 seconds (60 seconds for the ABI custom assay
only).
Statistical analysis. SAS version 9.1.3 (SAS Institute Inc.,
Cary, NC) was used to compare the mean values between
groups (virus-positive bodies or legs) using a t-test with
stepdown Bonferroni adjustment.
RESULTS
Sensitivity and specificity evaluation of real-time RT-PCR
assays. The sensitivities of the real-time RT-PCR assays for
CHIKV and ONNV were evaluated by determining the
detection threshold of each assay using 10-fold serial dilutions
of RNA extracted from viral stocks measured by plaque assay.
Assay results were then used to determine a real-time RT-PCR
cycle threshold (the time at which a sample is determined
positive by real-time RT-PCR) to PFU equivalents (PFUe),
which enables a qualitative determination of the presence
681
of infectious virus. Not surprisingly, the primers and probes
designed manually (i.e., without the aid of specific primer/
probe design computer software) proved to be the least
sensitive of the three assays with a sensitivity of 28 PFUe for
CHIKV RNA and 1.8 PFUe for ONNV RNA. Primers and
probes designed using the AlleleID software program yielded
sensitivities of 0.3 PFUe for the individual CHIKV assay
and the dual CHIKV/ONNV assay. Similarly, these primers
and probes were able to detect 0.02 PFUe for the individual
ONNV assay and 1.8 PFUe for the dual CHIKV/ONNV assay.
The ABI custom assay service produced primers and probes
with similar sensitivities as those designed using the AlleleID
software program, and resulted in primers and probes with a
sensitivity of 0.3 PFUe for CHIKV RNA and 0.02 PFUe for
ONNV RNA (Table 1). The intra-assay variation was < 5%
and 7% for the CHIKV and ONNV assays, respectively, and
the inter-assay variation was 2% and 6% for the CHIKV and
ONNV assays, respectively.
The AlleleID software program and the ABI Custom assay
service yielded primers and probes with similar sensitivities.
We chose to further characterize the primers and probes
designed from the ABI custom assay service because of the
ease of development (i.e., required minimal assay optimization). The specificity of the ABI custom assay designed primers and probes was evaluated against other alphaviruses and
included SINV, SFV, MAYV, UNAV, OCKV, AURAV, RRV,
NDUV, VEEV, and EEEV. The CHIKV or ONNV primers and probes did not cross-react with any of these other
alphaviruses in real-time RT-PCRs that contained a minimum of 3 log10 PFU of heterologous viral RNA. CHIKV and
ONNV are the most closely related alphaviruses (Table 2
shows the sequence alignment of the primers and probes),
and the CHIKV real-time RT-PCR assay did not detect
ONNV RNA and vice versa. Additionally, the CHIKV assay
was tested in a field setting in Thailand. Although there were
no positive isolates identified, the assay also did not produce any false-positive results for 85 Ae. sp. mosquito pools
tested.
Detection of CHIKV RNA isolated from infected mosquitoes. The ABI custom assay service designed CHIKV
primers and probe, CHIK 4F/4R/4P, were used to evaluate
mosquitoes that were infected with CHIKV. Detection of viral
RNA from infected mosquito bodies was compared with that
observed for the legs from the same mosquitoes, and was also
compared with that detected on different days after infection
(Figure 1). This comparison was conducted to test the sensitivity of the real-time RT-PCR assay and to determine if viruspositive mosquito legs that were accidentally introduced into a
mosquito pool during pooling of the mosquitoes would result in
a virus-positive mosquito pool. As expected, the mean amount
of viral RNA detected in the legs was less than the bodies for
all pools (4.2 versus 5.2 log10 PFUe, respectively). The mean
amount of viral RNA detected in bodies and legs of infected
mosquitoes peaked on day 4 for most of the mosquitoes tested
and were 5.5 and 4.5 log10 PFUe, respectively.
We also tested if adding virus-negative mosquitoes could
interfere with detection of viral RNA isolated from an individual infected mosquito. Although the presence of larger
numbers of uninfected mosquitoes appeared to interfere with
detection of CHIKV RNA isolated from infected mosquitoes held for 2 days (5.2 log10 PFUe for an individual infected
mosquito body compared with 4.2 log10 PFUe for a pool that
682
* ONN = O’nyong-nyong; CHIK = chikungunya. Shaded and underlined nucleotides indicate differences between the virus and primer/probe sequence.
