Download Mutant Signal Transducer and Activator of Transcription 5b

0021-972X/06/$15.00/0
Printed in U.S.A.
The Journal of Clinical Endocrinology & Metabolism 91(4):1526 –1534
Copyright © 2006 by The Endocrine Society
doi: 10.1210/jc.2005-2558
A Mutant Signal Transducer and Activator of
Transcription 5b, Associated with Growth Hormone
Insensitivity and Insulin-Like Growth Factor-I
Deficiency, Cannot Function as a Signal Transducer or
Transcription Factor
Peng Fang,* Eric M. Kofoed,* Brian M. Little, Xiangdong Wang, Richard J. M. Ross, Stuart J. Frank,
Vivian Hwa, and Ron G. Rosenfeld
Department of Pediatrics (P.F., E.M.K., B.M.L., V.H., R.G.R.), Oregon Health and Science University, Portland, Oregon
97239-3098; Division of Clinical Sciences (R.J.M.R.), Sheffield University, Sheffield S5 7AU, United Kingdom; Departments
of Medicine (X.W., S.J.F), Cell Biology (S.J.F.), and Physiology (S.J.F.), University of Alabama at Birmingham and
Birmingham Veterans Affairs Medical Center (S.J.F.), Birmingham, Alabama 35294; Lucile Packard Foundation for
Children’s Health (R.G.R.), Palo Alto, California 94304; and Department of Pediatrics (R.G.R.), Stanford University,
Stanford, California, 94305-2038
Context: A natural missense mutation in the signal transducer and
activator of transcription (STAT) 5b gene was recently identified in
association with a female patient presenting with severe growth failure and immune dysfunction. The mutation results in an alanine to
proline substitution at residue 630 (A630P) in the src-homology-2
domain, a region essential for docking of STATs to phospho-tyrosines
on activated receptors, STAT dimerization, and stabilization of phospho-STAT-DNA interactions.
Objective: The purpose of this study was to explore the molecular
mechanisms underlying the GH insensitivity and IGF-I deficiency
caused by the A630P-mutated STAT5b.
Results: In reconstitution experiments using HEK293 cells, both GH
and interferon-␥ were unable to activate mutant STAT5b (A630P), as
demonstrated by lack of immunodetectable phospho-tyrosyl-STAT5b
T
HE JANUS KINASE (JAK)-signal transducers and activators of transcription (STAT) signaling pathways, activated by multiple cytokine and growth factors, are fundamental to the regulation of genes involved in cell
proliferation, immune surveillance, tumor suppression, and
other biological activities. Ligand association with cytokine
receptors results in JAK-induced tyrosine phosphorylation
of the receptors, which act as docking sites for cytosolic
proteins including the STATs. The STATs are subsequently
phosphorylated on a single tyrosine by the JAKs, dimerize,
First Published Online February 7, 2006
* P.F. and E.M.K. contributed equally to this work.
Abbreviations: A630P, Alanine to proline substitution at residue 630;
CF, primary dermal fibroblasts, normal; EGF, epithelial growth factor;
EGFR, EGF receptor; GHR, GH receptor; GHRE, GH response element;
hGHR, human GHR; IFN, interferon; IP, immunoprecipitation or immunoprecipitated; JAK, Janus kinase; PF, mutant STAT5b(A630P); p-FA630P, phospho-F-A630P; pSTAT5, phospho-STAT5; SH2, src-homology 2; STAT, signal transducers and activators of transcription.
JCEM is published monthly by The Endocrine Society (http://www.
endo-society.org), the foremost professional society serving the endocrine community.
(A630P) and inability to drive luciferase reporter activity. However,
the Src family of nonreceptor kinases [constitutively active v-src and
epithelial growth factor-induced c-src] tyrosine-phosphorylated
STAT5b(A630P). The v-src-induced phospho-STAT5b(A630P) translocated to the nucleus but, unlike wild-type Stat5b, was unable to bind
DNA.
Conclusions: The A630P mutation disrupts the src-homology-2 architecture such that: 1) mutant STAT5b most likely cannot dock to
phospho-tyrosines on ligand-activated receptors; and 2) stable interactions with DNA are prevented. Because STAT5b (A630P) is an
inefficient signal transducer and transcription factor, the detrimental
impact on signaling pathways important for normal growth and immunity explains, in part, the complex clinical phenotype of GH insensitivity and immune dysfunction. (J Clin Endocrinol Metab 91:
1526 –1534, 2006)
and translocate to the nucleus, where they bind to DNA and
participate in transcriptional regulation of targeted genes.
In mammals there are seven STATs (STAT1, -2, -3, -4, -5a,
-5b, and -6). Although structurally similar, the unique properties of each STAT have been supported by gene disruption
studies in rodent models (1). Corresponding mutations in
humans, however, are rare and have been identified only in
the STAT1 gene (2, 3) and, recently, in the STAT5b gene (4,
5). The autosomal recessive STAT5b mutations were identified in two unrelated female patients diagnosed with GH
insensitivity syndrome, both of whom also presented with
some degree of immune dysfunction. One of the STAT5b
mutations was a frame-shift, which resulted in ablation of
total STAT5b expression due to early termination of protein
synthesis (5), and the other was a missense mutation that
altered Ala to Pro at residue 630 (A630P) (4). STAT5b(A630P)
was readily detectable in patient cells, albeit less well than
wild-type STAT5b (4).
