Download Anti-HIV-1 activity of Trim 37

Journal of General Virology (2014), 95, 960–967
DOI 10.1099/vir.0.057653-0
Anti-HIV-1 activity of Trim 37
Azah A. Tabah,1,2 Keith Tardif33 and Louis M. Mansky1,2,4
Correspondence
1
Louis M. Mansky
2
[email protected]
Institute for Molecular Virology, University of Minnesota, Minneapolis, MN 55455; USA
MinnCResT Program, Department of Diagnostic and Biological Sciences, School of Dentistry,
University of Minnesota, Minneapolis, MN 55455; USA
3
Myriad Pharmaceuticals, Salt Lake City, UT 84108, USA
4
Department of Microbiology, University of Minnesota, Minneapolis, MN 55455; USA
Received 29 July 2013
Accepted 28 November 2013
Trim 5a was the first member of the tripartite motif (TRIM) family of proteins that was identified to
potently restrict human immunodeficiency virus type 1 (HIV-1) replication. The breadth of
antiretroviral activity of TRIM family members is an active area of investigation. In this study, we
demonstrate that human Trim 37 possesses anti-HIV-1 activity. This antiretroviral activity and the
manner in which it was displayed were implicated by (1) decreased viral replication upon Trim 37
transient overexpression in virus-producing cells, (2) correlation of the reduction of viral infectivity
with Trim 37 virion incorporation, (3) increased HIV-1 replication during siRNA depletion of Trim
37 expression, and (4) reduction in viral DNA synthesis upon Trim 37 transient overexpression.
Our findings provide the first demonstration, to our knowledge, of the potent antiviral activity of
human Trim 37, and implicate an antiviral mechanism whereby Trim 37 interferes with viral DNA
synthesis.
INTRODUCTION
Eukaryote cells have evolved specific host cell proteins to
limit pathogen attack by providing immunity to infection
(Bieniasz, 2004; Goff, 2007; Towers & Goff, 2003). For
retroviruses, a long studied host cell protein is the murine
Fv1 protein, which is derived from an endogenous retroviral gag sequence (Best et al., 1996). Fv1 targets incoming
murine leukaemia virus (MLV) capsids and blocks infection after viral DNA synthesis (Jolicoeur & Rassart, 1980).
One family of host cell proteins whose members have been
studied in the context of human immunodeficiency virus
type 1 (HIV-1) infection is the tripartite motif (Trim)
family (Trkola, 2004; Zhang et al., 2011). All members
of the Trim family contain three N-terminal domains –
RING, B-box and coiled-coil (Reymond et al., 2001).
Additionally, nearly all members contain one or more
variable domains in their C terminus.
Several family-wide screens have been conducted on
the antiviral activities of mammalian Trim proteins
(Carthagena et al., 2009; Uchil et al., 2008). These screens
have revealed that many members of the Trim family
have conserved antiviral activity, especially those family
members that contain a SPRY domain as their fourth
C-terminal domain (Carthagena et al., 2009; Uchil
et al., 2008), for example, Trim 11, Trim 15 and Trim 22
(Kajaste-Rudnitski et al., 2011; Uchil et al., 2008). The
3Present address: ARUP Laboratories, 500 Chipeta Way, Salt Lake City,
UT 84108-1221, USA.
960
prototypical SPRY-containing Trim family member that
has been shown to have anti-HIV-1 activity is Trim 5a.
Recent studies have reported that Trim 5a causes an early
block in HIV-1 replication that occurs at or before the
initiation of reverse transcription (RT) (Keckesova et al.,
2004; Stremlau et al., 2004). Notably, it was demonstrated
that the presence of rhesus Trim 5a leads to a reduction in
the amount of late RT (LRT) products, and that Trim 5a
associates with retroviral capsids through its SPRY domain
(Stremlau et al., 2004; Wu et al., 2006). Other studies have
demonstrated that the Trim 5a B-box domain further
stabilizes the SPRY–capsid interaction (Diaz-Griffero et al.,
2007, 2009).
Recently, it was also shown that the linker region between
the coiled-coil and SPRY domains determines Trim 5a
localization to cytoplasmic bodies, and is essential for Trim
5a antiviral activity (Sastri et al., 2010). Taken together
with previous observations, these findings suggest that
multiple domains in Trim 5a are required for and participate in rhesus Trim 5a restriction of HIV-1 replication.
Interestingly, Trim 5a capsid recognition abilities have also
recently been linked to the newly discovered ability of Trim
5a to catalyse the synthesis of unattached K63 ubiquitin
chain, leading to further restriction of HIV-1 infection
(Pertel et al., 2011).
In addition to Trim 5a SPRY-dependent mechanisms of
inhibition of HIV-1 infection, some non-SPRY Trim family
members have also been implicated to have anti-HIV-1
activity (Uchil et al., 2008). In the large antiviral Trim
Downloaded from www.microbiologyresearch.org by
057653 G 2014 SGM
IP: 88.99.165.207
On: Sat, 12 Aug 2017 11:23:30
Printed in Great Britain
In this study, we have found that human Trim 37 – which
contains a TRAF domain as its C-terminal domain (Zapata
et al., 2001) – possesses anti-HIV-1 activity. The anti-HIV1 activity of Trim 37 was observed by its being able to
decrease viral replication upon transient overexpression in
virus-producing cells, but not target cells, and this effect
could be alleviated via depletion of Trim 37 expression by
siRNA. We also found that antiretroviral activity was
associated with the recruitment of Trim 37 into virus
particles and that the reduction in viral infectivity correlated with a reduction in viral DNA synthesis. Together,
these observations provide the first demonstration of the
anti-HIV-1 activity of human Trim 37.
