Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Journal of General Virology (2014), 95, 960–967 DOI 10.1099/vir.0.057653-0 Anti-HIV-1 activity of Trim 37 Azah A. Tabah,1,2 Keith Tardif33 and Louis M. Mansky1,2,4 Correspondence 1 Louis M. Mansky 2 [email protected] Institute for Molecular Virology, University of Minnesota, Minneapolis, MN 55455; USA MinnCResT Program, Department of Diagnostic and Biological Sciences, School of Dentistry, University of Minnesota, Minneapolis, MN 55455; USA 3 Myriad Pharmaceuticals, Salt Lake City, UT 84108, USA 4 Department of Microbiology, University of Minnesota, Minneapolis, MN 55455; USA Received 29 July 2013 Accepted 28 November 2013 Trim 5a was the first member of the tripartite motif (TRIM) family of proteins that was identified to potently restrict human immunodeficiency virus type 1 (HIV-1) replication. The breadth of antiretroviral activity of TRIM family members is an active area of investigation. In this study, we demonstrate that human Trim 37 possesses anti-HIV-1 activity. This antiretroviral activity and the manner in which it was displayed were implicated by (1) decreased viral replication upon Trim 37 transient overexpression in virus-producing cells, (2) correlation of the reduction of viral infectivity with Trim 37 virion incorporation, (3) increased HIV-1 replication during siRNA depletion of Trim 37 expression, and (4) reduction in viral DNA synthesis upon Trim 37 transient overexpression. Our findings provide the first demonstration, to our knowledge, of the potent antiviral activity of human Trim 37, and implicate an antiviral mechanism whereby Trim 37 interferes with viral DNA synthesis. INTRODUCTION Eukaryote cells have evolved specific host cell proteins to limit pathogen attack by providing immunity to infection (Bieniasz, 2004; Goff, 2007; Towers & Goff, 2003). For retroviruses, a long studied host cell protein is the murine Fv1 protein, which is derived from an endogenous retroviral gag sequence (Best et al., 1996). Fv1 targets incoming murine leukaemia virus (MLV) capsids and blocks infection after viral DNA synthesis (Jolicoeur & Rassart, 1980). One family of host cell proteins whose members have been studied in the context of human immunodeficiency virus type 1 (HIV-1) infection is the tripartite motif (Trim) family (Trkola, 2004; Zhang et al., 2011). All members of the Trim family contain three N-terminal domains – RING, B-box and coiled-coil (Reymond et al., 2001). Additionally, nearly all members contain one or more variable domains in their C terminus. Several family-wide screens have been conducted on the antiviral activities of mammalian Trim proteins (Carthagena et al., 2009; Uchil et al., 2008). These screens have revealed that many members of the Trim family have conserved antiviral activity, especially those family members that contain a SPRY domain as their fourth C-terminal domain (Carthagena et al., 2009; Uchil et al., 2008), for example, Trim 11, Trim 15 and Trim 22 (Kajaste-Rudnitski et al., 2011; Uchil et al., 2008). The 3Present address: ARUP Laboratories, 500 Chipeta Way, Salt Lake City, UT 84108-1221, USA. 960 prototypical SPRY-containing Trim family member that has been shown to have anti-HIV-1 activity is Trim 5a. Recent studies have reported that Trim 5a causes an early block in HIV-1 replication that occurs at or before the initiation of reverse transcription (RT) (Keckesova et al., 2004; Stremlau et al., 2004). Notably, it was demonstrated that the presence of rhesus Trim 5a leads to a reduction in the amount of late RT (LRT) products, and that Trim 5a associates with retroviral capsids through its SPRY domain (Stremlau et al., 2004; Wu et al., 2006). Other studies have demonstrated that the Trim 5a B-box domain further stabilizes the SPRY–capsid interaction (Diaz-Griffero et al., 2007, 2009). Recently, it was also shown that the linker region between the coiled-coil and SPRY domains determines Trim 5a localization to cytoplasmic bodies, and is essential for Trim 5a antiviral activity (Sastri et al., 2010). Taken together with previous observations, these findings suggest that multiple domains in Trim 5a are required for and participate in rhesus Trim 5a restriction of HIV-1 replication. Interestingly, Trim 5a capsid recognition abilities have also recently been linked to the newly discovered ability of Trim 5a to catalyse the synthesis of unattached K63 ubiquitin chain, leading to further restriction of HIV-1 infection (Pertel et al., 2011). In addition to Trim 5a SPRY-dependent mechanisms of inhibition of HIV-1 infection, some non-SPRY Trim family members have also been implicated to have anti-HIV-1 activity (Uchil et al., 2008). In the large antiviral Trim Downloaded from www.microbiologyresearch.org