Download Analysis of Eukaryotic DNA Topoisomerases and

Eur J Clin Chem Clin Biochem 1996; 34:873-888 © 1996 by Walter de Gruyter · Berlin · New York
Analysis of Eukaryotic DNA Topoisomerases and Topoisomerase-Directed
Drug Effects
Fritz Boege
Medizinische Poliklinik der Universit t W rzburg, W rzburg, Germany
Summary: DNA topoisomerases are enzymes which control DNA topology by cleaving and rejoining DNA strands
and passing other DNA strands through the transient gaps. Consequently these enzymes play a crucial role in the
regulation of the physiological function of the genome. Beyond their normal functions, topoisomerases are important
cellular targets in the treatment of human cancers. Some of the most powerful anti-cancer drugs used clinically
stabilize the catalytic topoisomerase-DNA intermediates and, thus, cause DNA disorders that will induce apoptosis
in proliferating cells. This review summarizes current protocols for measuring the catalytic activity of topoisomerases and for monitoring the molecular effects of topoisomerase-directed antitumour drugs in living cells and in cellfree assays. Furthermore, preanalytical factors are discussed, such as enzyme stability, methods for extracting DNA
topoisomerases from cells, and protocols for separating subtypes and isoforms of these enzymes.
List of Contents
1.
Introduction
2.
Preanalytical Factors
2.1
Preparative purification procedures
2.2
Partial purification for analytical purposes
2.2.1 Isolation of cell nuclei
2.2.2 Salt extraction
2.2.3 Removal of DNA
fragments
2.2.4 Protein precipitation
2.2.5 Chromatography
2.3
Stability
2.3.1 Stability of topoisomerase I
2.3.2 Stability of topoisomerase II
2.4
Separation of isoforms and epigenetic variants
2.4.1 Separation of topoisomerase I and topoisomerase II
2.4.2 Separation of topoisomerase ΙΙα and β
2.4.3 Resolving epigenetic variants of topoisomerase 1
and II
3.
3.1
3.2
Assessment of DNA Topology and DNA
Topoisomerase Activity
Catalytic assays for DNA topoisomerization
Dissecting the catalytic cycle
873
4.
874
874
874
875
875
875
875
875
875
875
876
876
4.1
4.1.1
4.1.2
4.2
876
876
5.
876
876
877
878
4.2.1
4.2.2
4.2.3
4.2.4
4.3
5.1
5.2
6.
Analysis of Topoisomerase-Directed Drug
Effects
Types of topoisomerase inhibitors
Topoisomerase poisons
Topoisomerase inhibitors
Cell-free assays for topoisomerase-directed drug
effects
Screening strategies
Drug effects on part-reactions
DNA sequence specificity
Demonstration of covalent topoisomerase-DNA
complexes
Measuring topoisomerase-directed drug effects in
intact cells
Perspectives for C l i n i c a l Oncology and
Pharmacology
Topoisomerases and drug-hunting
Clinical drug-monitoring and prediction of sensitivity to topoisomerase poisons
References
878
878
879
879
880
880
880
881
881
881
882
882
883
884
(4—6), recombination (7, 8), repair (9, 10) chromosome
(de)condensation, and sister chromatid segregation (11 —
The structure of the double helix together with the 15). Topoisomerases are characterized by their ability to
nuclear organization of the DNA into closed loop do- break and reseal the polyphosphate backbone of the
mains implies that virtually every physiological function DNA and pass other strands of DNA through the tranin the genome is modulated by topological relationships sient gaps (16—19). This ability allows them to unwind,
within the DNA (1-3). In the cell, DNA topology is unknot, untangle, and, thus, resolve complex DNA
regulated and controlled by ubiquitous enzmyes known structures (2). There are two types of DNA topoisomeras topoisomerases1), whose function is required for im- ases with different physico-chemical and catalytic propportant DNA processes such as replication, transcription erties. Type I topoisomerases are monomeric proteins
with a relative molecular mass of 100000 that function
*) Enzymes:
without the input of metabolic energy. They can alter the
Type I DNA topoisomerase, DNA untwisting enzyme (EC 3.1.-)
pitch
of DNA double helices by cutting one DNA strand
Type II DNA topoisomerase, DNA gyrase (EC 5.99.1.3)
1. Introduction
874
Boege: Analysis of DNA topoisomerases and topoisomerase-tiirected drug effects
and allowing the passage of the complementary DNA
strand through the transient nick (16). Type II topoisomerases are composed of two identical subunits with relative molecular masses of 170000 or 180000. They require ATP hydrolysis for catalytic activity and can alter
DNA topology by creating transient double strand
breaks, through which a second intact double helix is
passed (19). Eukaryotic topoisomerase II differs structurally from the bacterial type II enzyme g)>rase, which
is a tetrameric complex composed of pairs of two different subunits g)>rA and g)>rB, whereas eukaryotic topoisomerases II are homodimeric proteins composed of
identical monomers, each of which combine the functions rfgyrA and gyrB. Mammals possess two isoforms
of type II topoisomerases, α and β, which are encoded
by separate genes (20-22). Recent reports indicate that
active o/ -heterodimers of topoisomerase II may exist
in some cells at low abundancy (23). All cells contain
type I and type II topoisomerases. However, only the
type II enzymes seem to be essential for cell survival,
whereas the type I enzymes can be complemented by
the type II enzymes.
Enzymes such as topoisomerases, which generate breaks
in the DNA, carry a high risk of causing genomic disorders. Under, normal circumstances, this unfavorable
property of topoisomerases does not come into effect,
because the critical strand-passing step is only a very
short-lived catalytic intermediate. However, conditions
which significantly increase the half-lives of topoisomerase-linked DNA intermediates induce a number of
DNA disorders including mutations, insertions, deletions, and chromosomal aberrations (11), which in summary are deleterious for the cell (24, 25). A number
of powerful anti-cancer drugs that are widely used for
systemic therapy of human cancers act by stabilizing the
covalent topoisomerase-DNA intermediates (26, 27)
thereby converting topoisomerases into cell poisons (28,
29). The efficacy of these drugs is closely related to the
cellular levels and activities of topoisomerases (30-33)
and to the responsiveness of the enzymes to the drugs.
Thus, down-regulation of topoisomerases (34, 35), or
mutations (36-41) and epigenetic modifications (4246) that will produce topoisomerase-variants less susceptible to these drugs result in resistance of the tumour
to treatment. In addition, alterations of topoisomerases
can modulate the sensitivity of the cells towards cancer
drugs not targeting topoisomerases (47). Consequently,
in recent years, quantitative assessment of cellular levels
of topoisomerases and detection of the molecular effects
of topoisomerase poisons have become objectives of
increasing interest to clinical oncologists (28, 29,
48-53).
This paper reviews state of the art assays which are suitable for measuring the catalytic activity of topoisomerases and for determining the molecular effects of topo-
isomerase poisons. Furthermore, it briefly discusses
techniques of extracting and purifying topoisomerases
from various tissues or cells and of separating isoenzymes and isoforms of topoisomerases. Finally, it tries
to give a guideline for the selection of those procedures
that are most likely to be useful under routine clinical
conditions for the analysis of topoisomerases in specimens from cancer patients.
2. Preanalytical Factors
2.1 Preparative purification procedures
Topoisomerase I (at that time called protein ω) was purified from E. coll for the first time in 1971 by James D.
Wang (54). The basic preparative strategy of this first
purification, consisting of salt extraction of the cells, removal of contaminating DNA, ammonium sulphate precipitation of the enzyme, renaturing, and purification by
several steps of ion exchange, and/or affinity chromatography on DNA-like matrices, has since been conserved through all protocols published on the purification of eukaryotic topoisomerase I from HeL cells (55),
avian erythrocytes (56—58), Drosophila melanogaster
(59), Saccharomyces cerevisiae (60), calf thymus (61 —
63), and mouse mammary carcinoma FM3A cells (64).
Eukaryotic topoisomerase II has been purified from calf
thymus, Drosophila melanogaster (65, 66), various cultured tumour cell lines (66—69), and yeast Saccharomyces cerevisiae (70). Compared to topoisomerase I, purification is more difficult, because topoisomerase II
levels are at least ten times lower in the cells. Moreover,
the expression of topoisomerase II is proliferation-dependent and alters during the cell cycle (71—74), which
means that not all tissues are equally suitable sources for
the enzyme. Strategies have been established to purify
topoisomerase I and topoisomerase II simultaneously
(62).
2.2 Partial purification for analytical purposes
While preparative purification of large quantities of
homogeneous topoisomerases is a prerequisite for biochemical studies of the enzyme function, less elaborate
protocols can be used for analytical purposes aimed at
determination of cellular enzyme activity. Simplified
and miniaturized protocols for extraction and partial purification of topoisomerases from small samples of human cells have been developed (75-77), which may be
suitable for studying topoisomerases in specimens from
patients. In general, analysis of nuclear topoisomerase
activity requires that the enzyme is extracted from the
cells. In most cases it also needs to be further purified
in order to be stable and fully active. The subsequent
chapter discusses some crucial aspects of these preanalytical steps.
Boege: Analysis of DNA topoisomerases and topoisomerase-directed drug effects
875
2.2.1 Isolation of cell nuclei
2.2.4 Protein precipitation
Starting with cultured, or otherwise single cells, purification of cell nuclei (as described in some detail in 1. c.
(76)) is an essential first step. It consists of cell lysis
with non-ionic detergents, such as Triton X-100, followed by sedimentation across a single-step gradient of
30% sucrose. Care needs to be taken that the isolated
nuclei which pellet underneath the sucrose cushion become neither damaged nor contaminated by non-lysed
cells, which will sediment as well. Moreover, care
should be taken that the isolation process does not select
for nuclei of certain cell types or cell cycle stages (the
recovery of nuclei/cells should be at least 90%). Cells
from various tissues differ slightly in the amount of detergent and the time of treatment needed for an optimal
result.
Topoisomerases can be reversibly denatured and precipitated by ammonium sulphate. When carried out in the
presence of at least 0.35 mol/1 of NaCl, topoisomerases
will be precipitated in a state dissociated from the DNA,
which will stay soluble. Topoisomerase II can be completely precipitated by 2—2.5 mol/1 of ammonium sulphate, whereas topoisomerase I stays soluble for the
most part at these concentrations, making a crude separation of the two types of topoisomerases possible (49).
Topoisomerase I can be precipitated completely by 3.5
mol/1 of ammonium sulphate.
2.2.2 Salt extraction
Complete extraction of both types of topoisomerases
from isolated nuclei is usually obtained with 0.35
mol/1 of NaCl. Under these conditions, DNA-modifying enzymes will be extracted almost selectively,
whereas histones and other structural proteins of the
nuclear scaffold will remain bound to the genomic
DNA (56, 58).
2.2.5 Chromatography
In some cases a single step of chromatography may be
needed in order to stabilize topoisomerases for further
analysis. Mixed interaction chromatography on DNAlike matrices, carrying strong polyanion ligands, such as
heparin Sepharose (63, 64, 79) or phosphocellulose
(54-57, 59, 69, 78, 80), is most suitable. The enzymes
bind to these matrices at low salt concentrations (< 100
mmol/1 of NaCl or KC1, or < 50 mmol/1 of potassium
phosphate) and can be eluted by 0.5—0.6 mol/1 of NaCl
or 0.2—0.3 mol/1 of potassium phosphate.