ACCCTGTTGGCACTGATAGCCATGGTTAGACCGCG TCAGAAGGTCGTACTTTGTGGCGA
ACGTT ACTTGCA TTGATCGCCTTGGTGAGACCAAGACAGAAAGTTGTACTTTGTGGTGA
ACGCTACTTGCT TTGATCGCCTTGGTGAGACCAAGGCAGAAAGTTGTACTTTGTGGTGA
NC_004162
DQ443544
CHIK
CHIK
ONN 4R
ONN 4P
ONN 4F
CCAAAAGGGGACTTTAA GGCAACAATCAAGGAGTGGGAAGCAGAACA C GCC TCC ATCATGGCAGGAATATG
M20303 and NC_001512
ONN
CHIK 4F
CHIK 4P
CHIK 4R
CCGAAAGGAAACTTCAAAGCAACTATTAAGGAGTGGGAGGTGGAGCAT G CATCAATAATGGCGGG CATCTG
GenBank accession no.
Virus
Table 2
Multiple nucleotide sequence alignment of the CHIKV and ONNV strains used for primer/probe design*
SMITH AND OTHERS
contained one infected mosquito body plus 24 uninfected
mosquitoes), no consistent affect was observed for infected
mosquitoes held for 4 and 7 days. All pairwise comparisons
between mean values resulted in no statistically significant
differences between amounts of viral RNA detected from
individual infected mosquitoes or from pools containing an
additional 24 negative mosquitoes (P > 0.05).
Detection of ONNV RNA isolated from infected mosquitoes. The amount of viral RNA detected at all time points
in the bodies and legs of ONNV-infected mosquitoes was less
overall compared with the CHIKV-infected mosquito bodies
and legs (Figure 2). The amount of ONNV RNA detected in
the bodies (infected legs were not tested) immediately after
infection was above the limit of detection for the assay (mean
titer 1.8 log10 PFUe), which is in contrast to the CHIKVinfected mosquitoes, in which no viral RNA was detected
immediately after infection. The amount of viral RNA
detected in the mosquito bodies increased steadily up to 7
days after inoculation (mean titer 4.4 log10 PFUe). The viral
RNA in the legs peaked on day 4 after inoculation (mean titer
3.0 log10 PFUe) and remained relatively constant to day 7 after
inoculation. Similar to the results with the CHIKV assay, the
addition of negative mosquitoes did not interfere with the
detection of ONNV RNA by real-time RT-PCR (P ≥ 0.07 for
all pairwise comparisons).
A subset of mosquitoes representing all cohorts was titrated
by standard plaque assay. Results of the plaque assays were
consistent with those of the real-time RT-PCR assay.
DISCUSSION
The molecular diagnosis of CHIKV has only been evaluated for human samples16–23 and no real-time RT-PCR assay
exists for detecting ONNV present in human or mosquito
Figure 1. Detection of CHIKV in infected mosquitoes using
real-time reverse transcription–polymerase chain reaction. Infected
mosquito bodies were assayed individually or in pools containing
one infected mosquito body or two infected mosquito legs and the
indicated number of uninfected whole mosquitoes. The virus-infected
(+) mosquito part (body or legs) is followed by the number of uninfected (−) mosquitoes. Three samples were tested on days 0 (bodies only), 2, 4, and 7 after infection. Error bars represent standard
deviations.
FIELD-BASED REAL-TIME RT-PCR ASSAYS FOR CHIKV AND ONNV
Figure 2. Detection of ONNV in infected mosquitoes using realtime reverse transcription–polymerase chain reaction. Infected mosquito bodies were assayed individually or in pools containing one
infected mosquito body or two infected mosquito legs and the indicated number of uninfected whole mosquitoes. The virus-infected (+)
mosquito part (body or legs) is followed by the number of uninfected (−) mosquitoes. Three samples were tested on days 0 (bodies only), 2, 4, and 7 after infection. Error bars represent standard
deviations.
samples. Because these are two important re-emerging arboviruses that can cause human disease, we developed and tested
real-time RT-PCR assays to detect the RNA of these viruses
in mosquitoes.