RESULTS
Trim 37 expression and inhibition of HIV-1
replication
Previous studies have suggested that Trim 37 is highly
conserved and was expressed in all tissues tested (Hämäläinen et al., 2006; Kallijärvi et al., 2006). To verify these
reports, we set out to characterize the expression levels of
Trim 37 in a variety of mammalian cell lines in the lab. We
examined protein expression levels of Trim 37 in three cell
lines (293T, HeLa, HepG2) and in stimulated peripheral
blood mononuclear cells (PBMCs) to determine the expression levels of Trim 37 in these cell types. Fig. 1 reveals that
Trim 37 was highly expressed in HepG2 cells. Relative
to HepG2 cells, Trim 37 protein expression was approximately 11-fold lower in 293T cells, fourfold lower in HeLa
cells, and eightfold lower in PBMCs.
Since antiviral activity has been shown for other TRIM
family members, we sought to determine whether Trim 37
influenced HIV-1 replication. Results from a yeast twohybrid screen conducted at Myriad Pharmaceuticals
indicated that Trim 37 interacted with HIV-1 reverse
transcriptase (data not shown), and this further suggested
that Trim 37 may influence HIV-1 replication. To test if
Trim 37 could influence HIV-1 replication, VSV-G
pseudotyped HIV-1 was produced from 293T cells in the
presence of varying amounts of Trim 37. The resulting viral
supernatants were normalized for p24 levels, and used to
infect HeLa target cells; infected cells were identified by
green fluorescent protein (GFP) expression. Fig. 2(a, b)
shows that viral infectivity decreases as expression of Trim
37 increases in a dose-dependent manner, though transfection of 10 mg of the Trim 37 expression plasmid into 293T
cells did not further decrease viral infectivity beyond that
observed by transfection of 5 mg of the Trim 37 expression
http://vir.sgmjournals.org
PB
M
C
H
ep
family member screen performed by Uchil and colleagues,
Trim 31, which lacks both a coiled-coil and a C-terminal
domain, was found to inhibit HIV-1 entry (Uchil et al.,
2008). Furthermore, Trim 32, which contains an NHL
C-terminal domain, inhibits HIV-1 long terminal repeat
transcription (Fridell et al., 1995).
G
2
29
3T
H
eL
a
Anti-HIV-1 activity of Trim 37
Trim 37
Tubulin
Fig. 1. Endogenous levels of Trim 37 in cell lines. Levels of
endogenous Trim 37 in the HepG2, 293T and HeLa cell lines and
PBMCs. PBMCs were stimulated with phytohaemagglutinin for
72 h followed by treatment with interleukin-2 for an additional
72 h. Cell lysates were prepared and Trim 37 and gamma-tubulin
protein expression was analysed by immunoblotting.
plasmid (Fig. 2b). This suggests that diminution of virus
infectivity by Trim 37 expression in 293T may have a
saturation limit beyond which no further reduction of
virus infectivity can be observed. Our results demonstrate
that at the highest level of transfected Trim 37 plasmid,
Trim 37 reduced HIV-1 infectivity by approximately 10fold compared with virus produced in its absence as
assessed in HeLa cells (Fig. 2a). We confirmed by RT-PCR
that the increase in Trim 37 mRNA levels correlated with
the amount of the Trim 37 plasmid transiently transfected
into 293T cells (Fig. 2c).
The transient expression of Trim 37 in 293T cells was
observed to be lower than Trim 37 expression in HepG2
cells (Fig. 2d), indicating that the transient expression is
within levels observed in other cell types. Infection of HeLa
target cells with HIV-1 vector virus produced from HepG2
resulted in elimination of virus infectivity, indicating that
saturation of the ability to reduce virus infectivity by higher
Trim 37 expression levels observed in 293T cells (i.e. 5 mg
to 10 mg, Fig. 2b) was not apparent in HepG2 cells, as Trim
37 expression levels in these cells correlated with the
elimination virus infectivity (Fig. 2d). Taken together,
these observations suggest cell type differences in the ability
of Trim 37 to diminish virus infectivity (e.g. differential
ability of Trim 37 to associate with viral protein(s) and
assemble into virus particles at increasing Trim 37
expression levels).