by 057653 G 2014 SGM IP: 88.99.165.207 On: Sat, 12 Aug 2017 11:23:30 Printed in Great Britain In this study, we have found that human Trim 37 – which contains a TRAF domain as its C-terminal domain (Zapata et al., 2001) – possesses anti-HIV-1 activity. The anti-HIV1 activity of Trim 37 was observed by its being able to decrease viral replication upon transient overexpression in virus-producing cells, but not target cells, and this effect could be alleviated via depletion of Trim 37 expression by siRNA. We also found that antiretroviral activity was associated with the recruitment of Trim 37 into virus particles and that the reduction in viral infectivity correlated with a reduction in viral DNA synthesis. Together, these observations provide the first demonstration of the anti-HIV-1 activity of human Trim 37. RESULTS Trim 37 expression and inhibition of HIV-1 replication Previous studies have suggested that Trim 37 is highly conserved and was expressed in all tissues tested (Hämäläinen et al., 2006; Kallijärvi et al., 2006). To verify these reports, we set out to characterize the expression levels of Trim 37 in a variety of mammalian cell lines in the lab. We examined protein expression levels of Trim 37 in three cell lines (293T, HeLa, HepG2) and in stimulated peripheral blood mononuclear cells (PBMCs) to determine the expression levels of Trim 37 in these cell types. Fig. 1 reveals that Trim 37 was highly expressed in HepG2 cells. Relative to HepG2 cells, Trim 37 protein expression was approximately 11-fold lower in 293T cells, fourfold lower in HeLa cells, and eightfold lower in PBMCs. Since antiviral activity has been shown for other TRIM family members, we sought to determine whether Trim 37 influenced HIV-1 replication. Results from a yeast twohybrid screen conducted at Myriad Pharmaceuticals indicated that Trim 37 interacted with HIV-1 reverse transcriptase (data not shown), and this further suggested that Trim 37 may influence HIV-1 replication. To test if Trim 37 could influence HIV-1 replication, VSV-G pseudotyped HIV-1 was produced from 293T cells in the presence of varying amounts of Trim 37. The resulting viral supernatants were normalized for p24 levels, and used to infect HeLa target cells; infected cells were identified by green fluorescent protein (GFP) expression. Fig. 2(a, b) shows that viral infectivity decreases as expression of Trim 37 increases in a dose-dependent manner, though transfection of 10 mg of the Trim 37 expression plasmid into 293T cells did not further decrease viral infectivity beyond that observed by transfection of 5 mg of the Trim 37 expression http://vir.sgmjournals.org PB M C H ep family member screen performed by Uchil and colleagues, Trim 31, which lacks both a coiled-coil and a C-terminal domain, was found to inhibit HIV-1 entry (Uchil et al., 2008). Furthermore, Trim 32, which contains an NHL C-terminal domain, inhibits HIV-1 long terminal repeat transcription (Fridell et al., 1995). G 2 29 3T H eL a Anti-HIV-1 activity of Trim 37 Trim 37 Tubulin Fig. 1. Endogenous levels of Trim 37 in cell lines. Levels of endogenous Trim 37 in the HepG2, 293T and HeLa cell lines and PBMCs. PBMCs were stimulated with phytohaemagglutinin for 72 h followed by treatment with interleukin-2 for an additional 72 h. Cell lysates were prepared and Trim 37 and gamma-tubulin protein expression was analysed by immunoblotting. plasmid (Fig. 2b). This suggests that diminution of virus infectivity by Trim 37 expression in 293T may have a saturation limit beyond which no further reduction of virus infectivity can be observed. Our results demonstrate that at the highest level of transfected Trim 37 plasmid, Trim 37 reduced HIV-1 infectivity by approximately 10fold compared with virus produced in its absence as assessed in HeLa cells (Fig. 2a). We confirmed by RT-PCR that the increase in Trim 37 mRNA levels correlated with the amount of the Trim 37 plasmid transiently transfected into 293T cells (Fig. 2c). The transient expression of Trim 37 in 293T cells was observed to be lower than Trim 37 expression in HepG2 cells (Fig. 2d), indicating that the transient expression is within levels observed in other cell types. Infection of HeLa target cells with HIV-1 vector virus produced from HepG2 resulted in elimination of virus infectivity, indicating that saturation of the ability to reduce virus infectivity by higher Trim 37 expression levels observed in 293T cells (i.e. 5 mg to 10 mg, Fig. 2b) was not apparent in HepG2 cells, as Trim 37 expression levels in these cells correlated with the elimination virus infectivity (Fig. 2d). Taken together, these observations suggest cell type differences in the ability of Trim 37 to diminish virus infectivity (e.g. differential ability of Trim 