The development of real-time PCR assays requires primers and probes to detect a gene or nucleic acid of interest, followed by assay optimization. Many methods exist for primer
and probe design and assay optimization requires hands-on
laboratory work. This process can be time-consuming, and a
direct comparison of different primer and probe design methods has not been completed. We compared three approaches
for designing primers and probes for real-time RT-PCR assays.
The first approach involved designing primers and probes
without the aid of computer software (i.e., manual design).
This method was inexpensive, but required knowledge of what
constituted good primer and probe sequences and binding
sites. The second approach involved using a computer software program (AlleleID) specifically intended for the design
of optimal primers and probes for a targeted gene. This program has proved successful for the development of primers
and probes for other genes of interest, but requires an understanding of the computer program.26 The third approach took
advantage of a company’s (ABI custom assay service) solicitation to design the primers and probes for the customer.
Although this method was slightly more expensive in regard
to the initial cost of the primers and probe (compared with the
manual design method), it was the simplest of the three methods and did not require purchasing primer/probe design software. Because ABI provides the sequence of the primers and
probes with each order, the customer has the ability to obtain
additional primer and probe material from a potentially less
expensive supplier.
683
We directly compared the three real-time RT-PCR primer
and probe-design approaches described above using serially diluted viral RNA to determine the sensitivity of each
assay. The least sensitive assay for detecting both CHIKV and
ONNV RNA was the manually designed primer and probe
approach. The primers and probes designed using the AlleleID
computer software and the ABI custom assay service proved
to be the most sensitive. The AlleleID computer software did
add the advantage of designing a pan assay. However, we were
more interested in pursuing individual assays for CHIKV and
ONNV. We chose the ABI custom assay services as the lead
approach because of its ease of development and optimization of the primers and probes, and on the basis of the discussion presented above. As part of the ABI custom assay design
approach, ABI returns a 20× solution containing concentration optimized primers and probes. Compared with the ABI
approach, the manual and the AlleleID approach required
optimization of the primer and probe concentrations for each
real-time RT-PCR assay.
The primers and probes were designed using sequence information that represents the CHIKV and ONNV genotype(s)
with the widest geographic distribution. However, these
viruses contain a significant amount of genetic diversity
among strains. Designing degenerate primers and probes
would enable greater assay flexibility to detect multiple virus
strains, but would be more difficult to design using the methods presented above.
The amount of viral RNA detected at all time points in
ONNV-infected mosquitoes was less overall compared with
CHIKV-infected mosquitoes. This is most likely because
ONNV is primarily transmitted by anopheline mosquitoes
and not Ae. aegypti, which were used in this study. We used this
mosquito species simply as an assessment tool for these realtime RT-PCR assays and not to evaluate their vector competence for ONNV.
To complete the development of real-time RT-PCR assays
for detecting CHIKV and ONNV present in infected mosquitoes, we evaluated the potential inhibitory effects from
the addition of uninfected mosquitoes to a pool containing one infected mosquito body or two infected mosquito
legs. This approach is consistent with the testing of fieldcollected mosquitoes because they are generally pooled
(often 25 or more per pool) before testing. Adding up to
24 uninfected mosquitoes to either one positive mosquito
body or two positive legs resulted in no significant inhibition
on the detection of CHIKV or ONNV RNA present in an
infected mosquito.
It is interesting that virus from the addition of just two legs
from a virus-infected mosquito to a pool of 24 uninfected
mosquitoes was readily detected by the CHIKV and ONNV
assays. In a field setting, mosquito legs often break off during the trapping, taxonomic sorting, and pooling process and
may accidentally be included in a pool other than where that
mosquito was placed. Our results indicate that if a leg from
a CHIKV-infected or ONNV-infected mosquito were accidentally included in a pool of uninfected mosquitoes, that
that pool would then be positive for the virus, although it did
not contain an infected mosquito. Therefore, care should be
taken when interpreting field-detection data and the implication of a mosquito species as a potential vector for the fielddetected virus. Laboratory studies to confirm the sensitivity of
that species to infection and their ability to transmit the virus
684
SMITH AND OTHERS
in question need to be conducted before that species can be
implicated as a vector of the virus in question.