2.3 Stability
2.2.3 Removal of DNA fragments
2.3.1 Stability of topoisomerase I
Fragments of genomic DNA are always extracted together with topoisomerases. These will bind to the enzyme when ionic strength is lowered. They can link the
enzymes to other DNA-binding proteins present in the
extract. These protein-DNA complexes may become insoluble and are also difficult to separate. Moreover, contaminating genomic DNA will act as a competitive inhibitor in catalytic assays. Therefore, DNA contaminations need to be removed. Several DNA precipitation
procedures, which do not precipitate or inactivate topoisomerases, have been established: the use of streptomycin (54), polyethylene glycol (59, 63, 78) and polyethylene imine (56, 57). It should be noted that small DNA
fragments in particular will take considerable time for
precipitation. This is most notable when using polyethylene glycol, which takes up to 12 h for complete precipitation (63). Alternatively, filtration with glassfiber filters
(Whatman GF/A) (58) or adsorption to hydroxyapatite
have been employed for removing DNA. The latter procedure has also been used in conjunction with DNA precipitation in many protocols as a means of concentrating
the extracts. Both DNA and topoisomerase will bind to
hydroxyapatite at NaCl concentrations up to 0.3 mol/1,
but topoisomerase can be eluted at 0.4—0.5 mol/1 of
postassium phosphate, whereas DNA will bind much
more tightly (62, 63).
The enzyme is subjected to rapid aminoterminal proteolysis after extraction, which once led to the belief (78)
that two forms of the enzyme exist in vivo. The major
proteolytic fragment has a relative molecular mass of
68 000. It is catalytically more active than the full length
enzyme, because it lacks regulatory domains (61). Thus,
proteolysis is a potential cause of false high results of
topoisomerase I activity. In order to avoid it, salt extraction and purification steps should be carried out rapidly,
on ice, and in the presence of effective serine- and metallo-protease inhibitors. Moreover, topoisomerase I
needs to be phosphorylated on the aminoterminal domain in order to be fully functional (43, 81-86). Usually, a strong phosphatase activity becomes coextracted.
Thus, the enzyme in vitro rapidly loses activity by dephosphorylation unless potent phosphatase inhibitors are
included. It should be noted, however, that some of the
most potent phosphatase inhibitors, such as NaF, inhibit
the enzyme activity. During extraction and measurements topoisomerase I should not be exposed to pH
higher than the pi value, which is 7.9. Most commonly,
pH is kept between 7.0 and 7.8. Like all nuclear proteins, topoisomerase I needs to be kept in the presence
of thio-reductive compounds such as ß-mercaptoethanol
or dithiotreitol, in order to prevent formation of aberrant
intramolecular cystein bonds. Partially purified topoiso-
876
Boegc: Analysis of DNA topoisomerasos and topoisomerasc^dirccted drug effects
merase I can be stored for up to 2 months at -20 °C in
aqueous glycerol, volume fraction 0.5, in the presence
of protease and phosphatase inhibitors. Alternatively, the
enzyme can be stored for up to 3 days at 4 °C in the
presence of 3 mol/1 of ammonium sulphate and then be
renatured prior to the assay. "
2.3.2 Stability of topoisomerase II
Topoisomerase II is subjected to rapid proteolysis of
regulatory domains at the carboxyterminus. The core enzyme with relative molecular mass of 120000 is more
active than the full length protein. Topoisomerase Πβ
appears to be more prone to proteolysis than topoisomerase Ι Ια and a great variation exists between tissues
and cell lines with respect to the potential for nuclear
autolysis. Topoisomerase II also needs to be phosphorylated for full activity (87-93) and becomes rapidly dephosphorylated in vitro by coextracted phosphatases.
Thus, the enzyme should be kept on ice throughout the
preanalytical stage and protease and phosphatase inhibitors must be added to the buffers. Orthovanadate can not
be used as a phosphatase inhibitor, because it inhibits
the ATPase activity of both topoisomerase II isoenzymes
(94, 95). Partially purified topoisomerase II can be
stored for up to 2 months at —20 °C in aqueous glycerol,
volume fraction 0.5, in the presence of appropriate protease and phosphatase inhibitors.
2.4 Separation of isoforms and epigenetic
variants
For most applications and questions it will be important
to differentiate between topoisomerase I and topoisomerase II, and to discriminate between the two mammalian isoenzymes of topoisomerase II or even between
epigenetic variants of these isoenzymes. Some of these
aims can be reached by using specific assays, as will be
discussed in chapter 3. In most cases, however, it will
be necessary to physically separate various forms of the
enzymes before measuring their activity by non-specific assays.
should be carried out in the presence of at least 400
mmol/1 of potassium phosphate in order to avoid adsorption of the enzyme to the matrix. Whereas topoisomerase
II will elute as a dimer with an apparent relative molecular mass of 340000-360000, topoisomerase I usually
elutes as a monomer with an apparent relative molecular
mass of 120000-150000 (67).
2.4.2 Separation of topoisomerase Ua and β
There seems to be a difference in the pH optimum of
the catalytic activity of topoisomerase Πα and β (46).
However, this observation has not been validated on a
broad basis. It can probably not be used for a clear-cut
differentiation between the two isoenzymes in all cases.
Separation of topoisomerase ΙΙα from Πβ by Chromatographie methods is difficult due to the high degree of
structural similarity between these two isoenzymes. It
has been achieved by eluting the two enzymes bound to
a MonoQ column with a shallow NaCl gradient (45, 46,
68, 95). Topoisomerase Πα will elute at slightly lower
salt concentrations than topoisomerase Πβ. But unfortunately there are variants of topoisomerase ΙΙα that will
bind more tightly to anion exchange resins and coelute
with topoisomerase Πβ (45, 46). Recently, we have obtained isoenzyme-specific peptide antibodies directed
against topoisomerase Πα or Πβ (96) which can be used
for immunoprecipitation techniques (23).
2.4.3 Resolving epigenetic variants of topoisomerases
Proteolytic fragments of topoisomerase I or II can be
removed by glycerol density gradient centrifugation or
gel filtration chromatography. There are several variants
of full-length topoisomerase Πα, which differ in pi and
catalytical properties, and which most probably represent differently phosphorylated states of the enzyme (45,
46, 97). These variants can be separated by anion exchange chromatography or, more efficiently, by chromatofocusing, using a weak anion-exchanger, such as MonoP, and mixtures of ampholytic buffer substances for
isocratic elution. Several isoactivities have been resolved by this procedure (45).
2.4.1 Separation of topoisomerase I and II
Physical separation of topoisomerase I from topoisomerase II can be obtained in three ways:
3. Assessment of DNA Topology and
DNA Topoisomerase Activity
1) Fractionated precipitation with 2 mol/1 ammonium
sulphate (topoisomerase II), followed by 3.5 mmol/1 ammonium sulphate (topoisomerase I).
Topoisomerases function by altering the topological
state of the DNA. Figure 1 summarizes different types
of topological changes of the DNA which can be catalyzed by these enzymes in principle. Topoisomerase I
cleaves and religates only one strand of the double helix
and allows passage of the complementary strand through
the transient nick, thereby altering the pitch of the DNA.
Thus, it can release positive or negative supercoils from
closed-circular DNA plasmids (54). Topoisomerase I
2) Adsorption to a strong anion-exchanger such as MonoQ at pH 8. Topoisomerase I will not bind, whereas
topoisomerase II can be eluted with 0.4 mol/1 of NaCl.
3) Gel permeation chromatography: Superdex 200 in the
separation medium giving the best results. Separation
Boege: Analysis of DNA topoisomerases and topoisomerase-directed drug effects
cannot catalyze more complex changes in DNA topology, such as catenation/decatenation or knotting/unknotting, which require the transient insertion of DNA
double strand breaks and the passage of an intact second
double helix (17), unless very high concentrations of the
enzyme are present with adjacent nicks being formed
concurrently close to each other by two independent enzyme molecules (98, 99). Under most conditions, these
more complex DNA topoisomerization reactions are reserved to topoisomerase II, which simultaneously and
coordinatedly inserts a transient break into both DNA
strands and passes another intact double helix through
the gap. Topoisomerase II also relaxes supercoiled
closed circular DNA-plasmids (100), but it does so less
avidly than topoisomerase I. Moreover, it requires ATP
for the reaction, whereas topoisomerase I acts independently of free metabolic energy (17). The techniques for
measuring topoisomerase activity were reviewed five
years ago (99). This chapter will summarize these older
techniques and give an update on more recent developments.
3.1 Catalytic assays for DNA
topoisomerization
Several naturally occuring DNA structures have been
found that are able to form more than one unique topoisomer, as can be demonstrated by biochemical methods.
These DNA structures can be multiplied in vivo and
serve as substrates for simple catalytic assays of DNA
topoisomerases. The most widely used topoisomerization assay is relaxation of supercoiled plasmid DNA. For
this purpose several plasmids have been used (54, 100),
the most common being pBR 322, which contains several strong cleavage sites for both types of topoisomerases. Plasmid relaxation can be used as a topoisomerase
Relaxation
ooccoo 0
ooooco Q
Topoisomerase I and Topoisomerase //
Decatenation
Topoisomerase 11
Fig. 1 DNA topoisomerizations catalyzed by type I and II DNA
topoisomerases.
877
I specific assay by omitting ATP from the reaction
medium, or, more safely, by adding the ATPase-poison
orthovanadate, which inhibits most forms of topoisomerase II (45, 46, 94, 95) but not topoisomerase I. The
various topoisomers of DNA plasmids formed by the
enzymes can be easily demonstrated as a „DNA-ladder"
by analysis on a 10 g/1 agarose gel (see fig. 2). Electrophoresis should be carried out in the absence of intercalators such as ethidium bromide, as these will change the
topology of the closed circular plasmids. It is likewise
important to avoid heating the gel during electrophoresis. More complicated procedures have been devised for
the analysis of plasmid topology (101, 102). However,
these can only be employed with highly purified enzyme
preparations and do not have any significant advantage
over agarose gel electrophoresis. Enzyme activity can be
titrated by measuring plasmid DNA relaxation by serial
dilutions of the enzyme preparation. One unit of enzyme
activity is usually defined as the amount of enzyme that
will completely relax 250 ng of pBR 322 DNA at 37 °C
within 30 min. Specific relaxation activity of topoisomerase I is ΙΟ 5 —10 6 units/mg protein. Specific relaxation
activity of topoisomerase II is at least one order of magnitude lower. Catenation (see fig. 2) or knotting (101 —
103) of plasmid DNA in the presence of ATP is an indication of topoisomerase II activity, because topoisomerase I cannot catalyze these reactions. However, simultaneously occuring relaxation makes interpretation of catenation or knotting in quantitative terms difficult. Naturally occuring DNA molecules of more complex
topology, commonly used for specifically measuring the
activity of topoisomerase II, are the knotted DNA of the
bacterial phage P4 (P4-DNA) (104, 105) and the catenated network DNA (k-DNA) from the kinetoplast of
Tiypanosoma species or Crithidia fasciculata (69, 106).
Both DNA substrates can be obtained commercially.