37 to associate with viral protein(s) and assemble into virus particles at increasing Trim 37 expression levels). We next tested the ability of Trim 37 expression in target cells to block HIV-1 infectivity. To do this, Trim 37 was transiently expressed in HeLa target cells, and 48 h posttransfection cell culture supernatants containing HIV-1 vector virus were used to infect HeLa cells. As indicated in Fig. 2(e), viral infectivity of HeLa cells transiently transfected with the highest amount (10 mg) of Trim 37 was indistinguishable from that observed in target cells that were mock transfected with empty vector. Parallel experiments performed with 0.5 mg or 5 mg Trim 37 also revealed no differences in HIV-1 infectivity. These observations indicate that the expression of Trim 37 in producer cells, but not in target cells, significantly reduces HIV-1 infectivity. Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sat, 12 Aug 2017 11:23:30 961 A. A. Tabah, K. Tardif and L. M. Mansky (b) 0 mg Trim 37 0.5 mg Trim 37 5 mg Trim 37 10 mg Trim 37 30 20 6 % Cells infected % Cells infected (a) 40 10 4 2 0 0 0 10 20 40 80 0 0.5 5 10 Trim 37 expression plasmid (mg) Virus (ml) (d) 30 40 293T HepG2 % Cells infected Relative Trim 37 expression (c) 30 20 10 0 Tubulin 10 0 0 0.5 5 10 Trim 37 expression plasmid (mg) (e) 25 % Cells infected Trim 37 20 293T 293T HepG2 + Trim 37 (10 mg) 0 mg Trim 37 0.5 mg Trim 37 5 mg Trim 37 10 mg Trim 37 20 15 10 5 0 0 10 20 40 80 Virus (ml) Fig. 2. Trim 37 expression impairs HIV-1 infectivity when expressed in virus-producing cells. 293T cells were co-transfected with an env-minus HIV-1 vector expressing the mouse HSA and GFP, pHIG, and a VSV-G expression plasmid, pCMV-G, along with a Trim 37 expression construct, pTrim37. Forty-eight hours post-transfection, cell culture supernatants were harvested and used to infect HeLa target cells. (a) Viral infectivity was determined by flow cytometry. (b) The graph represents a quantification of the results in (a). (c) RNA extracts were prepared from 293T cells from experiments shown in panel (a) and were analysed by quantitative RT-PCR using Trim 37-specific primers. (d) Comparison of reduction of HIV-1 infectivity when HIV-1 vector virus was produced from 293T cells co-transfected with pHIG, pCMV-G and pTrim37 (10 mg) or from HepG2 cells (which endogenously express high levels of Trim 37) co-transfected with pHIG and pCMV-G and used to infect HeLa target cells. (e) Transient expression of Trim 37 in target cells does not affect HIV-1 infectivity. HeLa target cells were transiently transfected with the Trim 37 expression plasmid (0, 0.5, 5 or 10 mg) for 48 h and then infected with HIV-1 vector virus. Viral infectivity was determined by flow cytometry as described in Methods. All results are presented as the mean±SD from three independent experiments performed in triplicate. Targeted depletion of endogenous Trim 37 levels increases infectivity To help exclude the possibility that the antiviral effect of Trim 37 we observed was an artefact of transient Trim 37 expression, we examined the effects of depleting endogenous Trim 37 on infectivity using siRNAs directed 962 against Trim 37 (Fig. 3). Since overexpression of Trim 37 decreases infectivity of HIV-1, we hypothesized that depletion of Trim 37 with siRNA would increase viral infectivity. To examine the ability of Trim 37 siRNA to decrease Trim 37 expression, qPCR was performed 48 h after 293T cells were transiently transfected with Trim 37 siRNA. The results shown in Fig. 3(a) demonstrate that Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sat, 12 Aug 2017 11:23:30 Journal of General Virology 95 Anti-HIV-1 activity of Trim 37 siRNA treatment decreased Trim 37 mRNA levels by 35 %. This reduction led to a 2.5-fold increase in virus infectivity compared with virus produced in the presence of a control, scrambled siRNA (Fig. 3b). Since we were not able to fully knockdown endogenous Trim 37 gene expression in 293T cells, we further investigated the nature of the Trim 37 gene locus. The Trim 37 gene locus encodes two transcript variants, TV1 and TV2, which lead to the production of the same protein product. We used qPCR to detect transcript variant-specific mRNA expression of Trim 37 in a variety of cell lines (e.g. Bat1, HepG2, 293T, CrFK, MagiU373, Cos1, Vero and HeLa) and detected expression of both transcript variants of Trim 37 in all cell lines (data not shown). These findings are somewhat contrary to previous reports which indicated that only Trim 37 TV1 was expressed in all human and mouse cell types examined, with the exception of testis, which expressed both TV1 and TV2 (Kallijärvi et al., 2006). The 39 untranslated region (39UTR) of Trim 37 TV2 overlaps with the 39UTR of a