In conclusion, CHIK and ONN are important re-emerging arboviral diseases that are currently affecting persons
worldwide. The rapid and specific detection of CHIKV and
ONNV RNA in mosquitoes will enable healthcare and public health officials to better respond to outbreaks of these
viral diseases and to implement better control measures for
the vectors. We described the development of sensitive and
specific real-time RT-PCR assays for use on the RAPID
instrument for detection of CHIKV and ONNV in mosquitoes that can be used in a field or deployed setting. Further
testing of these assays in the field with field-collected mosquitoes in CHIKV and ONNV endemic/outbreak areas will
determine the robustness and utility of these newly developed assays.
Received March 16, 2009. Accepted for publication June 3, 2009.
Acknowledgments: We thank David Dohm for technical assistance
and Diana Fisher for statistical analysis support.
Financial support: This study was supported by the Military Infectious
Disease Research Program, Step U, project # U0176_09_RD.
Disclaimer: The mention of trade names or commercial products
does not constitute endorsement or recommendation for use by the
Department of Defense. The views of the authors do not necessarily
reflect the position of the Department of Defense or the Department
of the Army.
Authors’ addresses: Darci R. Smith, John S. Lee, Michael J. Turell,
Jennifer L. Groebner, and Monica L. O’Guinn, Virology Division,
Diagnostic Systems Division, U.S. Army Medical Research Institute
of Infectious Diseases, 1425 Porter Street, Fort Detrick, MD 21702,
E-mails: [email protected], [email protected], michael
[email protected], [email protected], and
[email protected]. Jordan Jahrling and David A. Kulesh,
Diagnostic Systems Division, U.S. Army Medical Research Institute
of Infectious Diseases, 1425 Porter Street, Fort Detrick, MD 21702,
E-mails: [email protected] and [email protected].
Reprint requests: Monica L. O’Guinn, Virology Division, U.S. Army
Medical Research Institute of Infectious Diseases, Fort Detrick, MD
21702, E-mail: [email protected].
REFERENCES
1. Griffin DE, 2001. Alphaviruses. Knipe DM, Howley PM, Griffin DE,
Lamb RA, Martin MA, Roizman B, Straus SE, eds. Field’s
Virology. New York: Lippincott, Williams and Wilkins,
917–962.
2. Strauss JH, Strauss EG, 1994. The alphaviruses: gene expression,
replication, and evolution. Microbiol Rev 58: 491–562.
3. Powers AM, Brault AC, Tesh RB, Weaver SC, 2000. Re-emergence
of Chikungunya and O’nyong-nyong viruses: evidence for distinct geographical lineages and distant evolutionary relationships. J Gen Virol 81: 471–479.
4. Sudeep AB, Parashar D, 2008. Chikungunya: an overview. J Biosci
33: 443–449.
5. Ross RW, 1956. The Newala epidemic. III. The virus: isolation,
pathogenic properties and relationship to the epidemic. J Hyg
(Lond) 54: 177–191.
6. Powers AM, Logue CH, 2007. Changing patterns of chikungunya
virus: re-emergence of a zoonotic arbovirus. J Gen Virol 88:
2363–2377.
7. Sarkar JK, Pavri KM, Chatterjee SN, Chakravarty SK, Anderson
CR, 1964. Virological and serological studies of cases of haemorrhagic fever in Calcutta. Material collected by the
Calcutta School of Tropical Medicine. Indian J Med Res 52:
684–691.
8. Jupp PG, McIntosh B, M., 1988. Chikungunya virus disease.
Monath TP, ed. The Arboviruses: Epidemiology and Ecology.
Boca Raton, FL: CRC Press, 137–157.
9. Laras K, Sukri NC, Larasati RP, Bangs MJ, Kosim R, Djauzi,
Wandra T, Master J, Kosasih H, Hartati S, Beckett C,
Sedyaningsih ER, Beecham HJ III, Corwin AL, 2005. Tracking
the re-emergence of epidemic chikungunya virus in Indonesia.
Trans R Soc Trop Med Hyg 99: 128–141.
10. Johnson BK, 1988. O’nyong-nyong virus disease. Monath TP, ed.
The Arboviruses: Epidemiology and Ecology. Boca Raton, FL:
CRC Press, 217–223.
11. Williams MC, Woodall JP, Corbet PS, Gillett JD, 1965. O’nyongnyong fever: an epidemic virus disease in east Africa. 8. Virus
isolations from Anopheles mosquitoes. Trans R Soc Trop Med
Hyg 59: 300–306.