We next tested the ability of Trim 37 expression in target
cells to block HIV-1 infectivity. To do this, Trim 37 was
transiently expressed in HeLa target cells, and 48 h posttransfection cell culture supernatants containing HIV-1
vector virus were used to infect HeLa cells. As indicated in
Fig. 2(e), viral infectivity of HeLa cells transiently
transfected with the highest amount (10 mg) of Trim 37
was indistinguishable from that observed in target cells
that were mock transfected with empty vector. Parallel
experiments performed with 0.5 mg or 5 mg Trim 37 also
revealed no differences in HIV-1 infectivity. These
observations indicate that the expression of Trim 37 in
producer cells, but not in target cells, significantly reduces
HIV-1 infectivity.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 12 Aug 2017 11:23:30
961
A. A. Tabah, K. Tardif and L. M. Mansky
(b)
0 mg Trim 37
0.5 mg Trim 37
5 mg Trim 37
10 mg Trim 37
30
20
6
% Cells infected
% Cells infected
(a) 40
10
4
2
0
0
0
10
20
40
80
0
0.5
5
10
Trim 37 expression plasmid (mg)
Virus (ml)
(d) 30
40
293T HepG2
% Cells infected
Relative Trim 37 expression
(c)
30
20
10
0
Tubulin
10
0
0
0.5
5
10
Trim 37 expression plasmid (mg)
(e) 25
% Cells infected
Trim 37
20
293T
293T
HepG2
+
Trim 37 (10 mg)
0 mg Trim 37
0.5 mg Trim 37
5 mg Trim 37
10 mg Trim 37
20
15
10
5
0
0
10
20
40
80
Virus (ml)
Fig. 2. Trim 37 expression impairs HIV-1 infectivity when expressed in virus-producing cells. 293T cells were co-transfected
with an env-minus HIV-1 vector expressing the mouse HSA and GFP, pHIG, and a VSV-G expression plasmid, pCMV-G, along
with a Trim 37 expression construct, pTrim37. Forty-eight hours post-transfection, cell culture supernatants were harvested and
used to infect HeLa target cells. (a) Viral infectivity was determined by flow cytometry. (b) The graph represents a quantification
of the results in (a). (c) RNA extracts were prepared from 293T cells from experiments shown in panel (a) and were analysed by
quantitative RT-PCR using Trim 37-specific primers. (d) Comparison of reduction of HIV-1 infectivity when HIV-1 vector virus
was produced from 293T cells co-transfected with pHIG, pCMV-G and pTrim37 (10 mg) or from HepG2 cells (which
endogenously express high levels of Trim 37) co-transfected with pHIG and pCMV-G and used to infect HeLa target cells. (e)
Transient expression of Trim 37 in target cells does not affect HIV-1 infectivity. HeLa target cells were transiently transfected
with the Trim 37 expression plasmid (0, 0.5, 5 or 10 mg) for 48 h and then infected with HIV-1 vector virus. Viral infectivity was
determined by flow cytometry as described in Methods. All results are presented as the mean±SD from three independent
experiments performed in triplicate.
Targeted depletion of endogenous Trim 37 levels
increases infectivity
To help exclude the possibility that the antiviral effect of
Trim 37 we observed was an artefact of transient Trim
37 expression, we examined the effects of depleting
endogenous Trim 37 on infectivity using siRNAs directed
962
against Trim 37 (Fig. 3). Since overexpression of Trim
37 decreases infectivity of HIV-1, we hypothesized that
depletion of Trim 37 with siRNA would increase viral
infectivity. To examine the ability of Trim 37 siRNA to
decrease Trim 37 expression, qPCR was performed 48 h
after 293T cells were transiently transfected with Trim 37
siRNA. The results shown in Fig. 3(a) demonstrate that
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 12 Aug 2017 11:23:30
Journal of General Virology 95
Anti-HIV-1 activity of Trim 37
siRNA treatment decreased Trim 37 mRNA levels by 35 %.
This reduction led to a 2.5-fold increase in virus infectivity
compared with virus produced in the presence of a control,
scrambled siRNA (Fig. 3b).
Since we were not able to fully knockdown endogenous
Trim 37 gene expression in 293T cells, we further investigated the nature of the Trim 37 gene locus. The Trim 37
gene locus encodes two transcript variants, TV1 and TV2,
which lead to the production of the same protein product.
We used qPCR to detect transcript variant-specific mRNA
expression of Trim 37 in a variety of cell lines (e.g. Bat1,
HepG2, 293T, CrFK, MagiU373, Cos1, Vero and HeLa)
and detected expression of both transcript variants of
Trim 37 in all cell lines (data not shown). These findings
are somewhat contrary to previous reports which indicated
that only Trim 37 TV1 was expressed in all human and
mouse cell types examined, with the exception of testis,
which expressed both TV1 and TV2 (Kallijärvi et al., 2006).
The 39 untranslated region (39UTR) of Trim 37 TV2
overlaps with the 39UTR of a neighbouring gene, PPM1E,
in humans and other species. PPM1E can be amplified
from these cell lines, suggesting that mRNA hybridization
between Trim 37 and PPM1E could occur. The physiological relevance of the Trim 37 and PPM1E overlap has
not been determined (Kallijärvi et al., 2006). The inability
to knockdown PPM1E gene expression using shRNA has
recently been reported (Voss et al., 2011), providing further
indication of the difficulties in using interfering technologies to reduce gene expression in this region.