Knotted P4-DNA migrates as a broad, smeary band in
agarose gel electrophoresis. Due to topological constraints, it hardly incorporates ethidium bromide. P4-unknotting can be visualized as the appearance of two
sharp DNA bands brightly stained by ethidium bromide,
which represent relaxed and nicked forms of the P4DNA plasmid (fig. 2). P4-unknotting is the test most
suitable for titrating topoisomerase II activity if plasmid
relaxation cannot be used, because topoisomerase I is
also present. One P4-unknotting unit has been defined
as the amount of topoisomerase II that will completely
unknot 100 ng of P4-DNA in the presence of 0.5-1
mmol/1 ATP at 37 °C within 30 min (105). Specific P4unknotting activity is slightly lower than relaxation activity. Decatenation of k-DNA is also a specific assay
for topoisomerase II catalytic activity but is less sensitive than P4-unknotting. Because of its high molecular
mass, the catenated network of k-DNA is too large for
entering an agarose gel. Thus, topoisomerase II-specific
decatenation can be monitored by the release of electro-
878
Boege: Analysis of DNA topoisomeraseS and topoisomerase-directed drug effects
phonetically mobile DNA catenanes and circles from the
immobile network (fig. 3). Alternatively, k-DNA can be
pelleted by centrifugation, whereas single DNA circles
will stay in solution and, thus, can be measured fluorometrically in the supernatant (107).
kDNA
<— Catenated network
<- Free DNA, Catenanes
<- Free DNA, Circles
*v
1
CTR
Dilution of nuclear extract
P4-DNA
<~ Catenated
<- Unknotted
<- Nicked
CTR 24
816
no ATP
2
4
8
16 Dilution of Nuclear Extract
1 mmol/1 ATP
pBR 322 DNA
<- Catenated
<- Relaxed
«- Supercoiled
2 4 8 16 32 64
no ATP
2 4 8 16 32 64 Dilution of nuclear extract
1 mmol/1 ATP
Fig. 2 Catalytical assays for topoisomerases:
Crude nuclear extract of human A431 epidermoid cells was obtained by extracting 2 X 107 isolated nuclei with 0.35 mol/1 NaCl.
The extract was diluted with reaction buffer (10 mmol/1 bis-Trispropane, pH 7.9, containing 10 mmol/1 MgCl2, 100 mmol/1 KC1
and 0.1 mmol/1 dithiothreitol) as indicated. Two μΐ of diluted extract were reacted with the respective DNA substrate in the absence
or presence of 1 mmol/1 ATP in a final volume of 30 μΐ of reaction
buffer. Controls were without extract. Incubation at 37 °C for 30
min was terminated by addition of 10 g/1 sodium dodecyl sulphate.
Samples were then digested with l g/l proteinase K at 37 °C for
30 min. Gel electrophoresis was performed at 1 V/cm for 24 h in
10 g/1 agarose gels with TRIS/acetate/EDTA buffer. Following
electrophoresis, the gel was stained with 0.5 mg/1 ethidium bromide. Fluorescence of ethidium bromide in the gels (excitation 302
nm, emission > 600 nm) was documented by Polaroid photography.
a) Decatenation: 200 ng of Crilhidia fasciculata catenated network
kinetoplast DNA (kDNA) were used as a substrate.
b) Unknotting: 200 ng of knotted P3-plasmid DNA were used as
a substrate.
c) Relaxation: 250 ng of supercoiled pBR 322 plasmid DNA were
used a a substrate.
3.2 Dissecting the catalytic cycle
Topoisomerization of complex DNA substrates, such as
plasmids, is the result of repeated rounds of the complete sequence of DNA cleavage, strand passage, and
DNA religation reactions. In order to analyze these partreactions separately, oligonucleotide suicide-substrates
of topoisomerase I (108, 109) and topoisomerase II (27)
have been designed that restrict the enzyme to a single
round of cleavage and religation and allow for addressing these two half-reactions separately. The function of
these non-catalytic assays is exemplified by the oligonucleotide suicide-substrate assay of topoisomerase I: A
double-stranded 36-mer oligonucleotide containing a
strong topoisomerase I cleavage sequence (110) is composed, as shown in figure 3a. The strand to be cleaved
has a nick two base pairs 3' to the major cleavage position and is labelled with 32P at the 5'-end. All other 5'ends, including that of the nick, are blocked by phosphorylation in order to prevent religation at these sites.
The oligonucleotide is mainly cleaved in a position 2
base pairs 5' to the nick (108, 111). The dinucleotide
which is cleaved off escapes from a further religation
reaction by diffusion, and religation to the 5Vend distal
of the nick is blocked by phosphorylation. Therefore,
cleavage is irreversible and the substrate becomes quantitatively converted to a covalent complex with the enzyme (fig. 3b). For religation, a 1000-fold excess of a
3'-biotinylated GA-dinucleotide can subsequently be
added to the topoisomerase I-DNA complex as a religation substrate together with 330 mmol/1 NaCl, in order
to prevent recleavage of the religated DNA-biotin adduct (fig. 3b). After ethanol precipitation and trypsinizing, non-cleaved, cleaved, and religated forms of the labelled oligonucleotide strand can be electrophoretically
separated on 0.5 mm 140 g/1 polyacrylamide gels under
denaturing conditions and visualized by autoradiography
(fig. 3c). Cleaved and religated forms of the labeled oligonucleotide strand will migrate retardedly, because
they are covalently linked either to a protease resistant
peptide of topoisomerase I or to biotin. Alternatively, for
a quantitative assessment of the religation reaction, the
fraction of the cleaved oligonucleotide strand religated
to the biotinylated dinucleotide can be captured by immobilized avidin. Radioactivity bound to the beads can
be taken as a measure of religation. These assays have
proven to be valuable tools in elucidating the mechanism
of enzyme action, but they can only be used with high
concentrations of pure enzymes and, therefore, are not
suitable for all purposes.
4. Analysis of Topoisomerase-Directed Drug Effects
4.1 Types of topoisomerase inhibitors
Some of the most powerful therapeutic substances used
for the systemic treatment of cancer target DNA topo-
Boege: Analysis of DNA topoisomerases and topoisomerase-directed drug effects
879
whereas topoisomerase I-specific poisons, which are
even more powerful anti-cancer drugs, are just now being introduced into systemic cancer therapy (53, 116,
117). Early clinical trials of poisons targeting both types
of topoisomerases (128, 129) show that these substances
may form a new class of anti-tumour drugs, which are
active on a variety of solid tumours and escape crossresistance to drugs that target solely one type of topoisomerases. The efficacy of all topoisomerase poisons is
closely related to the amount of topoisomerase-DNA adducts formed in the cell. Thus, assays for measuring
these molecular drug effects are useful in searching for
new cancer-drugs (130) as well as for monitoring the
efficacy of the therapy (75).
isomerases. There are two types of topoisomerase-directed drugs with different mechanisms of action.
4.1.1 Topoisomerase poisons
The first type of substances, termed topoisomerase poisons, includes anthracyclines, aminoanthracenes, podophyllotoxins, aminoacridines, ellipticines, and quinolones acting on topoisomerase II (28, 29, 49, 112-115),
camptothecins acting on topoisomerase I (16, 26, 53,
116-120), and flavonoids (114, 121-123), the fungal
toxine saintopin (124, 125), and the 7H-benzo-pyridoindole intoplicine (126) acting on both topoisomerase I
and II. These compounds stabilize the covalent DNAtopoisomerase intermediate by stimulating the cleavage
reaction and/or inhibiting the religation step (27, 127).
By doing so, they turn topoisomerases into powerful cell
poisons that cut up and damage the genome, and, consequently, induce apoptosis in proliferating cells (28, 29,
49, 112, 113). Topoisomerase II-specific poisons are
longstanding components of many therapeutic protocols,
4.1.2 Topoisomerase inhibitors
The second group of substances, termed topoisomerase
inhibitors, includes aclarubicine (131), ß-lapachone
(132), chebulaic acid (130), and certain synthetic flavonoids (123). These drugs inhibit the non-covalent DNA
Recognition sequence
p _ TTTTTTAAAAATTTTTCTAAGTCTT PTAGATCCTCT 3 '
3 'AAAAAATTTJTTAAAAA-P
3'GATTCAGAA&ATCTAGGAGA-[ 32 P]
Cleavage site
<- Biotin-GATTCAGAAAATCTAGGAGA- [ 32 P]
<- Peptide-TTCAGAAAATCTAGGAGA- [ 32 P]
4- GATTCAGAAAATCTAGGAGA- [ 32 P]
Fig. 3
Separate measurement of topoisomerase I-mediated cleavage and religation:
a) The oligonucleotide substrate is composed of a 36-mer noncleaved strand, a 20-mer cleaved strand and a 16-mer duplex-forming strand. Non-cleaved and duplex-forming strands were nonradioactive, the cleaved strand radioactively phosphorylated on the
5'-ends with E. coli 4 polynucleotide kinase. The oligonucleotides
were hybridized in a ratio of 1 : 1.5 : 2 (cleaved: non-cleaved: duplex^forming).
b) Suicide cleavage of the oligonucleotide was initiated by addition
addition
of 200 units of purified human topoisomerase I per 0.2 pmol of
substrate and was allowed to continue for 30 min at 30 °C. Religation was subsequently started by addition of 200 pmol of the biotinylated dinucleotide and carried out in the presence of 330 mmol/1
NaCl at 37 °C for 30-60 min.
c) Electrophoresis of the non-cleaved (left), the cleaved (middle),
and the religated substrate (right) in a 140 g/1 polyacrylamide gel
under denaturing conditions. Samples were trypsinized and denawith formamide and heating (96 °C for 5 min) before electrotured wit
phoresis.
880
Bocgc: Analysis of DNA topoisomcrasefc and topoisomerase-directed drug effects
binding or the cleavage reaction of topoisomerases inhibiting the catalytical activity without inducing DNAbreaks. Some of these substances are potent virostatics
(133-135).
4.2 Cell-free assays for topoisomerasedirected drug effects
be obtained with 100—200 units of topoisomerase per
250 ng of pBR 322 DNA in a final volume of 20-30 μΐ.
4.2.2 Drug effects on part-reactions
Detailed information on the effects of various drugs on
the DNA cleavage and religation reactions has been obtained by including these substances into oligonucleo-
4.2.1 Screening strategies
1
2
3
4
5
6
7
8
9
For the simultaneous screening of topoisomerase I<-Application Slot
targeted drug effects, both of the poison- and the inhibitor-type, a strategy has been proposed (130) which is
<-pBR 322, nicked
based on alterations of the electrophoretic mobility of
<- pBR 322, linearized
pBR 322 plasmid DNA due to the combined action of
«- pBR 322, supercoiled
topoisomerase I and inhibiting drugs. As shown in figure
<-pBR 322, relaxed
4, the mobility of the naturally supercoiled closed circular double stranded plasmid DNA increases upon topoisomerase I-mediated relaxation if electrophoresed in a
1 g/1 agarose gel with 0.5 mg/1 ethidium bromide. This
change in electrophoretic mobility of the topoisomers is
caused by intercalation of the DNA with ethidium bromide, leading to the introduction of positive supercoils
into closed circular DNA molecules. In the presence of
topoisomerase I and camptothecin, which binds to the
covalent DNA-topoisomerase I intermediate and inhibits
Fig. 4 Topoisomerase-mediated relaxation, nicking, and linearthe religation half-reaction (26), topoisomerase I intro- ization of a plasmid DNA.