neighbouring gene, PPM1E, in humans and other species. PPM1E can be amplified from these cell lines, suggesting that mRNA hybridization between Trim 37 and PPM1E could occur. The physiological relevance of the Trim 37 and PPM1E overlap has not been determined (Kallijärvi et al., 2006). The inability to knockdown PPM1E gene expression using shRNA has recently been reported (Voss et al., 2011), providing further indication of the difficulties in using interfering technologies to reduce gene expression in this region. Investigation of Trim 37 incorporation into HIV-1 particles We next tested if Trim 37 could be incorporated into HIV-1-like particles produced from an HIV-1 Gag-only expression construct. To do this, the Gag-only expression construct was co-transfected with varying amounts of Trim 37 into 293T cells. Particles released into cell culture supernatants were analysed by immuoblot (Fig. 4c). Gag incorporation into particles was not affected by Trim 37 co-expression (Fig. 4c). Trim 37, however, was not detected in the virus particles, although both Trim 37 and Gag were detected in cell lysates. These data suggest that the viral protein determinants required for Trim 37 incorporation into particles involve an HIV-1 protein other than Gag. Analysis of viral DNA synthesis in infected cells (a) 1.5 (b) 4 Fold increase in infectivity To determine if Trim 37 influences the levels of viral DNA synthesis, quantitative real-time PCR was used to detect RT intermediates from infected target cells. HeLa cells were infected with HIV-1 p24 capsid-equivalent amounts of virus. RT products were detected from 4 to 24 h postinfection and the absolute quantities synthesized were determined by a standard curve. Fig. 5(a) demonstrates a Relative Trim 37 expression To determine whether Trim 37 was packaged into HIV-1 particles, we analysed Trim 37 virion incorporation into an HIV-1 vector, pHIG. Seventy-two hours post-transfection of 293T cells with Trim 37 and pHIG, cell culture supernatants were collected and virus particles were purified by ultracentrifugation through a 20 % sucrose cushion. The particles were lysed, subjected to SDS-PAGE, and analysed for Trim 37 incorporation. As shown in Fig. 4(a), the 130 kDa Trim 37 protein was readily detected when Trim 37 was co-transfected into cells. The amount of Trim 37 co-transfected did not significantly affect the amount of HIV-1 Gag incorporated into virus particles or the efficiency of virus particle production (Fig. 4a, bottom panel). This indicates that Trim 37 was incorporated into virus particles in a dose-dependent manner (Fig. 4a, b). 1.0 * 0.5 0 Scrambled siRNA Trim 37 siRNA * 3 2 1 0 Scrambled siRNA Trim 37 siRNA Fig. 3. siRNA depletion of Trim 37 enhances HIV-1 infectivity. (a) Reduction of Trim 37 expression by Trim 37-directed siRNA. 293T cells were transduced with scrambled or Trim 37-specific siRNA. Twenty-four hours post-transfection, cells were lysed and RNAs extracted for PCR analysis. (b) Increase in HIV-1 infectivity by siRNA depletion of Trim 37. 293T cells were transfected with siRNAs. Twenty-four hours post-transfection, cells were subsequently transfected with pHIG and pCMV-G. Forty-eight hours post-transfection, cell culture supernatants were collected, filtered and used to infect permissive HeLa target cells. The data represent the mean±SD from at least three independent experiments. *Statistical significance (P,0.05). http://vir.sgmjournals.org Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sat, 12 Aug 2017 11:23:30 963 A. A. Tabah, K. Tardif and L. M. Mansky 0 0.5 5 10 (b) 250 Relative Trim 37 incorporated (a) Trim 37 (mg) Trim 37 p55Gag p24 200 150 100 50 0 0 0.5 5 10 Trim 37 (mg) (c) VIP 0 0.5 5 Cellular 10 0 0.5 5 10 Trim 37 (mg) Gag Trim 37 Fig. 4. Trim 37 is incorporated into HIV-1 particles. (a) Immunoblot analysis of virus particles. 293T cells were transfected with pHIG and pCMV-G in the presence of the indicated amounts of pTrim37. Forty-eight hours post-transfection, cell culture supernatants were harvested and virus particles were pelleted through a sucrose cushion. The viral particle pellets were resuspended, lysed and subjected to SDS-PAGE. Immunoblot analysis was done using antibodies directed against Trim 37 and p24 Gag. (b) Relative amounts of Trim 37 incorporated into HIV-1 particles. Error bars indicate SD. (c) 293T cells were cotransfected with human codon optimized gag and the expression plasmid for Trim 37. Forty-eight hours post-transfection, cell culture supernatants and cells were harvested. The virus-like particle pellets or cells were resuspended, lysed and subjected to SDS-PAGE. Immunoblot analysis was done using antibodies directed against Gag and Trim 37. 