Investigation of Trim 37 incorporation into HIV-1
particles
We next tested if Trim 37 could be incorporated into
HIV-1-like particles produced from an HIV-1 Gag-only
expression construct. To do this, the Gag-only expression
construct was co-transfected with varying amounts of
Trim 37 into 293T cells. Particles released into cell culture
supernatants were analysed by immuoblot (Fig. 4c). Gag
incorporation into particles was not affected by Trim 37
co-expression (Fig. 4c). Trim 37, however, was not detected
in the virus particles, although both Trim 37 and Gag were
detected in cell lysates. These data suggest that the viral
protein determinants required for Trim 37 incorporation
into particles involve an HIV-1 protein other than Gag.
Analysis of viral DNA synthesis in infected cells
(a) 1.5
(b) 4
Fold increase in infectivity
To determine if Trim 37 influences the levels of viral DNA
synthesis, quantitative real-time PCR was used to detect
RT intermediates from infected target cells. HeLa cells
were infected with HIV-1 p24 capsid-equivalent amounts
of virus. RT products were detected from 4 to 24 h postinfection and the absolute quantities synthesized were
determined by a standard curve. Fig. 5(a) demonstrates a
Relative Trim 37 expression
To determine whether Trim 37 was packaged into HIV-1
particles, we analysed Trim 37 virion incorporation into an
HIV-1 vector, pHIG. Seventy-two hours post-transfection
of 293T cells with Trim 37 and pHIG, cell culture supernatants were collected and virus particles were purified by
ultracentrifugation through a 20 % sucrose cushion. The
particles were lysed, subjected to SDS-PAGE, and analysed
for Trim 37 incorporation. As shown in Fig. 4(a), the
130 kDa Trim 37 protein was readily detected when Trim
37 was co-transfected into cells. The amount of Trim 37
co-transfected did not significantly affect the amount
of HIV-1 Gag incorporated into virus particles or the
efficiency of virus particle production (Fig. 4a, bottom
panel). This indicates that Trim 37 was incorporated into
virus particles in a dose-dependent manner (Fig. 4a, b).
1.0
*
0.5
0
Scrambled
siRNA
Trim 37
siRNA
*
3
2
1
0
Scrambled
siRNA
Trim 37
siRNA
Fig. 3. siRNA depletion of Trim 37 enhances HIV-1 infectivity. (a) Reduction of Trim 37 expression by Trim 37-directed siRNA.
293T cells were transduced with scrambled or Trim 37-specific siRNA. Twenty-four hours post-transfection, cells were lysed
and RNAs extracted for PCR analysis. (b) Increase in HIV-1 infectivity by siRNA depletion of Trim 37. 293T cells were
transfected with siRNAs. Twenty-four hours post-transfection, cells were subsequently transfected with pHIG and pCMV-G.
Forty-eight hours post-transfection, cell culture supernatants were collected, filtered and used to infect permissive HeLa target
cells. The data represent the mean±SD from at least three independent experiments. *Statistical significance (P,0.05).
http://vir.sgmjournals.org
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 12 Aug 2017 11:23:30
963
A. A. Tabah, K. Tardif and L. M. Mansky
0
0.5
5
10
(b) 250
Relative Trim 37 incorporated
(a) Trim 37 (mg)
Trim 37
p55Gag
p24
200
150
100
50
0
0
0.5
5
10
Trim 37 (mg)
(c)
VIP
0
0.5
5
Cellular
10
0
0.5
5
10
Trim 37 (mg)
Gag
Trim 37
Fig. 4. Trim 37 is incorporated into HIV-1 particles. (a) Immunoblot analysis of virus particles. 293T cells were transfected with
pHIG and pCMV-G in the presence of the indicated amounts of pTrim37. Forty-eight hours post-transfection, cell culture
supernatants were harvested and virus particles were pelleted through a sucrose cushion. The viral particle pellets were
resuspended, lysed and subjected to SDS-PAGE. Immunoblot analysis was done using antibodies directed against Trim 37
and p24 Gag. (b) Relative amounts of Trim 37 incorporated into HIV-1 particles. Error bars indicate SD. (c) 293T cells were cotransfected with human codon optimized gag and the expression plasmid for Trim 37. Forty-eight hours post-transfection, cell
culture supernatants and cells were harvested. The virus-like particle pellets or cells were resuspended, lysed and subjected to
SDS-PAGE. Immunoblot analysis was done using antibodies directed against Gag and Trim 37.
2- to 18-fold reduction in the synthesis of minus-strand
strong stop (SS) DNA when using virus produced in the
presence of varying levels of Trim 37. The initial amount of
minus-strand DNA detected at 4 h did not increase over
time, suggesting some viral DNA synthesis was initiated,
albeit at low levels. The synthesis of late RT products was,
like the early RT products, at low levels (Fig. 5b). These
observations suggest that the presence of Trim 37 is associated with a severe inhibition of viral DNA synthesis, but
that a low level of viral DNA synthesis occurred prior to
full establishment of the Trim 37 antiviral effect.
DISCUSSION
This study has identified the human Trim 37 protein as
possessing anti-HIV-1 activity. The anti-HIV-1 activity
of human Trim 37 was implicated by (1) decreased viral
replication upon Trim 37 transient overexpression in
virus-producing cells, (2) correlation of the reduction of
viral infectivity with Trim 37 virion incorporation, (3)
increased HIV-1 replication during siRNA depletion of
Trim 37 expression, and (4) reduction in viral DNA
synthesis upon Trim 37 transient overexpression.