duces nicks into one of the DNA-strands. After protein- Procedure: 250 ng pBR 322 plasmid DNA were incubated with
ase K-digestion of the covalently attached enzyme, the 200 U of human topoisomerase I or II in the absence or presence
resulting open-circular plasmid migrates to a similar po- of camptothecin, etoposide, or EMD 50 689. The control was pBR
322 DNA without drugs and without enzymes. Linearized pBR
sition as DNase I-nicked pBR 322 (118). The migration 322 was obtained by digestion of 250 ng DNA with 40 units of
of the open-circular plasmids are unaffected by interca- EcoRl endonuclease. Nicked pBR 322 DNA was obtained by dilation with ethidium bromide and are slower than gestion of 1 μ§ DNA with 0.2 U DNase I in the presence of 0.25
g/1 ethidium bromide, 20 mmol/1 MgCl , 0.2 mmol/1 dithiothreitol,
closed-circular and linearized plasmid forms. In con- 10 mmol/1 bis-Tris-propane, pH 7.9 at 237 °C for 5 min (modified
trast, substances such as -lapachone, or the synthetic according to 1. c. (133)). The assay had a final volume of 40 μΐ of
flavonoid HMD 50689 (123), which inhibit the catalytic reaction buffer (10 mmol/1 bis-tris-propane, pH 7.9, containing 10
mmol/1 MgCl2, 10 mmol/1 KC1, 0.1 mmol/1 dithiothreitol and 10
activity of the enzyme but do not stabilize the covalent g/1 dimethylsulphoxide,
volume fraction 0.1). Incubation at 37 °C
DNA intermediate, will inhibit plasmid relaxation but for 30 min was terminated by addition of 10 g/1 sodium dodecyl
will not induce nicked plasmid forms. A similar result sulphate. Samples were then digested with l g/l proteinase K at
37 °C for 30 min. Gel electrophoresis was performed at 0.4 V/cm
is obtained with topoisomerase II and topoisomerase II for 12 h in 1 g/1 agarose gels with TRIS/borate/EDTA-buffer condirected drugs, with the exception that type II enzymes taining 0.5 mg/1 of ethidium bromide. Fluorescence of ethidium
will linearize the plasmid in the presence of poisons, bromide in the gels (excitation 302 nm, emission > 600 nm) was
documented by Polaroid photography.
because they cleave both DNA strands simultaneously.
Interpretation: The migration distance of naturally supercoiled
The linearized plasmid form migrates slightly further pBR 322 DNA (lane 3) becomes increased upon relaxation by tointo the gel than the nicked from. Thus, inhibition of poisomerase I (lane 7) or topoisomerase II (lane 8), when subjected
relaxation without linearization or nicking indicates the to 1 g/1 agarose gel electrophoresis in the presence of ethidium
bromide, because the relaxed plasmid can incorporate more of the
action of a topoisomerase inhibitor, whereas formation intercalator and as a result becomes more positively supercoiled.
of open-circular or linearized plasmid DNA can be taken Linearization (lane 1) or nicking (lane 2) results in forms of the
as a measure of the effects of topoisomerase poisons. plasmid migrating more retardedly, because these will not be supercoiled by ethidium bromide any more. It can clearly be seen
Since the formation of nicked or linearized plasmid (lane 4 and 5) that in the presence of topoisomerase I, camptoforms by topoisomerase I or II, respectively, is a stoichi- thecin, a topoisomerase I poison, induces the nicked plasmid form
ometric process, it requires sufficient amounts of en- in a dose-dependent manner, whereas there is no effect in the absence of the enzyme (not shown). In contrast, EMD 50689, a synzyme in the assay. However, with increasing amounts of thetic flavonoid recently shown (98) to inhibit topoisomerase I caenzyme, background cleavage of the DNA substrate in talytic activity, inhibits topoisomerase I-mediated pBR 322 relaxthe absence of drug will also rise. Thus, optimization of ation but does not induce nicking (lane 6). The topoisomerase II
poison etoposide induces linearization of pBR 322 DNA in the
the enzyme to DNA ratio is crucial. The best results will presence of topoisomerase II (lane 9).
Boege: Analysis of DNA topoisomerases and topoisomerase-directed drug effects
tide suicide assays (27, 37, 127). Inhibition or stimulation of the cleavage and/or of the religation reaction can,
thus, be studied separately and without influencing each
other. We have used this approach for the characterization of various novel flavone inhibitors of eukaryotic
topoisomerase I (123).
4.2.3 DNA sequence specificity
Topoisomerase poisons stimulate topoisomerase-mediated cleavage at defined DNA sequences, which differ
between various topoisomerase inhibitors. DNA sequence specificity is thought to arise from the formation
of ternary DNA-enzyme-drug complexes. Most drugs
seem to be interacting simultaneously with specific sites
on the enzyme and specific DNA residues (16, 29, 136).
Sequence specificity of drug-induced DNA cleavage by
topoisomerases usually is studied with large fragments
of plasmid DNA that have been end-labelled (137). The
cleavage pattern can be analyzed in DNA sequencing
gels.
4.2.4 Demonstration ofcovalent topoisomerase-DNA
complexes
While analytical efforts approaching topoisomeraseDNA interactions from the DNA-side offer the opportunity of screening many substances at the same time
without large experimental effort, they require the use
of pure or partially pure enzyme preparations, not contaminated with DNases. Moreover, these assays are not
very sensitive with respect to enzyme concentrations,
because linearization and nicking are stoichiometric processes, which consume the enzyme present in the assay.
Approaches for detecting covalent DNA-topoisomerase
intermediates on the protein-side are more suitable for
the analysis of crude preparations with low levels of
enzyme: K-sodium dodecyl sulphate precipitation utilizes the fact that sodium dodecyl sulphate-micelles of
proteins can be selectively precipitated with potassium.
Thus, after incubating labeled DNA with topoisomerases
and subsequent sodium dodecyl sulphate-denaturation,
the DNA-label will be detected in the potassium precipitate if covalent enzyme-DNA complexes have been
formed during the incubation (138). However, this approach is not specific for topoisomerases, because it will
also detect covalent complexes of DNA and other proteins. A more specific and highly sensitive assay for the
formation of topoisomerase-DNA adducts is the immuno-dot blot. This procedure utilizes the selective
binding of covalent topoisornerase-DNA complexes to
nitrocellulose in the presence of sodium dodecyl sulphate (123, 130). Thus, crude topoisomerase preparations can be incubated with a non-specific DNA sample
such as calf thymus DNA in the presence or absence of
drugs. Subsequently, the incubation mixture is treated
881
with sodium dodecyl sulphate and filtered through nitrocellulose by vacuum. As shown in figures 5a and b, only
enzyme that is covalently linked to the DNA will bind
to the filter and can be specifically detected by immunostaining, whereas enzyme not linked to DNA will not
bind. Enhancement of filter-binding can, thus, be clearly
assigned to the action of a topoisomerase poison. The
selectivity of the assay regarding the DNA-linkage of
the enzyme can easily be tested by treating the sample
with a detergent-resistant endonuclease such as
Benzonase® prior to filtration, which will abolish the
immuno signal (fig. 5a). Since specific antibodies for
topoisomerase I, topoisomerase Πα and topoisomerase
Πβ are now available, the same analytical approach can
be used for all forms of topoisomerases.
4.3 Measuring topoisomerase-directed drug
effects in intact cells
The classical approach for detecting drug-induced DNA
breaks in the alkaline elution technique (139—141).
Since this method requires metabolic labelling of the
DNA and is not specific for topoisomerase-mediated
strand breaks, alternative methods have been sought.
With specific antibodies directed against the various
types and forms of topoisomerase becoming available
(96), several assays have been designed for monitoring
the covalent linkage of topoisomerases to the genomic
DNA of the cells on the protein side. There is some
evidence that accumulation of DNA-linked topoisomerase in the nuclear DNA matrix of treated cells can be
measured by fluorescence microscopy of antibodystained cells (74, 142). However, interpretation of these
images is still ambiguous. The most straightforward approach to date seems to be the immuno-band-depletion
assay (119, 143). As shown in figure 6, it is based on
the observation that topoisomerase covalently linked to
genomic DNA of high molecular mass will not enter a
polyacrylamide gel during sodium dodecyl sulphate gel
electrophoresis. Thus, it can not be detected by
following immuno-blotting. When cells are treated efficiently with topoisomerase poisons and are lysed subsequently with sodium dodecyl sulphate, the topoisomerase band will disappear or decrease in the immuno-blot
as compared to non-treated controls. Thus, immunoband-depletion can be taken as an indication of the effective interaction of topoisomerase, drug, and DNA in
the living cell (46). However, the band-depletion phenomenon can not be interpreted if the appropriate untreated control is missing, as for example in tumour cell
samples obtained during treatment of patients, since
down-regulation of enzyme expression will give a similar result. Digestion of the DNA by a detergent-resistant
nuclease (fig. 5) can be used as a control, however it
does not work reliably in all cells. It should also be
noted that, in contrast to topoisomerase poisons, topo-
882
Boege: Analysis of DNA topoisomerases and topoisomerase-directed drug effects
isomerase inhibitors will produce a band-repletion phe- 5. Perspectives for Clinical Oncology and
Pharmacology
nomenon in some cells. They increase the amount of
enzyme that enters the polyacrylamide gel and can be 5.1. Topoisomerases and drug-hunting
detected by immuno-blotting, because they inhibit backWith the discovery of topoisomerases as targets for antiground cleavage. Band-repletion can only then be intercancer drugs and virostatics, a rational and systematic
preted in terms of a release of tbpoisomerases from cosearch for new therapeutic substances has become posvalent DNA bonds if it is also observed in the presence
of a protein biosynthesis inhibitor, such as cyclohexi- sible. Screening assays of topoisomerase-directed drug
mide. Considerable efforts directed at devising a method effects have been successfully employed for detecting
that allows a direct demonstration of DNA-topoisomer- several new classes of topoisomerase poisons and inhibase complexes by immuno-dot blotting of sodium dode- itors (16, 121, 123, 128, 132, 145;>i146). Some recently
cyl sulphate-lysed cells, have not yet given reliable re- discovered topoisomerase poisons have already shown
sults. However, camptothecin-induced covalent com- promising anti-tumour activities in the clinic (128, 129).
plexes of topoisomerase I and DNA formed in living When setting out to analyze topoisomerase-directed efcells can be detected by caesium chloride density gradi- fects in vitro, selection of the appropriate target enzyme
ent centrifugation of cell lysates, followed by immuno- is crucial. It needs to be purified at least to a stage where
dot blotting (144).
type I and type II enzymes are clearly separated. One
Camptothecin
μπιοΐ/ΐ
Control
100
ι
Control
2
SDS
3
DNA, SDS
4
CPT+DNA, SDS
CPT+DNA, SDS,
then Benzonase
1
2
3
Ο -I
0
Protein
30
DNA
10
6
Fraction (1 ml)
:i
CPT
Control
3
1
Fig. 5 Detection of covalent topoisomerase-DNA complexes by immuno-dot blotting:
a) Procedure: Immuno-dot blotting of DNA-linked topoisomerase
I: 400 U of human topoisomerase I were preincubated with 3 μg
of calf thymus. DNA in the presence of 2 mmol/1 MgCl2 in a final
volume of 500 μΐ of reaction buffer (10 mmol/1 bis-Tris-propane,
pH 7.9, containing 10 mmol/1 MgCl2, 10 mmol/1 KC1, 0.1 mmol/1
dithiothreitol and dimethylsulphoxide, volume fraction 0.1). Incubation at 37 °C for 30 min with (lines 4 and 5) or without (line 3)
30 μπιοΐ/ΐ camptothecin. The reaction was terminated by addition
of 2 g/1 sodium dodecyl sulphate. Controls were: Untreated enzyme
(line 1), sodium dodecyl sulphate-treated enzyme not preincubated
with DNA (line 2), enzyme preincubated with DNA and 30 μπιοΐ/ΐ
camptothecin, followed by sodium dodecyl sulphate-denaturation
and subsequent treatment with 250 U of Benzonase (line 5). Samples were filtered through nitrocellulose filters using a 96-well vacuum dot blot apparatus (Schleicher & Sch ll, Germany), followed
by 2 washes (500 μΐ) with 10 mmol/1 Tris-HCl, pH 7.5, 50 mmol/1
NaCl. Nitrocellulose filters were irradiated (254 nm, 2 min), dried
at 20 °C for 12h, and finally subjected to immunostaining.
immunostaining was earned out using a mouse monoclonal antibody against human topoisomerase I (kindly supplied by Dr. Igor
Bronstein, Engelhard Institute, Moscow, GUS), peroxidase-labelled
goat-anti-mouse IgG, and peroxidase-activated enhanced chemoluminescence of luminol (ECL).