2- to 18-fold reduction in the synthesis of minus-strand strong stop (SS) DNA when using virus produced in the presence of varying levels of Trim 37. The initial amount of minus-strand DNA detected at 4 h did not increase over time, suggesting some viral DNA synthesis was initiated, albeit at low levels. The synthesis of late RT products was, like the early RT products, at low levels (Fig. 5b). These observations suggest that the presence of Trim 37 is associated with a severe inhibition of viral DNA synthesis, but that a low level of viral DNA synthesis occurred prior to full establishment of the Trim 37 antiviral effect. DISCUSSION This study has identified the human Trim 37 protein as possessing anti-HIV-1 activity. The anti-HIV-1 activity of human Trim 37 was implicated by (1) decreased viral replication upon Trim 37 transient overexpression in virus-producing cells, (2) correlation of the reduction of viral infectivity with Trim 37 virion incorporation, (3) increased HIV-1 replication during siRNA depletion of Trim 37 expression, and (4) reduction in viral DNA synthesis upon Trim 37 transient overexpression. One potential mechanism to explain the anti-HIV-1 activity of Trim 37 is that viral DNA synthesis is perturbed 964 by interaction between Trim 37 and RT. The lack of Trim 37 incorporation with Gag-only virus-like particles provides an indication that a viral protein(s) other than Gag was required for Trim 37 virion incorporation. It is formally possible that Trim 37 causes premature uncoating. Rhesus Trim 5a is thought to cause a reduction in viral DNA products. The SPRY-domain-containing rhesus Trim 5a is rapidly degraded after exposure to HIV-1 capsids, but this degradation can be blocked by proteasomal inhibition (Rold & Aiken, 2008). Several groups have confirmed that proteasomal inhibition does not result in a relief of the block of HIV-1 infectivity, although it does result in an increase in viral DNA products (Perez-Caballero et al., 2005; Stremlau et al., 2006; Wu et al., 2006). Our evidence of the anti-HIV-1 activity of Trim 37 was not predicted from a family-wide Trim screen for anti-HIV activity (Uchil et al., 2008). In these studies, it was found that human Trim 37 did not inhibit HIV or MLV entry when target cells were transfected with Trim 37 plasmid, then challenged with MLV or HIV-1 virus pseudotyped with ALV-A 30 h later. This experimental design parallels our experiments with target cells (see Fig. 2e), and corroborates our findings that Trim 37 does not exert a target cell effect. This observation provides one line of evidence that the HIV-1 capsid protects RT, and why target cell Trim 37 does not affect viral replication. However, it is Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sat, 12 Aug 2017 11:23:30 Journal of General Virology 95 (a) 0 mg Trim 37 0.5 mg Trim 37 5 mg Trim 37 10 mg Trim 37 Relative expression minus-strand strong stop 6 5 4 3 2 1 45 40 0 mg Trim 37 0.5 mg Trim 37 5 mg Trim 37 10 mg Trim 37 35 30 25 20 15 10 5 0 0 4 –1 (b) Relative expression late RT product Anti-HIV-1 activity of Trim 37 8 12 24 4 8 12 24 Time (h) Time (h) Fig. 5. Incorporation of Trim 37 impairs viral DNA synthesis. 293T cells were co-transfected with pHIG and pCMV-G alone (control) or with pTrim37. Cell culture supernatants were collected at 48 h post-transfection, filtered and used to infect permissive HeLa target cells. Cells were harvested at 4, 8, 12 and 24 h post-infection for qPCR analysis. (a) Early RT products (i.e. minus-strand SS DNA). (b) LRT products. The data are the mean±SD from experiments done in triplicate. possible that no target cell effect was observed due to the lack of stable Trim 37 expression in target cells. Like rhesus Trim 5a, Trim 37 exerts its antiviral activity in the early phase of HIV-1 replication. However, our data indicate that Trim 37 has an antiviral mechanism that is distinct from that of rhesus Trim 5a. Trim 37 was incorporated into HIV-1 particles and its expression severely diminished viral DNA synthesis. While Trim 5a interacts with the HIV-1 capsid through its SPRY domain, Trim 37, however, lacks a SPRY domain. For its variable C-terminal domain, Trim 37 contains a TRAF, also referred to as a MATH motif (Lehesjoki et al., 2001). While siRNA depletion of Trim 37 resulted in only a modest reduction (,50 %), virus infectivity increased by 2.5-fold. This could be indicative of a critical threshold of Trim 37 expression needed in order to see an effect on HIV-1 infectivity. The evolutionary conservation of the Trim family suggests that the antiviral properties of human Trim 37 could apply to other retroviruses. It is therefore plausible that Trim 37 from other species could be more potent in the inhibition of HIV-1 replication. Comparative studies should be useful in determining