Ala 630 is within the highly conserved src-homology 2
(SH2) domain of STAT5b (Fig. 1A). The SH2 domain in STAT
proteins has three well-characterized functions (1): 1) it per-
1526
Fang et al. • Mutant STAT5b Cannot Function
J Clin Endocrinol Metab, April 2006, 91(4):1526 –1534
1527
Materials and Methods
Antibodies
Antibodies used were as follows: anti-phospho-tyrosine-STAT5 (Cell
Signaling Technology, Beverly, MA); anti-STAT5a (L-20) and antiSTAT5b (G-2) (Santa Cruz Biotechnology, Santa Cruz, CA); goat sera,
anti-FLAG M2, and anti-FLAG-M2-agarose gel (Sigma, St. Louis, MO);
antimouse IgG and antirabbit IgG (Amersham-Pharmacia Biotech, Uppsala, Sweden); Hoechst 33342, fluorescein-conjugated goat antimouse, or
antirabbit IgG (Molecular Probes, Eugene, OR). Anti-GH receptor (GHR)
polyclonal antibody (GHRcyt-AL47) was generated as previously described (8).
Cell culture
FIG. 1. Mutant STAT5b(A630P) is not activated by GH in primary
dermal fibroblasts. A, Schematic secondary structure of the human
STAT5b(A630P) protein. Numbers indicate amino acid residue. P,
Proline due to a missense mutation; Y, tyrosine that is normally
phosphorylated; ND, N-terminal domain; CCD, coiled-coil domain;
DBD, DNA-binding domain; L, linker domain; TAD, transcription
activation domain. B, CF (normal) and PF (STAT5b mutation) infected with adenovirus vector (Ad-v) or adenovirus carrying the rabbit
GH receptor (Ad-rGHR), were treated with GH (500 ng/ml) for 30 min
and cell lysates analyzed by Western immunoblot (WIB) for phosphorylation of STAT5 (␣-pSTAT5). Overexpression of rGHR was confirmed by immunodetection with ␣GHR. Note endogenous GHR was
not immunodetected due to low concentrations of endogenous GHR in
these cells. Total STAT5b and STAT5a were immunodetected as indicated.
mits docking of the STATs to phospho-tyrosines on activated
receptors; 2) it permits phosphorylated STATs to hetero- or
homodimerize before translocation to the nucleus; and 3) it
stabilizes STAT-DNA interactions. Architecturally similar to
other SH2 domains, the core of the STAT SH2 domain consists of an antiparallel ␤-sheet flanked by two ␣ helices (6).
The strictly conserved arginine, which recognizes the phosphate group of phosphotyrosines, is in strand-␤B, and residues in the loop connecting strands-␤B and -␤C provide the
supporting structure for phosphate binding (6). The proline
substitution at residue 630 within strand-␤C is predicted to
disrupt the ␤C-structure, thereby impairing the phosphate
binding and possibly destabilizing STAT5b structure.
Significantly, in primary dermal fibroblasts carrying
STAT5b(A630P), after stimulation by GH or interferon
(IFN)-␥, both of which normally activate the JAK-STAT5b
signaling pathways, phospho-STAT5 was not detected, and
the STAT5b target gene, IGF-I, clearly was dysregulated (4,
7). The precise explanation for reduced IGF-I gene transcription remained uncertain because it could be the result of
aberrant STAT5b(A630P) function(s) or simply reflect the
presence of decreased levels of unstable STAT5b(A630P).
The current studies provide evidence that, although mutant
STAT5b(A630P) can be phosphorylated by non-receptorassociated kinases such as src, the phosphorylated
STAT5b(A630P) is still unable to activate STAT5b-dependent
target genes. This, together with new data demonstrating the
inability of the mutant protein to be phosphorylated by GH
and IFN-␥, is consistent with the hypothesis that the A630P
mutation most likely prevents docking to activated cytokine
receptors and prevents stable protein-DNA complex
formation.
Human primary dermal fibroblasts, normal (CF) and carrying mutant
STAT5b(A630P) (PF), have been described previously (4). COS-7 cells
(American Type Culture Collection, Manassas, VA), HEK293 (ATCC),
and HEK293 stably transfected with the human GH receptor gene,
HEK293(hGHR) (9), were maintained as recommended. Cells were
treated with 100 U/ml IFN-␥ (Roche, Mannheim, Germany), 100 ng/ml
human recombinant epithelial growth factor (EGF) (Sigma, St. Louis,
MO), or 500 ng/ml recombinant human GH (generous gift from Genentech, Inc., South San Francisco, CA), as previously described (7).
Immunocytochemical analysis
Poly-d-lysine-coated eight-chamber slides (Becton Dickinson, Bedford, MA) were seeded with 6000 HEK293 or HEK239(hGHR) cells/
chamber, and transfected for 24 h, treated with GH (500 ng/ml) for 30
min before processing as previously described (10). Appropriate primary (anti-FLAG or anti-pY-STAT5 at 1:500 dilution) and secondary
antibodies were applied, and the nucleus was stained with Hoechst
(1:1000 dilution). Immunofluorescence was observed as previously described (7, 10).
Plasmids and adenovirus constructs
N-terminally FLAG-tagged STAT5b (F-STAT5b) and STAT5b(A630P)
(F-A630P) constructs have been described previously (7). Constructs
carrying v-src or EGF receptor (EGFR) cDNAs were gifts from Drs. Brian
Druker and Gayle Clinton, respectively (Oregon Health and Science
University). The luciferase reporter construct, 8 ⫻ GH response element
(GHRE) from the rat Spi2.1 gene in pGL2 (pGHRE-LUC), was a gift from
Drs. Joachim Woelfle and Peter Rotwein (Oregon Health and Science
University). The generation of adenovirus carrying the rabbit recombinant GH receptor, Ad-rGHR, was similar to that previously reported
(11): rabbit GHR cDNA (a gift of W. Wood, Genentech), was N-terminally HA tagged, and resultant N-HA-GHR fragment (XbaI-PmeI) was
subcloned into the XbaI and EcoRV sites of the adenoviral shuttle vector,
pAdTrack-CMV. Final construction of Ad-rGHR followed the AdEasy
system (Q-Biogene, Carlsbad, CA) protocol.