Interpretation: Nitrocellulose-binding of non-denatured topoisonv
erase I (line 1) is completely blocked by sodium dodecyl sulphate
(line 2). It becomes completely restored upon preincubation with
calf thymus DNA and camptothecin (line 4) but only marginally
with DNA alone (line 3). Digestion with detergent endonuclease
(Benzonase®) abolishes camptothecin-induced filter binding (line
5), showing that covalent DNA-linkage of the denatured enzyme
is responsible for absorption to nitrocellulose.
b) Procedure: Enzyme was preincubated with DNA in the absence
or presence of 30 μηιοΐ/ΐ camptothecin (CPT), and denatured with
2 g/1 sodium dodecyl sulphate (see a), followed by gel chromatography (Sepharose 4B, column 10 X 1 cm, equilibrated and run
with 0.5 ml/min of reaction buffer, containing 1 g/1 sodium dodecyl
sulphate), in order to separate DNA-bound from free topoisomerase I. Fractions of one ml were collected and analyzed by immunodot blotting. The elution profiles of either enzyme or DNA alone
were determined by light absorption at 280 nm (protein) or fluorescence of bisbenzimide (0.01 mg/l)-stained DNA, respectively.
Interpretation: Gel chromatography proves that only enzyme coeluting with the high molecular DNA binds to nitrocellulose filters
in the presence of sodium dodecyl sulphate. Pretreatment with
camptothecin specifically increases the filter binding of the DNA
linked, but not of the free, enzyme fraction. Thus, filter binding of
the sodium dodecyl sulphate denatured enzyme can be used for
demonstrating covalent DNA-linkage.
c) Procedure: Topoisomerase I was preincubated with DNA in the
absence (control) or presence of various concentrations of camptothecin, followed by immuno-dot blot analysis, as described in (a);
Interpretation: Camptothecin increases the covalent DNA-linkage
of topoisomerase I in a manner proportional to the concentration
of the drug.
Boege: Analysis of DNA topoisomerases and topoisomerase-directed drug effects
should keep in mind that in particular the type II enzymes from different species have different drug sensitivities. Moreover, catalytic activity and drug sensitivity
of topoisomerases are regulated by phosphorylation, as
well as poly(ADP)ribosylation (147-149). Finally, the
proteolytic loss of regulatory domains (the carboxyterminus of topoisomerase II and the aminoterminus of topoisomerase I), will produce catalytically highly active
core-enzymes with altered drug sensitivity. Heterologous expression of human topoisomerases in yeast has
turned out to be the most elegant way of obtaining sufficient quantities of structurally intact enzymes (150).
This approach is more advisable than purifying the enzymes from primary tissues, such as calf thymus, which
will in most cases result in a mixture of various proteolytic degradation products (61). For the human type II
enzymes, a set of peptide-directed antibodies has been
developed, which are specific for the termini of the enMr
[103]
112
— 76
— 53
\v
Front
χ
Fig. 6 Immuno-band-depletion in cells.
Procedure: 106 HL-60 cells were cultivated for 30 min at 37 °C
with 30 μιηοΐ/ΐ camptothecin. Controls were without camptothecin,
or with a subsequent DNA-digestion with 250 units of detergent
resistant endonuclease Benzonase® for 10 min at 37 °C. The reaction was terminated by sedimentation of the cells (1000g, 5 min,
4 °C) and subsequent lysis in 10 g/l SDS. Samples were subjected
to sodium dodecyl sulphate-polyacrylamide (80 g/1) gel electrophoresis and proteins that had entered into the gel were electrophoretically transferred to nitrocellulose sheets by the semi-dry method.
Immunostaining of immobilized proteins was carried out using a
mouse monoclonal topoisomerase I antibody, peroxidase-labelled
goat-anti-mouse IgG, and peroxidase-activated enhanced chemoluminescence of luminol (ECL). Migration distances of immunostained protein bands were compared with those of rabbit muscle
myosin (MT = 212 000), a2-macroglobulin from bovine plasma (Mr
= 170000), p-galactosidase from E. coli (Mr = 116000), human
transferrin (Mr = 76 000) and bovine liver glutamic dehydrogenase
(Mr = 53 000).
Interpretation: The topoisomerase I band (MT = 100000) becomes
depleted upon treatment with the topoisomerase I poison camptothecin. Disappearance of the bands is clearly related to the covalent
binding to DNA because it can be reverted by DNase-treatment.
Upon DNase-treatment, topoisomerase I migrates slightly retardedly and more diffusely, because of the attachment of oligonucleotide adducts of various sizes.
883
zymes and can, thus, be used for,, characterizing the
structural integrity of the purified proteins by western
blotting. At least some indications regarding epigenetic
modifications of the enzyme can be gained by isoelectric
focusing or chromatofocusing (45, 67). Finally, a rough
estimate of the specific activity should be attempted, for
example by relating the catalytic activity to the amount
of enzymes, as judged from the intensity of the silverstained protein band in a sodium dodecyl sulphate-polyacrylamide gel. Supposing that the specific activity of
topoisomerase I or II is clearly lower than 105 or 104
units/mg, respectively, the enzyme is most probably dephosphorylated, or otherwise inactivated and will show
increased sensitivity for inhibitors but decreased sensitivity for poisons.
Screening of topoisomerase-directed drug effects should
start with the in vitro analysis of the alterations of pBR
322 mobility (see fig. 4), since this assay can detect
topoisomerase inhibitors as well as topoisomerase poisons. For topoisomerase poisons, stabilization of the covalent enzyme-DNA complex by the drug should be
confirmed by immuno-dot blot or a similar assay, detecting topoisomerase-DNA adducts from the protein side
(see fig. 5). Due to its greater sensitivity, the immunodot blotting method is also most suitable for determining
dose-response curves (fig. 5c). In addition, it may be of
interest to compare DNA cleavage sites of topoisomerase induced by the drug tested to those induced by standard topoisomerase poisons, such as camptothecin or
amsacrine. For topoisomerase inhibitors, it should be
checked to see whether these can antagonize a standard
topoisomerase poison (151). Finally, the cellular effects
on topoisomerases can be studied by the band-de/repletion phenomenon (see fig. 6), using for example HeLa
cells, or human leukaemic HL-60 cells. In this case, a
single batch of cells treated for 1 —2 h with drug can be
probed with different antibodies, specific for the various
types and isoenzymes of DNA topoisomerases (96,
123).
5.2 Clinical drug-monitoring and prediction of
sensitivity for topoisomerase poisons
The cytotoxic effect of topoisomerase poisons is closely
related to the cellular levels of the target proteins (30—
33) and to the responsiveness of the enzymes to the
drugs. Thus, down-regulation of topoisomerases (34,
35), or mutations (36—51) and epigenetic modifications
(42—44, 149) that will produce topoisomerase variants
less susceptible to these drugs result in resistance of the
tumour to the treatment. Moreover, the expression of
topoisomerase Πα is a marker of cell proliferation and,
in some tumours, has been shown to be predictive for
therapeutic outcome (152-156), With the Ki-Sl monoclonal antibody, which can be used to detect topoi-
884
Boege: Analysis of DNA topoisomerases and topoisomerase-tii reeled drug effects
somerase I la even in paraffin-embedded thin sections of
tumour tissue (71, 96), the study of expression levels of
topoisomerase Πα by various immuno-chemical methods has become much easier. However, in view of the
pronounced epigenetic regulation of the enzyme, it may
be more informative to study enzyme activities instead.
A method for small scale extraction and partial purification of topoisomerase activities from leukaemic cell
samples (as small as 5 Χ 106 nucleated cells) has recently been published (75). It utilizes heparin Sepharose
affinity chromatography in mini spin columns containing 100 μΐ of the matrix. These authors could discriminate various isoactivities of topoisomerases with different drug-densitivity by plasmid relaxation assays carried out at different pH. But these data are difficult to
interpret, because the authors failed to relate the observed iso-activities to the known structural forms of
topoisomerases. Nevertheless, the results of their study
suggest that various iso-activities of topoisomerases may
be related to the drug sensitivity of the cells. Recently,
the band-depletion of topoisomerase I has been used for
the first time for monitoring the therapy with topotecan,
a camptothecin derivative poisoning topoisomerase I.
Based on the increasing cleavable complex formation in
peripheral blood lymphocytes with increasing topotecan
infusion duration, a rationale for prolonged administration of camptothecins could be obtained (157). A similar
result was obtained by another group using the immunodot blotting procedure combined with separation of free
and DNA-bound topoisomerase by caesium chloride
density gradient centrifiigation (144). These examples
show that the technology for measuring cellular levels
and activity of topoisomerases and for assessing the molecular effects of topoisomerase-directed drugs in specimens from tumour patients is just about to be developed.
Thus, in the near future, we may be able to assess the
sensitivity of tumour cells before and during therapy,
and to individualize the clinical use of topoisomerase
poisons.
Acknowledgements
The author gratefully acknowledges an educational stipend of the
Deutsche Krebshilfe, Dr. Mildred Scheel Stiftung and support by
the Deutsche Forschungsgemeinschaft, SFB 172, B12.
6. References
1. Wang JC. DNA topoisomerases. Annu Rev Biochem 1985;
54:665-97.
2. Wang JC. DNA topoisomerases. Annu Rev Biochem 1996;
65:635-92.
3. Cozzarelli NR, Wang JC. DNA topology and its biological
effects. Cold Spring Habour, NY: Cold Sprong Harbour Laboratory Press, 1990.
4. Meriono A, Madden KR, Lane WS, Champoux JJ, Reinberg
D. DNA topoisomerase I is involved in both repression and
activation of transcription. Nature 1993; 365:227-32.
5. Kretzschmar M, Meisterernst M, Roeder R. Identification of
human DNA topoisomerase I as a cofactor for activator-dependent transcription by RNA polymerase II. Proc Natl Acad
Sei USA 1993; 90:11508-12.
6. Zhang H, Wang JC, Liu LF. Involvement of DNA topoisomerase I in transcription of human ribosomal RNA genes. Proc
Natl Acad Sei USA 1988; 85:1060-4.
7. Lim M, Liu LF, Jacobson KD. Williams JR. Induction of
sister chromatid exchanges by inhibitors of topoisomerases.
Cell Biol Toxicol 1986; 2:485-94.
8. Shuman S. Recombination mediated by vaccinia virus DNA
topoisomerase I in Escherichia coli is sequence specific. Proc
Natl Acad Sei USA 1991; 88:10104-8.
9. Yeh YC, Liu HF, Elis CA, Lu AL. Mammalian topoisomerase
I has base mismatch nicking activity. J Biol Chem 1994;
269:15498-504.