the molecular mechanism for the perturbation of viral DNA synthesis and the anti-HIV-1 mechanism of Trim 37. entry site and the enhanced green fluorescence protein (EGFP) gene, which was cloned into the nef gene. This vector does not express the envelope protein due to a 59 frame shift mutation in the envelope gene. A Trim 37 expression plasmid previously described (Avela et al., 2000) was generously provided by Dr Anna-Elina Lehesjoki (University of Helsinki, Finland). A vector that encodes the vesicular stomatitis virus glycoprotein (pCMV-VSV-G) was used to pseudotype the HIV-1 vector for production of virus. An HIV-1 Gag-only expression vector, pHIVGag, was constructed by codon optimization of the HIV-1 Gag gene sequence. Single-round replication assays. Vector virus stocks for single- round HIV-1 infectivity assays were produced by DNA transfection of 293T cells or HepG2 cells. Cells were grown on poly-L-lysine-coated 10 cm dishes, and were transfected using the calcium phosphate DNA precipitation method. Each 10 cm dish was co-transfected with 10 mg viral vector (pHIG) and 1 mg p-CMV-VSV-G. To assess effects of Trim 37 in 293T cells, the vector encoding Trim 37 was co-transfected at 0.5 mg, 5 mg or 10 mg. Additionally, the levels of plasmid DNA were normalized for each transfection by adding the appropriate level of an empty bacterial vector, such that each transfection contained 21 mg DNA in total. Twenty-four hours after transfection, the medium was changed, and 20 mM HEPES was added to the culture medium. Cell culture supernatants from either 293T or HepG2 cells were harvested 48 h post-transfection, filtered through a 0.2 mm filter, and normalized for p24 Gag prior to infection of target cells (Dapp et al., 2009). Two days post-infection, virus infectivity was assessed by measuring EGFP fluorescence using flow cytometry. Trim 37 RNA depletion by siRNA. Downregulation of Trim 37 expression by siRNA was done by transfecting cells with siRNA against Trim 37 (Invitrogen) using Lipofectamine (Invitrogen) according to the manufacturer’s instructions. METHODS Cell culture and plasmid constructs. The HEK293T, HepG2 and HeLa cells were maintained in Dulbecco’s modified Eagle’s medium (GIBCO) supplemented with penicillin and streptomycin and 10 % fetal clone III serum (Hyclone) at 37 uC in 5 % CO2. The single-cycle HIV-1 vector, pHIG, contains an expression cassette consisting of the mouse heat-stable antigen CD24 (HSA) gene, an internal ribosomal http://vir.sgmjournals.org Virion incorporation and co-immunoprecipitation assays. Lysates were prepared from either cells or viral pellets by resuspending the pellets in RIPA buffer (50 mM Tris-HCl pH 7.6, 150 mM NaCl, 1 % NP-40, 0.5 % deoxycholate (DOC), 0.1 % SDS and 5 mM EDTA pH 8.0). Viruses were harvested by filtration (0.2 mm) of Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sat, 12 Aug 2017 11:23:30 965 A. A. Tabah, K. Tardif and L. M. Mansky cell culture supernatants and concentrated by ultracentrifugation (Beckman 50.2 rotor, 25 000 r.p.m., 2 h). Pellets were dissolved in RIPA buffer, resuspended in 62.5 mM Tris, 2 % SDS, 5 % (v/v) glycerol, pH 6.8 and 0.07 % b-mercaptoethanol, and subjected to denaturing SDS-PAGE. Separated proteins were transferred to a nitrocellulose membrane, blocked in Tris-buffered saline containing 0.1 % (v/v) Tween-20 (TBS-T) and 5 % skimmed milk powder, and then probed with either a rabbit anti-Trim 37 antibody (Novus Biologicals or Bethyl Laboratories), or a rabbit anti-p24 antibody (Advanced Biotechnologies). Membranes were then incubated with goat anti-rabbit IgG–HRP secondary antibody conjugates, and the proteins were visualized by chemiluminescence using the Bio-Rad Gel Doc (Bio-Rad). To assess Trim 37 virion incorporation, Trim 37 was detected with a rabbit anti-Trim 37-specific antibody (Novus Biologicals). The levels of p24 Gag were used to normalize for equal loading of viral particle lysates as previously described (Dapp et al., 2009). Briefly, ELISA plates (96-well) were incubated overnight with a 1 : 1000 rabbit p24 antiserum (AIDS Reagent Program, catalogue no. 4250). The ELISA plates were then washed with PBS–0.5 % Tween 20 (PBST) and blocked for 1 h with 3 % milk in PBST. The samples and standards were prepared by adding a 1 : 1 volume of PBS–0.1 % Empigen (Sigma-Aldrich) and incubating at 56 uC for 30 min. The samples were then added to the plate and incubated at 37 uC for 1 h. Wells were washed with PBST and then incubated with mouse anti-p24 in PBST–1 % milk at 22 uC for 1 h. Incubation was then done with a horseradish peroxidase conjugated anti-mouse secondary antibody in PBST–1 % milk for 30 min, and the wells were washed with PBST and PBS before the addition of the tetramethylbenzidine