Transfection experiments
HEK293 and HEK293(hGHR) cells (⬃60% confluent), plated on polyd-lysine-coated plates or slides (Becton Dickinson, San Jose, CA), were
transiently transfected with pcDNA3.1 (1 ␮g/well), F-STAT5b (1 ␮g/
well), F-A630P (3 ␮g/well), v-src (0.5 ␮g/well), or EGFR (0.5 ␮g/well)
as indicated, using TransIT-LT1 (Mirus, Madison, WI). Transfections
were performed in duplicates, at least three independent times, unless
otherwise indicated. A higher concentration of F-A630P plasmid was
necessary to generate final F-A630P protein concentrations immunologically equivalent to that of F-STAT5b protein. After 18 –24 h of transfection, cells were washed, serum starved for 6 h, and treated for 30 min
as indicated.
Adenovirus infections of primary dermal fibroblasts
CF and PF cells were seeded at 5 ⫻ 105 cells per 100-mm plate and
grown to approximately 70% confluency. Infections with adenovirus
constructs (vector, Ad-V; or Ad-rGHR) were carried out at a multiplicity
of infection of 500, in ␣MEM supplemented with 5% fetal bovine serum.
1528
J Clin Endocrinol Metab, April 2006, 91(4):1526 –1534
After 48 h of infection, the cultures were treated for 1 h with 500 ng/ml
GH. Cells lysates were analyzed for expression and phosphorylation of
recombinant proteins as indicated.
Inhibition of tyrosine phosphatases with sodium
orthovanadate
Serum-starved HEK293(hGHR)-transfected cells were pretreated
with 1 mm sodium orthovanadate (Na3VO4, Sigma) for 1 h and then
treated with fresh serum-free HEK media containing 1 mm Na3VO4 and
GH (500 ng/ml) for the times indicated before cell lysis. Mock treatment
was included as a control. HEK293 cells cotransfected with v-src and
STAT5b (wild-type or mutant) were similarly processed.
Western immunoblot analysis
Cell lysates were solubilized in Triton X-100 lysis buffer as previously
described (7). Equal quantities of protein (protein assay; Bio-Rad Laboratories, Hercules, CA), 30 ␮g, were size fractionated on reducing 7%
or 13% SDS-polyacrylamide gels and electroblotted onto nitrocellulose
membranes. Western blots were processed with the appropriate primary
and secondary antibodies, following manufacturers’ protocols, and visualized by enhanced chemiluminescence (PerkinElmer Life Sciences,
Inc., Boston, MA). In some cases, immunoprecipitation (IP) of total cell
lysates (⬃500 ␮g), using anti-FLAG-M2-agarose beads, preceded Western immunoblot analysis.
Luciferase reporter assays
Luciferase (pGHRE-LUC)-transfected HEK293 or HEK293(hGHR)
cells were analyzed for reporter activity using the luciferase assay system (Promega Corp., Madison, WI). Input DNA was a total of 3 ␮g/well,
adjusted accordingly with pcDNA3.1:0.5 ␮g v-src, 1.0 ␮g pGHRE-LUC,
2 ␮g F-A630P, 0.5 ␮g F-STAT5b, and 0.5 ␮g EGFR. After treatment with
GH, EGF, or IFN␥ for 24 h, cells were lysed and luciferase activities
(normalized to total protein concentration) measured with a luminometer (Wallac, Inc., Gaithersburg, MD). Each experiment was performed
at least two independent times, in triplicate. The results are reported as
relative fold induction ⫾ sd relative to untreated conditions.
EMSA
Target DNA for pSTAT5b binding was the rat spi2.1 GHRE: 5⬘ACGCTTCTACTAATCCATGTTCTGAGAAATCATCCAGTCTGCCCA3⬘. The assay was performed with 1.5 ␮g (normal EMSA) or 2.5 ␮g
(supershift assays) nuclear extract, 4 pmol nonbiotinylated target DNA,
and 20 fmol 5⬘-biotinylated target DNA following the manufacturer’s
instructions (LightShift chemiluminescent EMSA kit; Pierce, Rockford,
IL). Nuclear extracts were generated as described previously (12) and
stored at ⫺80 C. For supershift assay, excess (2 ␮g) anti-FLAG M2
monoclonal antibody or mouse IgG (Sigma-Aldrich, St. Louis, MO) was
included in the reactions. The DNA-protein complexes were resolved on
native 5% polyacrylamide gels and detected as recommended by the
manufacturer.
Results
GH-induced phospho-STAT5 is not detected in primary
dermal fibroblasts carrying STAT5b(A630P)
In normal primary dermal fibroblasts (CF cells), both the
GH and IFN␥ signaling systems preferentially tyrosine phosphorylate STAT5b over STAT5a (4, 7). Phosphorylation of
STAT5b by GH, however, is considerably less robust than
that induced by IFN␥ (7) due, presumably, to low numbers
of GHRs. Total GHR concentrations were increased, therefore, by infecting fibroblasts with adenovirus carrying rabbit
GHR (Ad-rGHR). Upon GH treatment, phospho-STAT5
(pSTAT5) was consistently immunodetected in Ad-rGHRinfected normal fibroblasts, compared with fibroblasts infected with adenovirus control (Fig. 1B). Primary dermal
Fang et al. • Mutant STAT5b Cannot Function
fibroblasts carrying the STAT5b(A630P) mutation (PF cells)
were similarly infected with the adenovirus constructs, and,
as shown in Fig. 1B, pSTAT5 still was not detectable by
immunoblotting, despite overexpression of GHR.