One potential mechanism to explain the anti-HIV-1
activity of Trim 37 is that viral DNA synthesis is perturbed
964
by interaction between Trim 37 and RT. The lack of Trim
37 incorporation with Gag-only virus-like particles provides an indication that a viral protein(s) other than Gag
was required for Trim 37 virion incorporation. It is
formally possible that Trim 37 causes premature uncoating.
Rhesus Trim 5a is thought to cause a reduction in viral
DNA products. The SPRY-domain-containing rhesus Trim
5a is rapidly degraded after exposure to HIV-1 capsids, but
this degradation can be blocked by proteasomal inhibition
(Rold & Aiken, 2008). Several groups have confirmed that
proteasomal inhibition does not result in a relief of the
block of HIV-1 infectivity, although it does result in an
increase in viral DNA products (Perez-Caballero et al.,
2005; Stremlau et al., 2006; Wu et al., 2006).
Our evidence of the anti-HIV-1 activity of Trim 37 was not
predicted from a family-wide Trim screen for anti-HIV
activity (Uchil et al., 2008). In these studies, it was found
that human Trim 37 did not inhibit HIV or MLV entry
when target cells were transfected with Trim 37 plasmid,
then challenged with MLV or HIV-1 virus pseudotyped
with ALV-A 30 h later. This experimental design parallels
our experiments with target cells (see Fig. 2e), and corroborates our findings that Trim 37 does not exert a target
cell effect. This observation provides one line of evidence
that the HIV-1 capsid protects RT, and why target cell
Trim 37 does not affect viral replication. However, it is
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 12 Aug 2017 11:23:30
Journal of General Virology 95
(a)
0 mg Trim 37
0.5 mg Trim 37
5 mg Trim 37
10 mg Trim 37
Relative expression minus-strand strong stop
6
5
4
3
2
1
45
40
0 mg Trim 37
0.5 mg Trim 37
5 mg Trim 37
10 mg Trim 37
35
30
25
20
15
10
5
0
0
4
–1
(b)
Relative expression late RT product
Anti-HIV-1 activity of Trim 37
8
12
24
4
8
12
24
Time (h)
Time (h)
Fig. 5. Incorporation of Trim 37 impairs viral DNA synthesis. 293T cells were co-transfected with pHIG and pCMV-G alone
(control) or with pTrim37. Cell culture supernatants were collected at 48 h post-transfection, filtered and used to infect
permissive HeLa target cells. Cells were harvested at 4, 8, 12 and 24 h post-infection for qPCR analysis. (a) Early RT products
(i.e. minus-strand SS DNA). (b) LRT products. The data are the mean±SD from experiments done in triplicate.
possible that no target cell effect was observed due to the
lack of stable Trim 37 expression in target cells.
Like rhesus Trim 5a, Trim 37 exerts its antiviral activity in
the early phase of HIV-1 replication. However, our data
indicate that Trim 37 has an antiviral mechanism that
is distinct from that of rhesus Trim 5a. Trim 37 was
incorporated into HIV-1 particles and its expression
severely diminished viral DNA synthesis. While Trim 5a
interacts with the HIV-1 capsid through its SPRY domain,
Trim 37, however, lacks a SPRY domain. For its variable
C-terminal domain, Trim 37 contains a TRAF, also referred
to as a MATH motif (Lehesjoki et al., 2001). While siRNA
depletion of Trim 37 resulted in only a modest reduction
(,50 %), virus infectivity increased by 2.5-fold. This could
be indicative of a critical threshold of Trim 37 expression
needed in order to see an effect on HIV-1 infectivity.
The evolutionary conservation of the Trim family suggests
that the antiviral properties of human Trim 37 could apply
to other retroviruses. It is therefore plausible that Trim 37
from other species could be more potent in the inhibition
of HIV-1 replication. Comparative studies should be useful
in determining the molecular mechanism for the perturbation of viral DNA synthesis and the anti-HIV-1 mechanism
of Trim 37.
entry site and the enhanced green fluorescence protein (EGFP) gene,
which was cloned into the nef gene. This vector does not express the
envelope protein due to a 59 frame shift mutation in the envelope
gene. A Trim 37 expression plasmid previously described (Avela
et al., 2000) was generously provided by Dr Anna-Elina Lehesjoki
(University of Helsinki, Finland). A vector that encodes the vesicular
stomatitis virus glycoprotein (pCMV-VSV-G) was used to pseudotype the HIV-1 vector for production of virus. An HIV-1 Gag-only
expression vector, pHIVGag, was constructed by codon optimization
of the HIV-1 Gag gene sequence.
Single-round replication assays. Vector virus stocks for single-
round HIV-1 infectivity assays were produced by DNA transfection of
293T cells or HepG2 cells. Cells were grown on poly-L-lysine-coated
10 cm dishes, and were transfected using the calcium phosphate DNA
precipitation method. Each 10 cm dish was co-transfected with 10 mg
viral vector (pHIG) and 1 mg p-CMV-VSV-G. To assess effects of
Trim 37 in 293T cells, the vector encoding Trim 37 was co-transfected
at 0.5 mg, 5 mg or 10 mg. Additionally, the levels of plasmid DNA were
normalized for each transfection by adding the appropriate level of an
empty bacterial vector, such that each transfection contained 21 mg
DNA in total. Twenty-four hours after transfection, the medium was
changed, and 20 mM HEPES was added to the culture medium. Cell
culture supernatants from either 293T or HepG2 cells were harvested
48 h post-transfection, filtered through a 0.2 mm filter, and normalized for p24 Gag prior to infection of target cells (Dapp et al., 2009).