10. Stevnsner T, Bohr VA. Studies on the role of topoisomerases
in general, gene- and strand-specific DNA repair. Carcinogenesis 1993; 14:1841-50.
11. Nitiss JL. Roles of DNA topoisomerases in chromosomal replication and segregation. Adv Pharmacol 1994; 29:103-34.
12. Earnshaw WC, Mackay AM. Role of nonhistone proteins in
the chromosomal events of mitosis. FASEB J 1994; 8:94756.
13. Eamshaw W, Heck M. Localization of topoisomerase II in
mitotic chromosomes. J Cell Biol 1985; 100:1716-25.
14. Earnshaw W, Halligan B, Cooke C, Heck M, Liu L. Topoisomerase II is a structural component of mitotic chromosome
scaffold. J Cell Biol 1985; 100:1706-15.
15. Wood ER, Eamshaw WC. Mitotic chromatin condensation in
vitro using somatic cell extracts and nuclei with variable
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
levels of endogenous topoisomerase II. J Cell Biol 1990;
111:2839-50.
Gupta M, Fujimori A, Pommier Y. Eukaryotic DNA topoisomerases I. Biochim Biophys Acta 1995; 1262:1-14.
Osheroff N. Biochemical basis for the interactions of type I
and type II topoisomerases with DNA. Pharmacol Ther 1989;
41:223-41.
Osheroff N. Eukaryotic topoisomerase II. Characterization of
enzyme turnover. J Biol Chem 1986; 261:9944-50.
Osheroff N, Zechiedrich EL, Gale KC. Catalytic function of
DNA topoisomerase II. Bioassays 1991; 13:269-73.
Watt PM; Hickson ID. Structure and function of type II DNA
topoisomerases. Biochem J 1994; 303:681-95.
Jenkins JR, Ayton P, Jones T, Davies SL, Simmons DL, Harris AL, et al. Isolation of cDNA clones encoding the beta
isozyme of human DNA topoisomerase II and localisation
of the gene to chromosome 3p24. Nucleic Acids Res 1992;
20:5587-92.
Tsai-Pflugfelder M, Liu LF, Liu AA, Tewey KM, WhangPeng J, Knutsen T, et al. Cloning and sequencing of cDNA
encoding human DNA topoisomerase II and localization of
the gene to chromosome region 17q21—22. Proc Natl Acad
Sei USA 1988; 85:7177-81.
Biersack H, Jensen S, Gromova I, Nielsen I, Westergaard O,
Andersen A. Active heterodimers are formed from human
DNA topoisomerases II alpha and beta isoforms. Proc Natl
Acad Sei USA 1996; 93:8288-93.
Smith PJ, Makinson TA. Cellular consequences of overproduction of DNA topoisomerase II in an ataxia-telangiectasia
cell line. Cancer Res 1989; 49:1118-24.
Gale KC, Osheroff N. Intrinsic intermolecular DNA ligation
activity of eukaryotic topoisomerase II. Potential roles in recombination. J Biol Chem 1992; 267:12090-7.
Hertzberg RP, Caranfa MJ, Hecht SM. On the mechanism
of topoisomerase I inhibition by camptothecin: evidence for
binding to an enzyme-DNA complex. Biochemistry 1989;
28:4629^38.
Sorensen BS, Sinding J, Andersen AH, Alsner J, Jensen PB,
Westergaard O. Mode of action of topoisomerase II-targeting
agents at a specific DNA sequence. Uncoupling the DNA
Analysis of TWA topoisomcnases and topoisomerase-directed drug effects
cleavage and rcltgation events, J Mol Biol 1992;
Lni LR ΠΝΛ topoisomerase poisons as antitumor drugs.
Annu Re\ Bioehem 1 W>: 5S:351 -75.
l-Yoelich-.-Vmrnon Sk OshavflTN, Topoisomerase poisons: harncAving the darit side of cnzxtnc meehanism. J Biol Chem
OA, McPhcram JR Gu L. Medley DW, Toso R,
Dcucbarc KU ct al. Relationship of DNA topoisomerase Πα
And β expression to cytotoxioity of antineoplastic agents in
CUIC hinphoblastic leukemia cell lines. Cancer Res
31. Daxies S\t Robson ON, Davies SL. Hickson ID. Nuclear
topoisomciase Η levels condate with the sensitivity of mammalian cells to intercalating aecnts and epipodophylloioxins.
3 Kol Chem HS& 265:17724-9.
Tte\ies S\l, Harris AU Hickson ID. Overproduction of topoisctrncrasc 11 in an ataxia telangiectasia fibroblast cell line:
comparison \«th a topoisomerase Π-oveiproducing hamster
cell muam. Nucleic Adds Res 19S9: 17:1337-5ΐΓ
53. Fn AM. Chrcsra CM, Davies SM. Walker MC. Harris AL.
Kanjey JA. ea al. Relationship between topoisomerase II level
and chcmcisensiuvity in human tumor cell lines. Cancer Res
1*91: 5 1:6592-5.
34. \V*bb CD. Laiham MD, Lock RB. Sullivan DM. Attenuated
t^poisomsrase II content directly correlates \\iih a low level
of iJnis resistance in a Chinese hamster ovarv cell line. Cancer Res 1993: 51:6543-9.
Harks- WG. Slade DL. Drake FH, Parr RL. Mitoxantrone
in HL-60 leukemia cells: reduced nuclear topoiso£ H catalyse activity snd drug-induced DNA cleavage
in 3as:vci2aon with reduced expression of the topoisomerase
II hssa isrfonn. Biochemistry 1991; 30:9953—61.
. ΤΕΤΓ,ΊΜ Η, Kobcrhi C. Yainada R. Dceda T. Koiwai O? Panerso2 £. 2i 2! Mblecrl2r cloioig of a cDNA of a cairipiothecinresisisi^ h..!!..:.3;. DXA topoisoiDerase 1 and identification of
zrJiEikG axes. Nbdeic .Acids Rss 1991: 19:69-75.
Grocer IL Kieldsea E, Svejsircp JQ. Alsner J. Chrisdansen
K. Vssifxpsra O. Chazaciedzaiioa of an aJurred DNA caialrf ζ c2zsgXD±i25ciD-reasi2ci eukznoiic lopoisomerass I.
zisr Adds Rss 1993: 21:593-600.'
3
3Y. Dsnks MK. 3s^k "AT. Slide DP. Expression of a
DXA tDpeiscoaarase H in CCRF-CEM hmnaa 3eu);eιΓ r:?:Ts srlsrtsd for resistance to lesiposide. Proc Nail Acad
S USA 3991: §5:7654-5.
39. Hinds M DdssOTih K. Mayes J. Alischuler E, Jansen R,
ΡΊ5. SL &L losrdn^aiiorj of a poici mm^nion ID the
II gsaz iron3 a human leukemia cell line CODχ^ττη^ 22 2zas2icnn&-r2Rsi2C2i fonrj of lopoisoiasrase IL Can^r Eis : 991 : 51:4729-31.
-CD. ?_uhb E. Pscaazas ?. Bhartj A. TqppiBsyer D^ Giovans a B.
D, Idsas cziioQ cf a aastest human lopoisonierase ί
' and resistanoe to 9-ηίΰΌ-θ2ηψΐοL j: Biol Chera 1994; 269:2433-9X Kaazjn»a F, ?visbic X. TsJ^sda X Ohmori T, Fuji*
«s aL Dss^aaon cf lopsisw^srase J ^etie poini mutaicchcm i<>
ling
two in CPT-j 1
42, Taharo H. X B» K, ODD M. Uc;hida Y, KJU-AWO M,
of DNA topvhitintfase If ;n etohumacn sa&ser KB cdls. Cancer
h 533853 «743. SuasOO IL ^yvk^h^Lc^) fe Zabsk J- CAsrwjjwki KM, Nw?>
K- Sxiisaas L 7y
i
44.
Ojjrb$?ti
C;
i: drugs
t.
^f typ<jit»«>^t?r^s« JWpJ»
46. Boege F, Kjeldsen E, Gieseler F, Al$ner J. Biersack H. A
drug-resistant variant of topoisomerase Ilalpha in human HL60 cells exhibits alterations in catalytic pH optimum, DNAbinding and sub-nuclear distribution. Eur J Biochem 1993;
218*575·" 84
47. Eder J. Chan VT-W, Sg S-W, Rizvi N, Zacharoulis S, Teicher
A. et al, DN7A'topoisomerase Η-alpha expression is associated whh alkylating agent resistance. Cancer Res 1996;
55:6109-16.
48. Zijlstra JG, de Jong S. de Vries EG, Mulder NR Topoisomerases, new targets in cancer chemotherapy. Med Oncol Tumor
Phannacother 1990; 7:11-8.
49. Zwelling LA, Estey E, Bakic M. Silberman L· Chan D. To
poisomerase IJ as a target of antueukemic drugs, Nrci Monogr
1987: 1987:79-82.
50. Wang JC. DNA topoisomerases: from a laboratory curiosity
to a subject in cancer chemotherapy. Nci Monogr 1987:
1987:3-6.
51. Lock RB. Ross WE. DNA topoisomerases in cancer therapy,
Anticancer Drug Rss 1987; 2:151-64.
52. Rose KM DNA topoisomerases as targets for chemotherapy.
FASEB J 1988: 2:2474-8.
53. Slichsninyer WJ. Rowinsky EK. Donehower RC, Kaufinann
SH. The current status of camptothecin analogues as antitumor agents. J Nail Cancer Inst 1993; 85:271 -91.
54. Wang JC. Interaction between DNA and an Escherichia coli
protein Co. J Mo! Bio! 1971: 55:523-33.
55. Liu LF. HeLa topoisom&rase L Methods in Enzymology. Academic Press. Inc. New York NY 1983: 100:171-80.
56. Trask KT. M ller MT. Biochemical characterization of topoisomerase 1 purified from avian erythrocytes. Nucl Acids Res
1983: 11:2779-800.
57. Tricoli JV. Kowalsld D. Topoisomerase 1 from chicken erythrocytss: purification, characterization, and detection by a
daoxyribonucleic add binding assay. Biochemistry 1983;
22:2025-31.
58. PuUeyblank DE. Ellison MJ. Purification and properties of
type I topoisomerase from chicken erythrocytes: mechanism
of eukaryotic topoisomerase action. Biochemistry 1982;
21:1155-61.
59. Jahaverian 1C Tse Y-C, Vega J. Drosophila topoisomerase I:
iso&tion. purification and characterization. Nucl Adds Res
1982: 10:6945-55.
60. Goto T. Laipis P. Wang JC. The purification and characterization of DNA topoisomerases I and II of the yeast Saccharonrryces cerevisiae. J Biol Chem 1984; 259:10422-9.
6L Kudinov AR. Bronstdn IB. Gabibov AG, Gololobov GV.
Two subforms of eukaryotic topoisomerase L Purification and
structure-function relationships. FEBS Lett 1992; 314:26770.
62. Strauefeld U, Richter A. Simultaneous purification of DNA
topoisomerase I and II from eukaryotic cells. Prep Biochem
1989; 19:37-48.
63. Schmitt B, uhrc U, Vosberg HP, Characterisation of size
variants of type 1 DNA topoisomerase isolated from calf thymus. Eur J Biochem 1984; 144:127-34.
64, ffibii Kf Uascg wa T, Fujisawa K, Andoh X fiapj'd puriflcation and characterization of DNA topoisomcrrasc J from cultured mou<# mammary carcinoma FM3A celk. J iol Chem
1 9H3; 25«: 1 2728 -32.