FLAG-tagged mutant STAT5b (F-A630P) is not activated by
GH in HEK293(hGHR)
The failure to detect pSTAT5 in the PF cells (Fig. 1B)
suggested that STAT5b(A630P) could not be phosphorylated
or that phosphorylated STAT5b(A630P) could not be detected because expression of the mutant protein was low (PF
cells) in comparison with wild-type STAT5 (CF cells). To
demonstrate definitively whether GH can induce phosphorylation of mutant STAT-5b(A630P), reconstitution experiments were performed in HEK293 cells stably transfected
with hGHR. In HEK293(hGHR) cells, N-terminally FLAGtagged mutant (F-A630P) and wild-type (F-STAT5b) STAT5b
were overexpressed to immunologically equivalent amounts
(Fig. 2A) and response to GH treatment evaluated. Immunoblot analysis of vector (pcDNA3.1)-transfected cell lysates
showed that GH treatment induced tyrosine phosphorylation of endogenous STAT5. When F-STAT5b was overexpressed, the band corresponding to pSTAT5 was intensified,
suggesting F-STAT5b was also phosphorylated. In contrast,
in cell extracts in which F-A630P was overexpressed, the
pSTAT5 band was poorly detectable and similar to cells
transfected with vector (Fig. 2A). IP of F-STAT5b and
F-A630P confirmed GH-induced phosphorylation of
F-STAT5b but not F-A630P (Fig. 2B).
One explanation for the lack of detectable GH-induced
phospho-F-A630P (p-F-A630P) is that the A630P mutation
rendered the protein more vulnerable to dephosphorylation.
To determine whether this was the case, transfected cells
were preexposed to Na3VO4, a general tyrosine phosphatase
inhibitor, before GH treatment. In the absence of Na3VO4,
phosphorylation of wild-type F-STAT5b was significantly
reduced 18 h after GH treatment (Fig. 2C), but the presence
of Na3VO4 prolonged and enhanced detectable GH-induced
p-F-STAT5b. Unlike p-F-STAT5b, however, Na3VO4 treatment did not enhance detection of p-F-A630P. Clearly, the
lack of detectable p-STAT5b(A630P) was not due to a more
rapid dephosphorylation process.
The activity of GH-induced p-F-STAT5b was measured by
luciferase reporter assays, using the response element,
GHRE, from the rat Spi2.1 gene, which is specific for STAT5b
(13, 14). GH induced a modest 1.8-fold increase in luciferase
activity in cells transfected with pcDNA3.1, whereas a
greater than 20-fold induction in reporter activity was observed in GH-treated cells transfected with F-STAT5b (Fig.
2D). As predicted, in cells transfected with F-A630P, GHinduced reporter activity was similar to that of vector control
(Fig. 2D). Expression of mutant and wild-type STAT5b in
these assays was equivalent by immunoblot analysis (data
not shown).
F-A630P is not activated by IFN␥ in HEK293
We previously demonstrated that IFN␥ could not induce
phosphorylation of STAT5b(A630P) in primary fibroblasts,
resulting in dysregulation of the IGF-I target gene (7). These
Fang et al. • Mutant STAT5b Cannot Function
J Clin Endocrinol Metab, April 2006, 91(4):1526 –1534
1529
FIG. 3. F-A630P is not activated by the IFN␥ signaling pathway in
reconstitution experiments. HEK293 cells were transfected with plasmids pcDNA3.1, F-STAT5b, or F-A630P and treated with IFN␥ (100
U/ml) for 30 min. A, Cell lysates were collected and recombinant
FLAG-tagged proteins were IP from 500 ␮g total protein before Western immunoblot (WIB) analysis. B, GHRE(Spi2.1)-luciferase reporter
activity. pGHRE-LUC cotransfected cells were treated with or without IFN␥ for 24 h and cell lysates collected for determination of
luciferase activity. Results are reported as relative fold induction to
untreated (⫺IFN␥, given an arbitrary value of 1) ⫾ SD, from three
independent experiments, each performed in triplicate.
FIG. 2. F-A630P is not activated by GH in reconstitution experiments. HEK293(hGHR) cells were transfected with plasmids
pcDNA3.1 (Invitrogen Life Technologies, Carlsbad, CA), F-STAT5b,
or F-A630P and treated with GH for 30 min or as indicated. A, Cell
lysates were collected and analyzed by Western immunoblot (WIB).
Antibodies used are indicated. B, Recombinant FLAG-tagged proteins
were IP from 500 ␮g of total protein before WIB analysis. C, Transfected cells were pretreated with 1 mM Na3VO4 or media for 1 h before
treatment with GH (with or without Na3VO4). All 0 time points also
reflect no GH treatment. Cell lysates were IP with ␣FLAG before WIB
analysis. D, GHRE(Spi2.1)-luciferase reporter activity. Cells, cotransfected with pGHRE-LUC, were treated with or without GH for 24 h
and cell lysates collected for determination of luciferase activity. Results are reported as relative fold induction, compared with untreated
(⫺GH, given an arbitrary value of 1) ⫾ SD, from four independent
experiments, each performed in triplicate.
earlier observations are extended in reconstitution studies
using HEK293 cells. IFN␥ treatment, like GH treatment, resulted in tyrosine phosphorylation of wild-type F-STAT5b
but not of mutant F-A630P (Fig. 3A). Furthermore, whereas
IFN␥-induced p-F-STAT5b was able to drive luciferase reporter activity, F-A630P could not (Fig. 3B).