Two days post-infection, virus infectivity was assessed by measuring
EGFP fluorescence using flow cytometry.
Trim 37 RNA depletion by siRNA. Downregulation of Trim 37
expression by siRNA was done by transfecting cells with siRNA
against Trim 37 (Invitrogen) using Lipofectamine (Invitrogen)
according to the manufacturer’s instructions.
METHODS
Cell culture and plasmid constructs. The HEK293T, HepG2 and
HeLa cells were maintained in Dulbecco’s modified Eagle’s medium
(GIBCO) supplemented with penicillin and streptomycin and 10 %
fetal clone III serum (Hyclone) at 37 uC in 5 % CO2. The single-cycle
HIV-1 vector, pHIG, contains an expression cassette consisting of the
mouse heat-stable antigen CD24 (HSA) gene, an internal ribosomal
http://vir.sgmjournals.org
Virion incorporation and co-immunoprecipitation assays.
Lysates were prepared from either cells or viral pellets by resuspending the pellets in RIPA buffer (50 mM Tris-HCl pH 7.6, 150 mM
NaCl, 1 % NP-40, 0.5 % deoxycholate (DOC), 0.1 % SDS and 5 mM
EDTA pH 8.0). Viruses were harvested by filtration (0.2 mm) of
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 12 Aug 2017 11:23:30
965
A. A. Tabah, K. Tardif and L. M. Mansky
cell culture supernatants and concentrated by ultracentrifugation
(Beckman 50.2 rotor, 25 000 r.p.m., 2 h). Pellets were dissolved in
RIPA buffer, resuspended in 62.5 mM Tris, 2 % SDS, 5 % (v/v)
glycerol, pH 6.8 and 0.07 % b-mercaptoethanol, and subjected to
denaturing SDS-PAGE. Separated proteins were transferred to a
nitrocellulose membrane, blocked in Tris-buffered saline containing
0.1 % (v/v) Tween-20 (TBS-T) and 5 % skimmed milk powder, and
then probed with either a rabbit anti-Trim 37 antibody (Novus
Biologicals or Bethyl Laboratories), or a rabbit anti-p24 antibody
(Advanced Biotechnologies). Membranes were then incubated with
goat anti-rabbit IgG–HRP secondary antibody conjugates, and the
proteins were visualized by chemiluminescence using the Bio-Rad Gel
Doc (Bio-Rad).
To assess Trim 37 virion incorporation, Trim 37 was detected with a
rabbit anti-Trim 37-specific antibody (Novus Biologicals). The levels
of p24 Gag were used to normalize for equal loading of viral particle
lysates as previously described (Dapp et al., 2009). Briefly, ELISA
plates (96-well) were incubated overnight with a 1 : 1000 rabbit p24
antiserum (AIDS Reagent Program, catalogue no. 4250). The ELISA
plates were then washed with PBS–0.5 % Tween 20 (PBST) and
blocked for 1 h with 3 % milk in PBST. The samples and standards
were prepared by adding a 1 : 1 volume of PBS–0.1 % Empigen
(Sigma-Aldrich) and incubating at 56 uC for 30 min. The samples
were then added to the plate and incubated at 37 uC for 1 h. Wells
were washed with PBST and then incubated with mouse anti-p24
in PBST–1 % milk at 22 uC for 1 h. Incubation was then done with a
horseradish peroxidase conjugated anti-mouse secondary antibody in
PBST–1 % milk for 30 min, and the wells were washed with PBST and
PBS before the addition of the tetramethylbenzidine substrate. The
reactions were stopped by the addition of 1 M sulfuric acid, and the
absorbance was determined at 450 nm.
For experiments requiring co-immunoprecipitation, viral lysates were
incubated with either a monoclonal antibody directed against reverse
transcriptase (no. 11338, NIH AIDS Research Program) or a rabbit
anti-Trim 37 antibody.
Real-time reverse transcriptase PCR. Total RNA was extracted
from 293T or HeLa cells using the RNeasy kit from Qiagen and
cDNA was prepared using SuperScript III Reverse Transcriptase
(Invitrogen). Quantitative PCR was performed in triplicate with 1 ml
cDNA on an ABI Prism 7400 cycler, using Applied Biosystems SYBR
Green master mix. The Trim 37 primer pair was designed to amplify
all transcript variants of human Trim 37 (NM_015294) cDNA:
59-GTCGCGTCTCATGGAACT (forward) and 59-CTACAAGACCGCAACTGGTG (reverse). The primer pairs designed to amplify Trim
37 TV1 only were TGGAAACTGTTGGAAGGTGGCACA (forward)
and GCATTCAGCAAGACATCAGACACGG (reverse). The primer
pairs designed to amplify Trim 37 TV2 only were TGTGACACTGAGAATGAGGAGCAGG (forward) and TGGCCCCAACTATAGTGCCGG (reverse). The primer pairs designed to amplify PPM1E were
TGGAGGTTGCGTAGTCTGGT (forward) and CGGTGTCATAGAAGCCATCAC (reverse). Plasmid DNA encoding Trim 37 was used
as a standard.
with a denaturation step of 10 min at 95 uC followed by 40 cycles
of 15 s at 95 uC, 15 s at annealing temperature of 55 uC and 30 s
amplification at 72 uC. Quantification of DNA products was determined with reference to HIV-1 vector plasmid, which was used as a
standard.