65, Schoinhur^ U, Grunsc F, Purification and characterization of
DNA l^pojfiomtTa4>c II from calf thymus associated with
p«ilyp«plulctt of 175 afid 150 kDa, Eur J Biochem
of
, Onerirff Κ
11 a
67.
II
i/i
885
Ιίΐλ lidwiinte KA e Uu LF, Puriflcaiion and characi) «;lf a lypc II DNA topoiwmcravc from bovine calf
J Jjiol Cli&iu I9K5; 260:2475-82.
l', icr^ick ll ; Clark M. Uw? of anionchr<imau)fbcui>ing to reveal
dwoi/.«ndty of tc/poi-someraM?
HIX>M a;JI liiw re^t aui lo /nulii-dmg treaiment J
Ltok IJI, Xmmxrftinnfi Jl1, Met :?ibe I-L. Bartu^ UK Per SR,
I)M, «.Ί aL l'urjlicatioii of uipQJsxjmerase H from am«
886
Boege: Analysis of DNA topoisomerascs and topoisomerase-directed drug effects
sacrine-resistant P388 leukemia cells. Evidence for two forms
of the enzyme. J Biol Chem 1987; 262:16739-47.
69. Miller KG, Liu LF, Englund PT. A homogenous type II DNA
topoisomerasc from HeLa cell nuclei. J Biol Chcm 1981;
256:9334-9.
70. DiNardo S, Voelkel K, Sternglanz R. DNA topoisomerase
II mutant of Saccharomyces cerevisiae: topoisomerase II is
required for segregation of daughter molecules at the termination of DNA replication. Proc Natl Acad Sei USA 1984;
2616-20.
71. Kreipe H, Heidebrecht HJ, Hansen S, Rohlk W, Kubbies M,
Wacker H H, et al. A new proliferation-associated nuclear antigen detectable in paraffin-embedded tissues by the monoclonal antibody Ki-Sl. Am J Pathol 1993; 142:3-9.
72. Woessner RD, Chung TD, Hoftnann GA, Mattern MR, Mirabelli CK, Drake FH, et al. Differences between normal and
ras-transformed NIH-3T3 cells in expression of the 170kD
and 180kD forms of topoisomerase II. Cancer Res 1990;
50:2901-8.
73. Woessner RD, Mattern MR, Mirabelli CK, Johnson RK,
Drake FH. Proliferation- and cell cycle-dependent differences
in expression of the 170 kilodalton and 180 kilodalton forms
of topoisomerase II in NIH-3T3 cells. Cell Growth Differ
1991; 2:209-14.
74. Wolverton JS, Danks MK, Granzen B, Beck WT. DNA topoisomerase II immunostaining in human leukemia and rhabdomyosarcoma cell lines and their responses to topoisomerase
II inhibitors. Cancer Res 1992; 52:4248-53.
75. Gieseler F, Glasmacher A, Kämpfe D, Zernak C, Valsamas
S, Kunze J, et al. Topoisomerase activities in undifferentiated
acute myeloblastic leukemias and monocytic differentiated
leukemias. Recent Res Cancer Res 1996. In press.
76. Boege F, Gieseler F, Biersack H. Meyer P. The measurement
of nuclear-topoisomerase II inhibition in vitro: a possible tool
for detecting resistance on a subcellular level in haematopoietic malignancies. Eur J Clin Chem Clin Biochem 1992;
30:63-8.
77. Kaufmann SH, McLaughlin SJ, Kastan MB, Liu LF, Karp
JE, Burke PJ. Topoisomerase II levels during granulocytic
maturation in vitro and in vivo. Cancer Res 1991;
51:3534-43.
78. Liu LF. Eukaryotic DNA topoisomerases: two forms of type
I DNA topoisomerases from HeLa cell nuclei. Proc Natl Acad
Sei USA 1981; 78:3487-91.
79. Boege F, Gieseler F, Müller M, Biersack H, Meyer P. Topoisomerase II is activated during partial purification by heparinsepharose chromatography. J Chromatogr 1992; 625:67-71.
80. Shelton ER, Osheroff N, Brutlag DL. DNA topoisomerase
II from Drosophila melanogaster. Purification and physical
characterization. J Biol Chem 1983; 258:9530-5.
81. Pommier Y, Kerrigan D, Hartman KD, Glazer RI. Phosphorylation of mammalian DNA topoisomerase I and activation by
protein kinase C. J Biol Chem 1990; 265:9418-22.
82. Cardellini E, Durban E. Phosphorylation of human topoisomerase I by protein kinase C in vitro and in phorbol 12-myristate 13-acetate-activated HL-60 promyelocytic leukaemia
cells. Biochem J 1993; 291:303-7.
83. Cardellini E, Bramucci M, Gianfranceschi GL, Durban E.
Human topoisomerase I is phosphorylated in vitro on its
amino terminal domain by protein kinase NIL Biol Chem
Hoppe Seyler 1994; 375:255-9.
84. Samuels DS, Shimizu N. DNA topoisomerase I phosphorylation in murine fibroblasts treated with 12-O-tetradecanoylphorbol-13-acetate and in vitro by protein kinase. J Biol
Chem 1992; 267:11156-62.
85. Samuels DS, Shimizu Y, Nakabayashi T, Shimizu N. Phosphorylation of DNA topoisomerase I is increased during the
response of mammalian cells to mitogenic stimuli. Biochim
Biophys Acta 1994; 1223:77-83.
86. Samuels DS, Shimizu Y, Shimizu N. Protein kinase C phosphorylates DNA topoisomerase I. FEBS Lett 1989'
259:57-60.
87. Saijo M, Ui M, Enomoto T. Growth state and cell cycle dependent phosphorylation of DNA topoisomerase II in Swiss
3T3 cells. Biochemistry 1992; 31:359-63.
88. Heck MM, Hittelman WN, Earnshaw WC. In vivo phosphorylation of the 170-kDa form of eukaryotic DNA topoisomerase II. Cell cycle analysis. J Biol Chem 1989; 264:15161-4.
89. Sahyoun N, Wolf M, Besterman J, Hsieh T, Sander M, Le
Vine H, et al. Protein kinase C phosphorylates topoisomerase
II: topoisomerase activation and its possible role in phorbol
ester-induced differentiation of HL-60 cells. Proc Natl Acad
Sei USA 1986; 83:1603-7.
90. Saijo M, Enomoto T, Hanaoka F, Ui M. Purification and characterization of type II DNA topoisomerase from mouse
FM3A cells: phosphorylation of topoisomerase II and modification of its activity. Biochemistry 1990; 29:583-90.
91. Kroll DJ, Rowe TC. Phosphorylation of DNA topoisomerase
II in a human tumor cell line, J Biol Chem 1991;
266:7957-61.
92. Cardenas M, Gasser S. Regulation of topoisomerase II by
phosphorylation: a role for casein kinase II. J Cell Sei 1993;
104:219-25.
93. Cardenas ME, Dang Q, Glover CV, Gasser SM. Casein kinase II phosphorylates the eukaryote-specific C-terminal domain of topoisomerase II in vivo. EMBO J 1992; 11:178596.
94. Boege F, Gieseler F, Biersack H, Meyer P. Different functional states of topoisomerase II can be discriminated by orthovanadate sensitivity in multi-drug resistant human leukemic cells. Leuk Lymphoma 1993; 381—3.
95. Drake FH, Hofmann GA, Bartus HF, Mattern MR, Crooke
ST, Mirabelli CK. Biochemical and pharmacological properties of pi 70 and pi 80 forms of topoisomerase II. Biochemistry 1989; 28:8154-60.
96. Boege F, Andersen A, Jensen S, Zeidler R, Kreipe H. Proliferation-associated nuclear antigen Ki-Sl is identical with topoisomerase Ilalpha. Delineation of a carboxyterminal epitope with peptide antibodies. Am J Pathol 1995; 146:1302-8.
97. Wrigth WD, Roti RJ. Resolution of DNA topoisomerase II
by two-dimensional polyacrylamide gel electrophoresis and
western blotting. Anal Biochem 1992; 204:124-30.
98. Dean FB, Cozzarelli NR. Mechanism of strand passage by
Escherichia coli topoisomerase I. J Biol Chem 1985;
260:4984-94.
99. Brown PO, Cozzarelli NR. Catenation and knotting of duplex
DNA by type I topoisomerases: a mechanistic parallel with
type 2 topoisomerases. Proc Natl Acad Sei USA 1981;
78:843-7.
100. Osheroff N, Shelton ER, Brutlage DL. DNA topoisomerase
II from Drosophila melanogaster. Relaxation of supercoiled
DNA. J Biol Chem 1983: 258:9536-43.
101. Andrea JE, Adachi K, Morgan AR. Fluorometric assays for
DNA topoisomerases and topoisomerase-targeted drugs:
quantitation of catalytic activity and DNA cleavage. Mol
Pharmacol 1991; 40:495-501.
102. Onishi Y, Azuma Y, Kizaki H. An assay method for DNA
topoisomerase activity based on separation of relaxed DNA
from supercoiled DNA using high-performance liquid chromatography. Anal Biochem 1993; 210:63-8.
103. Hsieh T. Knotting of the circular duplex DNA by type II
DNA topoisomerase from Drosophila melanogaster. J Biol
Chem 1983; 258:8413-20.
104. Liu LF, Davis JL, Calendar R. Novel topologically knotted
DNA topoisomerases. Nucleic Acids Res 1981; 9:3979-89.
105. Hofmann GA, Mirabelli CK, Drake FH. Quantitative adaptation of the bacteriophage P4 DNA unknotting assay for use
in the biochemical and pharmacological characterization of
topoisomerase II. Anticancer Drug Res 1990; 5:273-82.
106. Marini JC, Miller KG, Englund PT. Decatenation of kinetoplast DNA by topoisomerases. J Biol Chem 1980;
255:4976-9.
107. Sahai BM, Kaplan JG. A quantitative decatenation assay for
type II topoisomerases. Anal Biochem 1986; 156:364-79.
108. Christiansen K, Svejstrup AB, Andersen AH, Westergaard O.
Eukaryotic topoisomerase I-mediated cleavage requires bipartite DNA interaction. Cleavage of DNA substrates containing strand interruptions implicates a role for topoisomerase I in illegitimate recombination. J Biol Chem 1993;
268:9690-701.
Boege: Analysis of DNA topoisornerases and topoisomerase-directed drug effects
109. Svejstrup JQ, Christiansen K, Gromova II, Andersen AH,
Westergaard O. New technique for uncoupling the cleavage
and religation reactions of eukaryotic topoisomerase 1. The
mode of action of camptothecin at a specific recognition site.
JMol Biol 1991; 222:669-78.
110. Busk H, Thomsen B, Bonven BJ, Kjeldsen E, Nielsen OF,
Westergaard O. Preferential relaxation of supercoiled DNA
containing a hexadecameric recognition sequence for topoisomerase 1. Nature 1987; 327:638-40.
111. Svejstrup JQ, Christiansen K, Andersen AH, Lund K, Westergaard 0. Minimal DNA duplex requirements for topoisomerase 1-mediated cleavage in vitro. J Biol Chem 1990;
265:12529-35.
112. Elsea SH, Osheroff N, Nitiss JL. Cytotoxicity of quinolones
toward eukaryotic cells. Identification of topoisomerase II as
the primary cellular target for the quinolone CP-115,953 in
yeast. J Biol Chem 1992; 267:13150-3.
113. D'Arpa P, Liu LF. Topoisomerase-targeting antitumor drugs.
Biochim Biophys Acta 1989; 989:163-77.