Phosphorylation of F-A630P by src-mediated systems
Both GH and IFN␥ activation of the JAK-STAT5b signaling
pathways require initial recruitment of STAT5b, which, via
their SH2 domain, dock to phospho-tyrosines (pY) on the
receptors. The receptor-associated JAKs subsequently tyrosine phosphorylate the docked STAT5b at Y699. Since
STAT5b(A630P) could not be phosphorylated by activatedreceptor-JAK2 systems, we asked whether STAT5b(A630)
could be phosphorylated through non-receptor-mediated
mechanism(s), and, if phosphorylated, could it function as a
transcription factor. To evaluate this possibility, a constitutively active nonreceptor tyrosine kinase, v-src, was cotransfected with F-STAT5b or F-A630P in HEK293 cells, and
pSTAT5 analyzed. As shown in Fig. 4A, the presence of v-src
resulted in phosphorylation of not only F-STAT5b but also
mutant F-A630P, although p-F-A630P was reproducibly less
well immunodetected, compared with that of wild type. Pretreatment of transfected cells with Na3VO4 did not further
enhance detectable p-F-A630P (Fig. 4B). These results support the hypothesis that Y699 on the mutant protein is available for phosphorylation, although efficiency may be
lowered.
It is possible, however, that even proteins not normally
phosphorylated become phosphorylated when v-src is
highly overexpressed. We therefore examined the EGF signaling pathway, which, unlike the GH and IFN␥ pathways,
can induce tyrosine phosphorylation of STAT5b by activating endogenous c-src (15, 16). Coexpression of EGFR and
F-STAT5b in HEK293 cells resulted in a low level of detectable p-F-STAT5b, which was significantly enhanced with
EGF treatment (Fig. 4C). No p-F-A630P was detected when
EGFR was coexpressed with F-A630P, but on addition of
1530
J Clin Endocrinol Metab, April 2006, 91(4):1526 –1534
Fang et al. • Mutant STAT5b Cannot Function
FIG. 4. F-STAT5b and F-A630P are both phosphorylated by v-src and the EGF signaling pathway. HEK293
cells were transfected with plasmids pcDNA3.1,
F-STAT5b, or F-A630P or cotransfected with v-src or
EGFR as indicated. A, Cell lysates were collected,
FLAG-tagged protein IP from 500 ␮g total protein, and
analyzed by Western immunoblot (WIB). Antibodies
used are indicated. B, Transfected cells were treated
with 1 mM Na3VO4 or media for 6 h before cell lysate
collection. Cell lysates were IP with ␣-FLAG before WIB
analysis. C, Cells were cotransfected with EGFR and
treated with or without EGF (100 ng/ml) for 30 min
before collecting cell lysates. FLAG-tagged proteins
were IP from 500 ␮g total protein and analyzed by WIB.
EGF, p-F-A630P was readily and reproducibly immunodetected, albeit consistently at levels lower than those observed
with F-STAT5b (Fig. 4C). Identical results were obtained in
reconstitution experiments using COS-7 cells, which had
high levels of endogenous EGFR (data not shown). Altogether, the results suggest that mutant STAT5b(A630P) can
be tyrosine phosphorylated under limited situations.
Src-induced p-F-A630P can translocate to the nucleus but
cannot bind DNA
To determine whether p-F-A630P was capable of translocating to the nucleus, immunocytochemical and cellular fractionation studies were performed on HEK293 cells cotransfected with v-src and vector, wild-type, or mutant STAT5b.
Immunofluorescent staining of cells indicated that pSTAT5
was not detectable when v-src was cotransfected with vector
only (Fig. 5A, top panels). In the absence of v-src, pSTAT5 was
also not immunodetected, although FLAG-tagged wild-type
and mutant STAT5b were observed in the cytoplasm of cells
overexpressing the proteins (data not shown). When v-src
was cotransfected with F-STAT5b, pSTAT5 was readily detected and appeared to be nuclear (Fig. 5A, middle panels).
Surprisingly, similar observations were made in cells cotransfected with v-src and mutant F-A630P (Fig. 5A, bottom
panels).
The nuclear localization of v-src-activated p-F-A630P was
not due simply to overexpresssion of F-A630P because
F-A630P was not detected in the nucleus of GH-treated
HEK293(hGHR) cells overexpressing F-A630P but was
readily detected in the cytoplasm of the cells (Fig. 5B). Under
the same conditions, wild-type F-STAT5b was immunodetected in the nucleus only after GH treatment (Fig. 5B).
The results from immunocytochemical studies were confirmed by cellular fractionation studies. Immunoblot analysis of F-STAT-5b or F-A630P, IP from fractionated HEK293
cells cotransfected with v-src, indicated both p-F-STAT-5b
and p-F-A630P were present in the nuclear fractions, although proportionally less p-F-A630P was detected. We concluded from these experiments that v-src-induced p-F-A630P
can translocate to the nucleus.
We next evaluated whether v-src-mediated p-F-A630P
could bind DNA. Analysis by EMSA demonstrated that
F-STAT5b gel shifted GHRE in the presence of v-src (Fig. 6A,
lane 12). The same gel-shifted band was detected when
F-STAT5b was activated by GH (Fig. 6A, lane 3) and absent
in unstimulated F-STAT5b (Fig. 6A, lanes 1, 2, 10, and 11).
Specificity of binding was indicated by loss of the gel-shifted
band in competition experiments with unlabeled GHRE oligonucleotides (Fig. 6A, lanes 4 and 13). Furthermore, supershifting of the respective band was achieved with anti-Flag
antibody (Fig. 6B, lanes 2, 4) but not with excess mouse IgG
(Fig. 6B, lane 5). In stark contrast, v-src-activated F-A630P did
not gel shift the GHRE (Fig. 6A), suggesting that, despite the
unexpected ability to translocate to the nucleus, p-F-A630P
was unable to stably bind DNA and therefore unlikely to be
able to act as a transcription factor.
Src-induced p-F-A630P cannot drive GHRE(Spi2.1)
luciferase-reporter activity
The inability of p-F-A630P to act as a transcription factor
was confirmed in vitro using luciferase reporter assays (Fig.