ACKNOWLEDGEMENTS
We thank Lauren Beach and Christine Clouser for reading and
providing constructive comments on the manuscript. We thank the
ProNet group of Myriad Pharmaceuticals for identification of yeast
two-hybrid interactions. We also thank Alana Lehesjoki for providing the Trim 37 expression constructs as well as anti-Trim 37
antibodies. The following reagent was obtained through the NIH
AIDS Research and Reference Reagent program, Division of AIDS,
NIAD, NIH: HIV-1 RT monoclonal antibody (5B2B2) from Dr D.
Helland and Dr A. M. Szilway. This work was supported by NIH
grant GM56615 (L. M. M.). A. A. T. was supported by NIH grant T32
DE07288 (MinnCResT Program).
REFERENCES
Avela, K., Lipsanen-Nyman, M., Idänheimo, N., Seemanová, E.,
Rosengren, S., Mäkelä, T. P., Perheentupa, J., Chapelle, A. D. &
Lehesjoki, A. E. (2000). Gene encoding a new RING-B-box-coiled-
coil protein is mutated in mulibrey nanism. Nat Genet 25, 298–
301.
Best, S., Le Tissier, P., Towers, G. & Stoye, J. P. (1996). Positional
cloning of the mouse retrovirus restriction gene Fv1. Nature 382,
826–829.
Bieniasz, P. D. (2004). Intrinsic immunity: a front-line defense
against viral attack. Nat Immunol 5, 1109–1115.
Carr, J. M., Cheney, K. M., Coolen, C., Davis, A., Shaw, D., Ferguson,
W., Chang, G., Higgins, G., Burrell, C. & Li, P. (2007). Development of
methods for coordinate measurement of total cell-associated and
integrated human immunodeficiency virus type 1 (HIV-1) DNA
forms in routine clinical samples: levels are not associated with
clinical parameters, but low levels of integrated HIV-1 DNA may be
prognostic for continued successful therapy. J Clin Microbiol 45,
1288–1297.
Carthagena, L., Bergamaschi, A., Luna, J. M., David, A., Uchil, P. D.,
Margottin-Goguet, F., Mothes, W., Hazan, U., Transy, C. & other
authors (2009). Human TRIM gene expression in response to
interferons. PLoS ONE 4, e4894.
Dapp, M. J., Clouser, C. L., Patterson, S. & Mansky, L. M. (2009).
5-Azacytidine can induce lethal mutagenesis in human immunodeficiency virus type 1. J Virol 83, 11950–11958.
Diaz-Griffero, F., Kar, A., Lee, M., Stremlau, M., Poeschla, E. &
Sodroski, J. (2007). Comparative requirements for the restriction of
retrovirus infection by TRIM5a and TRIMCyp. Virology 369, 400–
Real-time PCR analysis of viral DNA synthesis. Infected cells
410.
were incubated with DNase-treated virus for 4, 6, 12 or 24 h. DNA
was prepared from the cells by resuspending cell pellets in lysis buffer
(0.1 M Tris pH 8.5, 5 mM EDTA pH 8.0, 200 mM NaCl, 0.2 % SDS
and 2 mg ml21 proteinase K) and incubating at 55 uC overnight.
qPCR analysis of reverse transcriptase products was performed using
1 ml lysate. Samples were then analysed using primer pairs that had
been previously established (Carr et al., 2007) for amplification of
viral SS or LRT DNA products. The following primer pairs were used:
59-CTAACTAGGGAACCCACTGC and 59-CTGCTAGAGATTTTCCACAC (SS DNA), and 59-TGTGTGCCCGTCTGTTGTGT, 59-GAGTCCTGCGTCGAGAGAGC (LRT DNA). PCRs were carried out
Diaz-Griffero, F., Qin, X. R., Hayashi, F., Kigawa, T., Finzi, A., Sarnak,
Z., Lienlaf, M., Yokoyama, S. & Sodroski, J. (2009). A B-box 2 surface
patch important for TRIM5a self-association, capsid binding avidity,
966
and retrovirus restriction. J Virol 83, 10737–10751.
Fridell, R. A., Harding, L. S., Bogerd, H. P. & Cullen, B. R. (1995).
Identification of a novel human zinc finger protein that specifically
interacts with the activation domain of lentiviral Tat proteins.
Virology 209, 347–357.
Goff, S. P. (2007). Host factors exploited by retroviruses. Nat Rev
Microbiol 5, 253–263.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 12 Aug 2017 11:23:30
Journal of General Virology 95
Anti-HIV-1 activity of Trim 37
Hämäläinen, R. H., Joensuu, T., Kallijärvi, J. & Lehesjoki, A. E. (2006).