114. Constantinou A, Mehta R, Runyan C, Rao K, Vaughan A,
Moon R. Flavonoids as DNA topoisomerase antagonists and
poisons: structure-activity relationships. J Nat Prod 1995;
58:217-25.
115. Yamashita Y, Kawada S, Nakano H. Induction of mammalian
topoisomerase II dependent DNA cleavage by nonintercalative flavonoids, genistein and orobol. Biochem Pharmacol
1990; 39:737-44.
116. Rowinsky EK, Grochow LB, Hendricks CB, Ettinger DS,
Forastiere AA, Hurowitz LA, el al. Phase I and pharmacologic study of topotecan: a novel topoisomerase I inhibitor. J
Clin Oncol 1992; 10:647-56.
117. Grochow LB, Rowinsky EK, Johnson R, Ludeman S, Kaufmann SH, McCabe FL, et al. Pharmacokinetics and pharmacodynamics of topotecan in patients with advanced cancer.
Drug Metab Dispos Biol Fate Chem 1992; 20:706-13.
118. Hsiang Y-H, Hertzberg R, Hecht S, Liu LF. Camptothecin
induces protein-linked DNA breaks via mammalian DNA topoisomerase I. J Biol Chem 1985; 260:14873-8.
119. Hsiang Y-H, Liu LF. Identification of mammalian topoisomerase I as an intracellular target of the anticancer drug camptothecin. Cancer Res 1988; 48:1722-6.
120. Hsiang Y-H, Lihou MG, Liu LF. Arrest of replication forks
by drug-stabilized topoisomerase I-DNA cleavable complexes
as mechanism of cell killing by camptothecin. Cancer Res
1989; 49:5077-82.
121. Austin CA, Patel S, Ono K, Nakane H, Fisher LM. Site-specific DNA cleavage by mammalian DNA topoisomerase II
induced by novel flavone and catechin derivatives. Biochem
J 1992; 282:883-9.
122. Okura A, Arakawa H, Oka H, Yoshinari T, Monden Y. Effect
of genistein on topoisomerase activity and on the growth of
[Val 12]Ha-ras-transformedNIH 3T3 cells. Biochem Biophys
Res Commun 1988; 157:183-9.
123. Boege F, Sträub T, Kehr A, Boesenberg C, Christiansen K,
Andersen A, et al. Selected novel flavones inhibit the DNAbinding or the DNA-religation step of eukaryotic topoisomerase I. J Biol Chem 1996; 271:2262-70.
124. Yamashita Y, Saitoh Y, Ando K, Takahashi K, Ohno H, Nakano H. Saintopin, a new antitumor antibiotic with topoisomerase II dependent DNA cleavage activity, from Paecilomyces [letter]. J Antibiot (Tokyo) 1990; 43:1344-6.
125. Yamashita Y, Kawada S, Fujii N, Nakano H. Induction of
mammalian DNA topoisomerase I and II mediated DNA
cleavage by saintopin, a new antitumor agent from fungus.
Biochemistry 1991; 30:5838-45.
126. Riou JF, Fosse P, Nguyen CH, Larsen AK, Bissery MC,
Grondard L, et al. Intoplicine (RP 60475) and its derivatives,
a new class of antitumor agents inhibiting both topoisomerase
I and II activities. Cancer Res 1993; 53:5987-93.
127. Kjeldsen E, Svejstrup JQ, Gromova II, Aisner J, Westergaard
O. Camptothecin inhibits both the cleavage and religation reaction of eukaryotic DNA topoisomerase I. J Mol Biol 1992;
228:1025-30.
128. Poddevin B, Riou JF, Lavelle F, Pommier Y. Dual topoisomerase I and II inhibition by intoplicine (RP-60475), a new
129.
130.
131.
132.
133.
134.
135.
136.
137.
138.
139.
140.
141.
142.
143.
144.
145.
146.
147.
148.
887
antitumor agent in early clinical trials. Mol Pharmacol 1993;
44:767-74.
Bissery MC, Nguyen CH, Bisagni E, Vrignaud P, Lavelle F.
Antitumor activity of intoplicine (RP 60475, NSC 645008),
a new benzo-pyrido-indole: evaluation against solid tumors
and leukemias in mice. Invest New Drugs 1993; 11:263 — 77.
Hecht SM, Berry DE, Mac KL, Busby RW, Nasuti CA. A
strategy for identifying novel, mechanistically unique inhibitors of topoisomerase I. J Nat Prod 1992; 55:401-13.
Sorensen BS, Jensen PB, Sehested M, Jensen PS, Kjeldsen
E, Nielsen OF, et al. Antagonistic effect of aclarubicin on
camptothecin induced cytotoxicity: role of topoisomerase I.
Biochem Pharmacol 1994; 47:2105-10.
Li CJ, Averboukh L, Pardee AB. ß-Lapachone, a novel DNA
topoisomerase I inhibitor with a mode of action different
from camptothecin. J Biol Chem 1993; 268:22463-8.
Li CJ, Zhang LJ, Dezube BJ, Crumpacker CS, Pardee AB.
Three inhibitors of type I human immunodeficiency virus
long terminal repeat-directed gene expression and virus replication. Proc Natl Acad Sei USA 1993; 90:1839-42.
Boothman DA. Enhanced malignant transformation is accompanied by increased survival recovery after ionizing radiation
in Chinese hamster embryo fibroblasts. Radiat Res 1994;
138:sl21-5.
Degrassi F, De SR, Berthella L. The production of chromosomal alterations by beta-lapachone, an activator of topoisomerase I. Mutat Res 1993; 288:263-7.
Pommier Y, Kohlhagen G, Kohn K, Leteutre F, Wani M, Wall
M. Interaction of an alkylating camptothecan derivative with
a DNA base at topoisomerase I-DNA cleavage sites. Proc
Natl Acad Sei USA 1995; 92:8861-5.
Kjeldsen E, Mollerup S, Thomsen B, Bonven B, Bolund L,
Westergaard O. Sequence-dependent effect of camptothecin
on human topoisomerase I DNA cleavage, J Mol Biol 1988;
202:333-42.
Liu LF, Rowe TC, Yang L, Tewey KM, Chen GL. Cleavage
of DNA by mammalian DNA topoisomerase II. J Biol Chem
1983; 258:15365-70.
Kohen R, Szyf M, Chevion M. Quantitation of single- and
double-strand DNA breaks in vitro and in vivo. Anal Biochem 1986; 154:485-91.
Kohn KW, Ewig RAG, Erickson LC, Zwelling LA. Measurement of strand breaks and cross-links by alkaline elution. In:
Friedberg EC, Hanawalt PC, editors. DNA repair: a laboratory manual of research techniques. New York: Marcel Dekker, 1981:379-401.
Pommier Y, Kerrigan D, Schwartz RE, Swack JA, McCurdy
A. Altered DNA topoisomerase II activity in Chinese hamster
cells resistant to topoisomerase II inhibitors. Cancer Res
1986; 46:3075-81.
Baker SD, Wadkins RM, Stewart CF, Beck WT, Danks MK.
Cell cycle analysis of amount and distribution of nuclear
DNA topoisomerase I as determined by fluorescence digital
imaging microscopy. Cytometry 1995; 19:134—45.
Kaufmann SH. Antagonism between camptothecin and topoisomerase II-directed chemotherapeutic agents in a human
leukemia cell line. Cancer Res 1991; 51:1129-36.
Subramanian D, Kraut E, Staubus A, Young DC, Muller MT.
Analysis of topoisomerase I/DNA complexes in patients administered topotecan. Cancer Res 1995; 55:2097-103.
Nabiev I, Chourpa I, Riou JF, Nguyen CH, Lavelle F, Manfait
M. Molecular interactions of DNA-topoisomerase I and II
inhibitor with DNA and topoisomerases and in ternary complexes: binding modes and biological effects for intoplicine
derivatives. Biochemistry 1994; 33:9013-23.
Wassermann K, Markovits J, Jaxel C, Capranico G, Kohn
KW, Pommier Y. Effects of morpholinyl doxorubicins, doxorubicin, and actinomycin D on mammalian DNA topoisomerases I and II. Mol Pharmacol 1990; 38:38-45.
Darby MK, Schmitt B, Jongstra BJ, Vosberg HP. Imbibition
of calf thymus type II DNA topoisomerase by poly(ADPribosylation). EMBO J 1985; 4:2129-34.
Ferro AM, Higgins NP, Oliva BM. Poly(ADP-ribosylation)
of a DNA topoisomerase. J Biol Chem 1983; 258:6000-3.
Boege: Analysis of DNA topoisornerases and topoisomerase-directed drug effects
149. Krupitza G, Cerutti P. ADP-ribosylation of ADPR-transferase
and topoisomerase 1 in intact mouse epidermal cells JB6. Biochemistry 1989; 28:2034-40.
150. Bjornsti MA, Benedetti P, Viglianti G A, Wang JC. Expression of human DNA topoisomerase I in yeast cells lacking
DNA topoisomerase I: restoration of sensitivity of the cells
to the antitumor drug camptothecin. Cancer Res 1989;
49:6318-23.
151. Jensen PB, Jensen PS, Demant EJ, Friche E, Sorensen BS,
Sehested M, et al. Antagonistic effect of aclarubicin on daunorubicin-induced cytotoxicity in human small cell lung cancer cells: relationship to DNA integrity and topoisomerase II.
Cancer Res 1991; 5 1:5093-9.
152. Kreipe H, Aim P, Olsson H, Hauberg M, Fischer L, Parwaresch R. Prognostic significance of a formalin-resistant
nuclear proliferation antigen in mammary carcinomas as determined by the monoclonal antibody Ki-Sl. Am J Pathol
1993; 142:651-7.
153. Doussis-Anagnostopoulou I, Garrido M, Heryet A, Cordeil J,
Gerdes J, Kreipe H, et al. Proliferation in Hodgkin's disease:
a study using three fixation-resistant markers. Diagn Oncol
1993: 3:302-6.
154. Camplejohn RS, Brock A, Barnes DM, Gillett C, Raikundalia
B, Kreipe H, et al. Ki-Sl, a novel proliferative marker: flow
cytometric assessment of staining in human breast carcinoma
cells. Br J Cancer 1993; 67:657-62.
155. Sampson SA, Kreipe H, Gillett CE, Smith P, Chaudary MA,
Khan A, et al. KiSl - a novel monoclonal antibody which
recognizes proliferating cells: evaluation of its relationship to
prognosis in mammary carcinoma. J Pathol 1992;
168:179-85.
156. Thiele J, Bertsch HP, Kracht L, Anwander T, Zimmer J,
Kreipe H, et al. Ki-Sl and PCNA expression in erythroid
precursors and megakaryocytes - a comparative study on
proliferative and endoreduplicative activity in reactive and
neoplastic bone marrow lesions. J Pathol 1994; 173:5-12.
157. Höchster H, Liebes L, Sorich J, Taubes B, Kim T, Fry M, et
al. Increasing cleavable complex ,formation in peripheral
blood lymphocytes with increasing topotecan infusion duration — rationale for prolonged administration of camptothecins. Proceedings of the sixth conference on topoisomerases
in therapy. Amsterdam 1995:Abstr. 88.
Received January 29/September 6, 1996
Corresponding author: PD Dr. med. Fritz Boege, Hauptlabor der
Medizinischen Poliklinik der Universität Würzburg, Klinikstraße
6-8, D-97070 Würzburg, Germany