6, C and D). In vector-transfected HEK293 cells, only a modest 1.5-fold increase in luciferase activity was observed on
EGF treatment or with v-src. In the presence of F-STAT5b,
EGF or v-src treatment resulted in a 7-fold increase in luciferase activity relative to untreated conditions. In contrast,
neither EGF treatment nor v-src could induce F-A630P to
drive luciferase activity above that of background (Fig. 6,
and D).
Discussion
The identification of a natural missense mutation in
STAT5b associated with severe growth failure and immune
dysfunction (4) pointed to the biological importance of
STAT5b but, simultaneously, raised fundamental questions
concerning the impact(s) this unique mutation had on
STAT5b function(s). In the STAT5b⫺/⫺ mouse model, targeted disruption of the STAT5b gene ablated expression of
STAT5b, and the effect of absence of STAT5b was loss of the
sexual dimorphic body growth rates characteristic of normal
mice, with STAT5b⫺/⫺ male mice reduced to the size of
Fang et al. • Mutant STAT5b Cannot Function
J Clin Endocrinol Metab, April 2006, 91(4):1526 –1534
1531
FIG. 5. v-src-induced phospho-F-A630P can translocate to the nucleus. Cells were transfected with pcDNA3.1, F-STAT5b, or F-A630P and
processed for immunocytochemical analysis as described in Materials and Methods or for Western immunoblot (WIB) analysis. A, Immunofluorescence of HEK293 cells cotransfected with v-src. Primary antibodies used are indicated at the top of the panels. B, Immunofluorescence
of transfected HEK293(hGHR) cells, treated with or without GH (500 ng/ml) for 30 min. C, WIB of nuclear and cytoplasmic fractionations of
cell extracts of HEK293 cotransfected with v-src (see Materials and Methods). FLAG-tagged proteins were IP from approximately 700 ␮g total
protein before WIB analysis as indicated. NE, Nuclear extract; CE, cytoplasmic extract.
female mice and displaying marked changes in liver gene
expression, whereas the size of female mice remained unaltered (17). Aberrancy in immune function was subsequently
noted (18 –22), although the most severe immunological
changes were those observed in mice lacking both STAT5a
and STAT5b (23, 24). Clearly the human phenotype is somewhat different from that reported in the rodent knockout
model because the human female patient was both severely
growth retarded and immunologically impaired. Whether
this reflects true interspecies differences of STAT5 function,
or is the consequence of the specific mutation involved, remains to be resolved, although it is of note that the second
case of STAT5b mutation reported, also in a female, had a
similar growth and immune phenotype (5).
In this report, we confirm and extend our previous observations regarding the inability of ligand-dependent signaling pathways to activate STAT5b(A630P) (4, 7) and provide new data demonstrating that, via ligand-independent
mechanisms, STAT5b(A630P) can be phosphorylated and
translocate to the nucleus but remains functionally impaired
as a transcription factor. Activation of STAT5b by type I and
type II cytokine receptors, represented by the GH and IFN␥
receptors, respectively, requires the recruitment of STAT5b
to phospho-tyrosines on ligand-activated receptors before
phosphorylation of STAT5b by JAK2. The lack of detectable
phospho-tyrosyl-STAT5b(A630P) in both reconstitution experiments and native state suggests that the A630P mutation
affects these initial steps in signal transduction. Evidence in
support of this hypothesis comes from two observations: 1)
STAT5b(A630P) can be tyrosine phosphorylated by non-receptor-associated constitutively active v-src; and 2) Na3VO4
treatment does not enhance detection of GH-induced phospho-STAT5b(A630P), indicating that an increased vulnerability to dephosphorylation is not the explanation for lack of
detectable phopho-STAT5b(A630P). Attempts to determine
whether mutant STAT5b(A630P) could dock to GH-activated
1532
J Clin Endocrinol Metab, April 2006, 91(4):1526 –1534
Fang et al. • Mutant STAT5b Cannot Function
FIG. 6. v-src-phosphorylated F-STAT5b, but not F-A630P, binds to GHRE and drives GHRE(Spi2.1)-luciferase reporter activity. HEK293 and
HEK293(hGHR) cells were transfected and processed, and EMSAs or luciferase assays were performed. A, Cells were treated with GH or
cotransfected with v-src, as indicated. Plasmid constructs transfected (F-STAT5b or F-A630P) and nonlabeled GHRE (competitor) are indicated.
Arrow indicates the gel-shifted band. B, Specificity of F-STAT5b-GHRE complex (lower arrow) was determined by supershifting (upper arrow)
with anti-FLAG antibody or mouse IgG (2 ␮g/reaction). C, EGFR cotransfected cells (as described in Fig. 4) were treated with or without EGF
for 24 h and cell lysates collected for determination of luciferase activity. Results are reported as relative fold induction to untreated (⫺EGF,
given an arbitrary value of 1) ⫾ SD from two independent experiments, each performed in triplicate. D, Luciferase activity was determined from
v-src-cotransfected cells (see Fig. 4). Results (fold induction ⫾ SD) are relative to pcDNA3.1 basal activity (set arbitrarily as 1), performed three
independent times, in triplicate.
GHR (using reciprocal co-IP techniques) were inconclusive
because the wild-type STAT5b did not consistently co-IP
with GHR (data not shown). Nevertheless, the combination
of a disrupted SH2 domain and phosphorylation by JAK2independent, nonreceptor kinase mechanisms would support the concept that STAT5b(A630P) is unlikely to dock
normally to ligand-activated receptors.