substrate. The reactions were stopped by the addition of 1 M sulfuric acid, and the absorbance was determined at 450 nm. For experiments requiring co-immunoprecipitation, viral lysates were incubated with either a monoclonal antibody directed against reverse transcriptase (no. 11338, NIH AIDS Research Program) or a rabbit anti-Trim 37 antibody. Real-time reverse transcriptase PCR. Total RNA was extracted from 293T or HeLa cells using the RNeasy kit from Qiagen and cDNA was prepared using SuperScript III Reverse Transcriptase (Invitrogen). Quantitative PCR was performed in triplicate with 1 ml cDNA on an ABI Prism 7400 cycler, using Applied Biosystems SYBR Green master mix. The Trim 37 primer pair was designed to amplify all transcript variants of human Trim 37 (NM_015294) cDNA: 59-GTCGCGTCTCATGGAACT (forward) and 59-CTACAAGACCGCAACTGGTG (reverse). The primer pairs designed to amplify Trim 37 TV1 only were TGGAAACTGTTGGAAGGTGGCACA (forward) and GCATTCAGCAAGACATCAGACACGG (reverse). The primer pairs designed to amplify Trim 37 TV2 only were TGTGACACTGAGAATGAGGAGCAGG (forward) and TGGCCCCAACTATAGTGCCGG (reverse). The primer pairs designed to amplify PPM1E were TGGAGGTTGCGTAGTCTGGT (forward) and CGGTGTCATAGAAGCCATCAC (reverse). Plasmid DNA encoding Trim 37 was used as a standard. with a denaturation step of 10 min at 95 uC followed by 40 cycles of 15 s at 95 uC, 15 s at annealing temperature of 55 uC and 30 s amplification at 72 uC. Quantification of DNA products was determined with reference to HIV-1 vector plasmid, which was used as a standard. ACKNOWLEDGEMENTS We thank Lauren Beach and Christine Clouser for reading and providing constructive comments on the manuscript. We thank the ProNet group of Myriad Pharmaceuticals for identification of yeast two-hybrid interactions. We also thank Alana Lehesjoki for providing the Trim 37 expression constructs as well as anti-Trim 37 antibodies. The following reagent was obtained through the NIH AIDS Research and Reference Reagent program, Division of AIDS, NIAD, NIH: HIV-1 RT monoclonal antibody (5B2B2) from Dr D. Helland and Dr A. M. Szilway. This work was supported by NIH grant GM56615 (L. M. M.). A. A. T. was supported by NIH grant T32 DE07288 (MinnCResT Program). REFERENCES Avela, K., Lipsanen-Nyman, M., Idänheimo, N., Seemanová, E., Rosengren, S., Mäkelä, T. P., Perheentupa, J., Chapelle, A. D. & Lehesjoki, A. E. (2000). Gene encoding a new RING-B-box-coiled- coil protein is mutated in mulibrey nanism. Nat Genet 25, 298– 301. Best, S., Le Tissier, P., Towers, G. & Stoye, J. P. (1996). Positional cloning of the mouse retrovirus restriction gene Fv1. Nature 382, 826–829. Bieniasz, P. D. (2004). Intrinsic immunity: a front-line defense against viral attack. Nat Immunol 5, 1109–1115. Carr, J. M., Cheney, K. M., Coolen, C., Davis, A., Shaw, D., Ferguson, W., Chang, G., Higgins, G., Burrell, C. & Li, P. (2007). Development of methods for coordinate measurement of total cell-associated and integrated human immunodeficiency virus type 1 (HIV-1) DNA forms in routine clinical samples: levels are not associated with clinical parameters, but low levels of integrated HIV-1 DNA may be prognostic for continued successful therapy. J Clin Microbiol 45, 1288–1297. Carthagena, L., Bergamaschi, A., Luna, J. M., David, A., Uchil, P. D., Margottin-Goguet, F., Mothes, W., Hazan, U., Transy, C. & other authors (2009). Human TRIM gene expression in response to interferons. PLoS ONE 4, e4894. Dapp, M. J., Clouser, C. L., Patterson, S. & Mansky, L. M. (2009). 5-Azacytidine can induce lethal mutagenesis in human immunodeficiency virus type 1. J Virol 83, 11950–11958. Diaz-Griffero, F., Kar, A., Lee, M., Stremlau, M., Poeschla, E. & Sodroski, J. (2007). Comparative requirements for the restriction of retrovirus infection by TRIM5a and TRIMCyp. Virology 369, 400– Real-time PCR analysis of viral DNA synthesis. Infected cells 410. were incubated with DNase-treated virus for 4, 6, 12 or 24 h. DNA was prepared from the cells by resuspending cell pellets in lysis buffer (0.1 M Tris pH 8.5, 5 mM EDTA pH 8.0, 200 mM NaCl, 0.2 % SDS and 2 mg ml21 proteinase K) and incubating at 55 uC overnight. qPCR analysis of reverse transcriptase products was performed using 1 ml lysate. Samples were then analysed using primer pairs that had been previously established (Carr et al., 2007) for amplification of viral SS or LRT DNA products. The following primer pairs were used: 59-CTAACTAGGGAACCCACTGC and 59-CTGCTAGAGATTTTCCACAC (SS DNA), and 59-TGTGTGCCCGTCTGTTGTGT, 59-GAGTCCTGCGTCGAGAGAGC (LRT DNA). PCRs were carried out Diaz-Griffero, F., Qin, X. R., Hayashi, F., Kigawa, T., Finzi, A., Sarnak, Z., Lienlaf, M., Yokoyama, S. & Sodroski, J. (2009). A B-box 2 surface patch important for TRIM5a self-association, capsid binding avidity, 966 and retrovirus restriction. J Virol 83, 10737–10751. Fridell, R. A., Harding, L. S., Bogerd, H. P. & Cullen, B. R. (1995). Identification of a novel human zinc finger protein that specifically interacts with the activation domain of lentiviral Tat proteins. Virology 209, 347–357. Goff, S. P. (2007). Host factors exploited by retroviruses. Nat Rev Microbiol 5, 253–263. Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sat, 12 Aug 2017 11:23:30 Journal of General Virology 95 Anti-HIV-1 activity of Trim 37 Hämäläinen, R. H., Joensuu, T., Kallijärvi, J. & Lehesjoki, A. E. (2006). Characterisation of the mulibrey nanism-associated TRIM37 gene: transcription initiation, promoter region and alternative splicing. Gene 366, 180–188. Sastri, J., O’Connor, C., Danielson, C. M., McRaven, M., Perez, P., Diaz-Griffero, F. & Campbell, E. M. (2010). Identification of residues within the L2 region of rhesus TRIM5a that are required Jolicoeur, P. & Rassart, E. (1980). Effect of Fv-1 gene product on for retroviral restriction and cytoplasmic body localization. Virology 405, 259–266. synthesis of linear and supercoiled viral DNA in cells infected with murine leukemia virus. J Virol 33, 183–195. Stremlau, M., Owens, C. M., Perron, M. J., Kiessling, M., Autissier, P. & Sodroski, J. (2004). The cytoplasmic body component TRIM5a Kajaste-Rudnitski, A., Marelli, S. S., Pultrone, C., Pertel, T., Uchil, P. D., Mechti, N., Mothes, W., Poli, G., Luban, J. & Vicenzi, E. (2011). TRIM22 inhibits HIV-1 transcription independently of its E3 ubiquitin ligase activity, Tat, and NF-kB-responsive long terminal restricts HIV-1 infection in Old World monkeys. Nature 427, 848– 853. repeat elements. J Virol 85, 5183–5196. Kallijärvi, J., Hämäläinen, R. H., Karlberg, N., Sainio, K. & Lehesjoki, A. E. (2006). Tissue expression of the mulibrey nanism-associated Trim37 protein in embryonic and adult mouse tissues. Histochem Cell Biol 126, 325–334. Keckesova, Z., Ylinen, L. M. & Towers, G. J. (2004). The human and African green monkey TRIM5a genes encode Ref1 and Lv1 retroviral restriction factor activities. Proc Natl Acad Sci U S A 101, 10780–10785. Lehesjoki, A. E., Reed, V. A., Mark Gardiner, R. & Greene, N. D. (2001). Expression of MUL, a gene encoding a novel RBCC family ring-finger protein, in human and mouse embryogenesis. Mech Dev 108, 221–225. Perez-Caballero, D., Hatziioannou, T., Yang, A., Cowan, S. & Bieniasz, P. D. (2005). Human tripartite motif 5a domains responsible for retrovirus restriction activity and specificity. J Virol 79, 8969–8978. Pertel, T., Hausmann, S., Morger, D., Züger, S., Guerra, J., Lascano, J., Reinhard, C., Santoni, F. A., Uchil, P. D. & other authors (2011). TRIM5 is an innate immune sensor for the retrovirus capsid lattice. Nature 472, 361–365. Reymond, A., Meroni, G., Fantozzi, A., Merla, G., Cairo, S., Luzi, L., Riganelli, D., Zanaria, E., Messali, S. & other authors (2001). The tripartite motif family identifies cell compartments. EMBO J 20, 2140–2151. Stremlau, M., Perron, M., Lee, M., Li, Y., Song, B., Javanbakht, H., Diaz-Griffero, F., Anderson, D. J., Sundquist, W. I. & Sodroski, J. (2006). Specific recognition and accelerated uncoating of retroviral capsids by the TRIM5a restriction factor. Proc Natl Acad Sci U S A 103, 5514–5519. Towers, G. J. & Goff, S. P. (2003). Post-entry restriction of retroviral infections. AIDS Rev 5, 156–164. Trkola, A. (2004). HIV–host interactions: vital to the virus and key to its inhibition. Curr Opin Microbiol 7, 555–559. Uchil, P. D., Quinlan, B. D., Chan, W. T., Luna, J. M. & Mothes, W. (2008). TRIM E3 ligases interfere with early and late stages of the retroviral life cycle. PLoS Pathog 4, e16. Voss, M., Paterson, J., Kelsall, I. R., Martı́n-Granados, C., Hastie, C. J., Peggie, M. W. & Cohen, P. T. (2011). Ppm1E is an in cellulo AMP- activated protein kinase phosphatase. Cell Signal 23, 114–124. Wu, X., Anderson, J. L., Campbell, E. M., Joseph, A. M. & Hope, T. J. (2006). Proteasome inhibitors uncouple rhesus TRIM5a restriction of HIV-1 reverse transcription and infection. Proc Natl Acad Sci U S A 103, 7465–7470. Zapata, J. M., Pawlowski, K., Haas, E., Ware, C. F., Godzik, A. & Reed, J. C. (2001). A diverse family of proteins containing tumor necrosis factor receptor-associated factor domains. J Biol Chem 276, 24242– 24252. Rold, C. J. & Aiken, C. (2008). Proteasomal degradation of TRIM5a Zhang, J., Ge, W., Zhan, P., De Clercq, E. & Liu, X. (2011). Retroviral restriction factors TRIM5a: therapeutic strategy to inhibit HIV-1 during retrovirus restriction. PLoS Pathog 4, e1000074. replication. Curr Med Chem 18, 2649–2654. http://vir.sgmjournals.org Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sat, 12 Aug 2017 11:23:30 967