12. Rwaguma EB, Lutwama JJ, Sempala SD, Kiwanuka N, Kamugisha
J, Okware S, Bagambisa G, Lanciotti R, Roehrig JT, Gubler DJ,
1997. Emergence of epidemic O’nyong-nyong fever in southwestern Uganda, after an absence of 35 years. Emerg Infect Dis
3: 77.
13. Lanciotti RS, Ludwig ML, Rwaguma EB, Lutwama JJ, Kram TM,
Karabatsos N, Cropp BC, Miller BR, 1998. Emergence of epidemic O’nyong-nyong fever in Uganda after a 35-year absence:
genetic characterization of the virus. Virology 252: 258–268.
14. Posey DL, O’Rourke T, Roehrig JT, Lanciotti RS, Weinberg M,
Maloney S, 2005. O’Nyong-nyong fever in west Africa. Am
J Trop Med Hyg 73: 32.
15. Williams MC, Woodall JP, 1961. O’nyong-nyong fever: an epidemic
virus disease in east Africa. II. Isolation and some properties of
the virus. Trans R Soc Trop Med Hyg 55: 135–141.
16. Pastorino B, Bessaud M, Grandadam M, Murri S, Tolou HJ,
Peyrefitte CN, 2005. Development of a TaqMan RT-PCR assay
without RNA extraction step for the detection and quantification of African Chikungunya viruses. J Virol Methods 124:
65–71.
17. Naresh M, Kumar CV, Anthony Johnson AM, Sai R, Gopal DV,
2007. Molecular characterization of chikungunya virus from
Andhra Pradesh, India and phylogenetic relationship with central African isolates. Indian J Med Res 126: 534–540.
18. Edwards CJ, Welch SR, Chamberlain J, Hewson R, Tolley H, Cane
PA, Lloyd G, 2007. Molecular diagnosis and analysis of
Chikungunya virus. J Clin Virol 39: 271–275.
19. Grivard P, Le Roux K, Laurent P, Fianu A, Perrau J, Gigan J,
Hoarau G, Grondin N, Staikowsky F, Favier F, Michault A, 2007.
Molecular and serological diagnosis of Chikungunya virus
infection. Pathol Biol (Paris) 55: 490–494.
20. Laurent P, Le Roux K, Grivard P, Bertil G, Naze F, Picard M,
Staikowsky F, Barau G, Schuffenecker I, Michault A, 2007.
Development of a sensitive real-time reverse transcriptase
PCR assay with an internal control to detect and quantify
Chikungunya virus. Clin Chem 53: 1408–1414.
21. Santhosh SR, Parida MM, Dash PK, Pateriya A, Pattnaik B,
Pradhan HK, Tripathi NK, Ambuj S, Gupta N, Saxena P,
Lakshmana Rao PV, 2007. Development and evaluation of
SYBR Green I-based one-step real-time RT-PCR assay for
detection and quantification of Chikungunya virus. J Clin Virol
39: 188–193.
22. Parida MM, Santhosh SR, Dash PK, Tripathi NK, Lakshmi V,
Mamidi N, Shrivastva A, Gupta N, Saxena P, Babu JP, Rao PV,
Morita K, 2007. Rapid and real-time detection of Chikungunya
virus by reverse transcription loop-mediated isothermal amplification assay. J Clin Microbiol 45: 351–357.
23. Carletti F, Bordi L, Chiappini R, Ippolito G, Sciarrone MR,
Capobianchi MR, Di Caro A, Castilletti C, 2007. Rapid detection and quantification of Chikungunya virus by a one-step
reverse transcription polymerase chain reaction real-time assay.
Am J Trop Med Hyg 77: 521–524.
24. Bookout AL, Cummins CL, Mangelsdorf DJ, Pesola JM, Kramer
MF, 2006. High-throughput real-time quantitative reverse transcription PCR. Current Protocols in Molecular Biology. Chapter
15: Unit 15.8. New York: John Wiley & Sons.
25. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ, 1990. Basic
local alignment search tool. J Mol Biol 215: 403–410.
26. Apte A, Singh S, 2007. AlleleID: a pathogen detection and identification system. Methods Mol Biol 402: 329–346.