The tyrosine phosphorylation of STAT5b(A630P) by srcmediated systems is consistent with cumulative reports demonstrating activation of STAT5a/b via JAK2-independent
mechanisms involving nonreceptor kinases (15, 25–28). The
p-STAT5b(A630P) detected reflected phosphorylation at
Y699 because the commercially available anti-pSTAT-5 antibody we used detects STAT5 only when phosphorylated at
Y694 (STAT-5a) or the equivalent Y699 (STAT-5b) (29). Indeed, all published reports indicate Y699 as the main site
phosphorylated by the src family of kinases (16, 26, 27). It is
probable that tyrosines other than Y699 were also phosphorylated in STAT5b(A630P), as has been demonstrated for rat
STAT5b, in which v-src additionally phosphorylated Y724
and Y679 (26) and, for human STAT5b, EGF-induced phos-
phorylation of Y725, Y740, and Y743, in addition to Y699 (16,
29). The biological consequences of phosphorylated tyrosines other than Y699, however, are unclear, although alterations in the pattern of nuclear localization and gene expression have been suggested (26).
One consequence of src-mediated phosphorylation of mutant STAT5b(A630P) was its translocation to the nucleus,
although whether this occurs in vivo remains to be established. Our results indicate that the nuclear translocation
signal, proposed to be either in the DNA binding domain (30)
or the N-terminal region (31), was unaffected by the A630P
mutation. Furthermore, the results implied that, according to
accepted paradigm, homodimers of p-STAT5b(A630P)
formed before translocation. It is unclear, at present, whether
STAT5b(A630P) could form dimers through the accepted
mechanism involving reciprocal binding of pY via the SH2
domain. Interestingly, SH2-independent dimerization mechanisms were suggested in a recent study demonstrating that
nonphosphorylated STAT4 formed dimers through its N
domain (32).
Nuclear p-F-STAT5b(A630P) could not drive gene ex-
Fang et al. • Mutant STAT5b Cannot Function
pression because, unlike the phosphorylated wild-type,
the mutant STAT5b appeared to be unable to bind DNA.
In gel-shift assays, only activated F-STAT5b bound to the
GHRE, which could be further supershifted with antiFLAG antibody. The inability of p-F-STAT5b(A630P) to
bind DNA in steady-state in vitro assays is consistent with
the proposed role of the SH2 domain in stabilizing STATDNA interactions (6).
The A630P mutation rendered STAT5b(A630P) poorly
detected in PF cells due, most probably, to the considerably shortened half-life of STAT5b(A630P) (3 h), compared
with wild-type STAT5b (⬎24 h) (33). We have now demonstrated that, even if STAT5b(A630P) is expressed more
abundantly, the mutant protein remains functionally impaired. Interestingly, overexpressing wild-type F-STAT5b
in PF cells can re-regenerate the GH signaling pathway
(data not shown), suggesting that STAT5b(A630P) does
not appear to exert an obvious negative effect on the function(s) of wild-type STAT5b. This would be consistent
with the heterozygous state of the parents of the patient,
who are of normal stature and with no apparent immune
complications (4).
Finally, the importance of STAT5b for human statural
growth has recently been verified by the identification of
a second case of mutant STAT5b associated with severe
growth retardation and GH insensitivity/IGF deficiency
(5). The identified frameshift mutation ablated detectable
STAT5b as a consequence of early termination of protein
synthesis. The phenotype of immune dysfunction in both
cases indicated that STAT5b is also critical for normal
immunity. Altogether, STAT5b(A630P) appears to be functionally equivalent to an absence of the STAT5b protein.
In conclusion, the A630P mutation disrupted the SH2
architecture such that the mutant STAT5b: 1) most likely
cannot dock normally to phospho-tyrosines on ligandactivated receptors, thus preventing phosphorylation by
these systems; and 2) cannot form stable STAT5b-DNA
interactions, even if phosphorylated and nuclear localized.
Because STAT5b(A630P) has proven to be an inefficient
signal transducer and transcription factor, the detrimental
impacts on signaling pathways important for normal
growth and immunity explain, in part, the complex clinical
phenotype of GH insensitivity/IGF deficiency and immune dysfunction.
Acknowledgments
Received November 28, 2005. Accepted February 1, 2006.
Address all correspondence and requests for reprints to: Dr. Vivian
Hwa, Department of Pediatrics, NRC5, Oregon Health and Science University, 3181 Southwest Sam Jackson Park Road, Portland, Oregon
97239-3098. E-mail: [email protected].
This work was supported by National Institutes of Health Grants
CA58110 (to R.G.R.) and DK46395 (to S.J.F.), and a grant from Pharmacia,
Inc. (to R.G.R.). P.F. is supported by a postdoctoral traineeship award
from the Prostate Cancer Research Program, Department of Defense.
P.F., E.M.F., B.M.L., X.W., R.J.M.R., S.J.F., V.H., and R.G.R. have
nothing to declare.
References
1. Levy DE, Darnell Jr JE 2002 STATs: transcriptional control and biological
impact. Nat Rev Mol Cell Biol 3:651– 662
J Clin Endocrinol Metab, April 2006, 91(4):1526 –1534
1533
2. Dupuis S, Dargemont C, Fieschi C, Thomassin N, Rosenzweig S, Harris J,
Holland SM, Schreiber RD, Casanova J-L 2001 Impairment of mycobacteril
but not viral immunity by a germline human STAT1 mutation. Science 293:
300 –303
3. Dupuis S, Jouanguy E, Al-Hajjar S, Fieschi C, Al-Mohsen IZ, Al-Jumaah S,
Yang K, Chapgier A, Eidenschenk C, Eid P, Ghonaium AA, Tufenkeji H,
Frayha H, Al-Rayes H, Schreiber RD, Gresser I, Casanova J-L 2003 Impaired
response to interferon-␣/␤ and lethal viral disease in human STAT1 deficiency. Nat Genet 33:388 –391
4. Kofoed EM, Hwa V, Little B, Woods KA, Buckway CK, Tsubaki J, Pratt KL,
Bezrodnik L, Jasper H, Tepper A, Heinrich J, Rosenfeld RG 2003 Growthhormone insensitivity (GHI) associated with a STAT-5b mutation. N Engl
J Med 349:1139 –1147
5. Hwa V, Little B, Adiyaman P, Kofoed EM, Pratt KL, Ocal G, Berberoglu M,
Rosenfeld RG 2005 Severe growth hormone insensitivity resulting from total
absence of signal transducer and activator of transcription 5b. J Clin Endocrinol
Metab 90:4260 – 4266
6. Chen X, Vinkemeier U, Zhao Y, Jerzalmi D, James E, Darnell J, Kuriyan J 1998
Crystal structure of a tyrosine phosphorylated STAT-1 dimer bound to DNA.