Characterisation of the mulibrey nanism-associated TRIM37 gene:
transcription initiation, promoter region and alternative splicing.
Gene 366, 180–188.
Sastri, J., O’Connor, C., Danielson, C. M., McRaven, M.,
Perez, P., Diaz-Griffero, F. & Campbell, E. M. (2010). Identification
of residues within the L2 region of rhesus TRIM5a that are required
Jolicoeur, P. & Rassart, E. (1980). Effect of Fv-1 gene product on
for retroviral restriction and cytoplasmic body localization. Virology
405, 259–266.
synthesis of linear and supercoiled viral DNA in cells infected with
murine leukemia virus. J Virol 33, 183–195.
Stremlau, M., Owens, C. M., Perron, M. J., Kiessling, M., Autissier, P.
& Sodroski, J. (2004). The cytoplasmic body component TRIM5a
Kajaste-Rudnitski, A., Marelli, S. S., Pultrone, C., Pertel, T., Uchil,
P. D., Mechti, N., Mothes, W., Poli, G., Luban, J. & Vicenzi, E.
(2011). TRIM22 inhibits HIV-1 transcription independently of its E3
ubiquitin ligase activity, Tat, and NF-kB-responsive long terminal
restricts HIV-1 infection in Old World monkeys. Nature 427, 848–
853.
repeat elements. J Virol 85, 5183–5196.
Kallijärvi, J., Hämäläinen, R. H., Karlberg, N., Sainio, K. & Lehesjoki,
A. E. (2006). Tissue expression of the mulibrey nanism-associated
Trim37 protein in embryonic and adult mouse tissues. Histochem Cell
Biol 126, 325–334.
Keckesova, Z., Ylinen, L. M. & Towers, G. J. (2004). The human and
African green monkey TRIM5a genes encode Ref1 and Lv1 retroviral
restriction factor activities. Proc Natl Acad Sci U S A 101, 10780–10785.
Lehesjoki, A. E., Reed, V. A., Mark Gardiner, R. & Greene, N. D.
(2001). Expression of MUL, a gene encoding a novel RBCC family
ring-finger protein, in human and mouse embryogenesis. Mech Dev
108, 221–225.
Perez-Caballero, D., Hatziioannou, T., Yang, A., Cowan, S. & Bieniasz,
P. D. (2005). Human tripartite motif 5a domains responsible for
retrovirus restriction activity and specificity. J Virol 79, 8969–8978.
Pertel, T., Hausmann, S., Morger, D., Züger, S., Guerra, J., Lascano,
J., Reinhard, C., Santoni, F. A., Uchil, P. D. & other authors (2011).
TRIM5 is an innate immune sensor for the retrovirus capsid lattice.
Nature 472, 361–365.
Reymond, A., Meroni, G., Fantozzi, A., Merla, G., Cairo, S., Luzi, L.,
Riganelli, D., Zanaria, E., Messali, S. & other authors (2001). The
tripartite motif family identifies cell compartments. EMBO J 20,
2140–2151.
Stremlau, M., Perron, M., Lee, M., Li, Y., Song, B., Javanbakht, H.,
Diaz-Griffero, F., Anderson, D. J., Sundquist, W. I. & Sodroski, J.
(2006). Specific recognition and accelerated uncoating of retroviral
capsids by the TRIM5a restriction factor. Proc Natl Acad Sci U S A
103, 5514–5519.
Towers, G. J. & Goff, S. P. (2003). Post-entry restriction of retroviral
infections. AIDS Rev 5, 156–164.
Trkola, A. (2004). HIV–host interactions: vital to the virus and key to
its inhibition. Curr Opin Microbiol 7, 555–559.
Uchil, P. D., Quinlan, B. D., Chan, W. T., Luna, J. M. & Mothes, W.
(2008). TRIM E3 ligases interfere with early and late stages of the
retroviral life cycle. PLoS Pathog 4, e16.
Voss, M., Paterson, J., Kelsall, I. R., Martı́n-Granados, C., Hastie, C. J.,
Peggie, M. W. & Cohen, P. T. (2011). Ppm1E is an in cellulo AMP-
activated protein kinase phosphatase. Cell Signal 23, 114–124.
Wu, X., Anderson, J. L., Campbell, E. M., Joseph, A. M. & Hope, T. J.
(2006). Proteasome inhibitors uncouple rhesus TRIM5a restriction of
HIV-1 reverse transcription and infection. Proc Natl Acad Sci U S A
103, 7465–7470.
Zapata, J. M., Pawlowski, K., Haas, E., Ware, C. F., Godzik, A. & Reed,
J. C. (2001). A diverse family of proteins containing tumor necrosis
factor receptor-associated factor domains. J Biol Chem 276, 24242–
24252.
Rold, C. J. & Aiken, C. (2008). Proteasomal degradation of TRIM5a
Zhang, J., Ge, W., Zhan, P., De Clercq, E. & Liu, X. (2011). Retroviral
restriction factors TRIM5a: therapeutic strategy to inhibit HIV-1
during retrovirus restriction. PLoS Pathog 4, e1000074.
replication. Curr Med Chem 18, 2649–2654.
http://vir.sgmjournals.org
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 12 Aug 2017 11:23:30
967