Cell 93:827– 839
7. Hwa V, Little B, Kofoed EM, Rosenfeld RG 2004 Transcriptional regulation
of insulin-like growth factor-I (IGF-I) by interferon-␥ (IFN-␥) requires Stat-5b.
J Biol Chem 279:2728 –2736
8. Zhang Y, Guan R, Jiang J, Kopshick JJ, Black RA, Baumann G, Frank SJ 2001
Growth hormone (GH)-induced dimerization inhibits phorbol ester-stimulated GH receptor proteolysis. J Biol Chem 276:24565–24573
9. Maamra M, Finidori J, Von Laue S, Simon S, Justice S, Webster J, Dower S,
Ross R 1999 Studies with a growth hormone antagonist and dual-fluorescent
confocal microscopy demonstrate that the full-length human growth hormone
receptor, but not the truncated isoform, is very rapidly internalized independent of JAK2-Stat5 signaling. J Biol Chem 274:14791–14798
10. Wilson EM, Oh Y, Hwa V, Rosenfeld RG 2001 Interaction of IGF-binding
protein-related protein 1 with a novel protein, neuroendocrine differentiation
factor, results in neuroendocrine differentiation of prostate cancer cells. J Clin
Endocrinol Metab 86:4504 – 4511
11. Cowan JW, Wang X, Guan R, He K, Jiang J, Baumann G, Black RA, Wolfe
MS, Frank SJ 2005 Growth hormone receptor is a target for presenilin-dependent ␥-secretase cleavage. J Biol Chem 280:19331–19342
12. Dignam JD, Martin PL, Shastry BS, Roeder RG 1983 Eukaryotic gene transcription with purified components. Methods Enzymol 101:582–598
13. Bergad PL, Shih HM, Towle HC, Schwarzenberg SJ, Berry SA 1995 Growth
hormone induction of hepatic serine protease inhibitor 2.1 transcription is
mediated by a Stat5-related factor binding synergistically to two ␥-activated
sites. J Biol Chem 270:24903–24910
14. Thomas MJ, Gronowski AM, Berry SA, Bergad PL, Rotwein P 1995 Growth
hormone rapidly activates rat serine protease inhibitor 2.1 gene transcription
and induces a DNA-binding activity distinct from those of Stat1, -3, and -4. Mol
Cell Biol 15:12–18
15. Olayioye MA, Beuvink I, Horsch K, Daly JM, Hynes NE 1999 ErbB receptorinduced activation of Stat transcription factors is mediated by src tyrosine
kinases. J Biol Chem 274:17209 –17218
16. Kloth MT, Laughlin KK, Biscardi JS, Boerner JL, Parsons SJ, Silva CM 2003
STAT5b, a mediator of synergism between c-Src and the epidermal growth
factor receptor. J Biol Chem 278:1671–1679
17. Udy GB, Towers RP, Snell RG, Wilkins RJ, Park SH, Ram PA, Waxman
DJ, Davey HW 1997 Requirement of STAT5b for sexual dimorphism of
body growth rates and liver gene expression. Proc Natl Acad Sci USA
94:7239 –7244
18. Teglund S, McKay C, Schuetz E, van Deursen JM, Stravopodis D, Wang D,
Brown M, Bodner S, Grosveld G, Ihle JN 1998 Stat5a and Stat5b proteins have
essential and nonessential, or redundant, roles in cytokine responses. Cell
93:841– 850
19. Imada K, Bloom ET, Nakajima H, Horvath-Arcidiacono JA, Udy GB, Davey
HW, Leonard WJ 1998 Stat5b is essential for natural killer cell-mediated
proliferation and cytolytic activity. J Exp Med 188:2067–2074
20. Moriggl R, Sexl V, Piekorz R, Topham D, Ihle JN 1999 Stat5 activation is
uniquely associated with cytokine signaling in peripheral T cells. Immunity
11:225–230
21. Moriggl R, Topham DJ, Teglund S, Sexl V, McKay C, Wang D, Hoffmeyer
A, van Deursen J, Sangster MY, Bunting KD, Grosveld GC, Ihle JN 1999 Stat5
is required for IL-2-induced cell cycle progression of peripheral T cells. Immunity 10:249 –259
22. Kagami S, Nakajima H, Kumano K, Suzuki K, Suto A, Imada K, Davey HW,
Saito Y, Takatsu K, Leonard WJ, Iwamoto I 2000 Both Stat5a and Stat5b are
required for antigen-induced eosinophil and T-cell recruitment into the tissue.
Blood 95:1370 –1377
23. Shelburne CP, McCoy ME, Piekorz R, Sexi V, Roh K-H, Jacobs-Helber SM,
Gillespie SR, Bailey DP, Mimonsef P, Mann MN, Kashyap M, Wright HV,
Chong HJ, Bouton LA, Barnstein B, Ramirez CD, Bunting KD, Sawyer S,
Lantz CS, Ryan JJ 2003 Stat5 expression is critical for mast cell development
and survival. Blood 102:1290 –1297
24. Snow JW, Abraham N, Ma MC, Herndier BG, Pastuszak AW, Goldsmith MA
1534
25.
26.
27.
28.
J Clin Endocrinol Metab, April 2006, 91(4):1526 –1534
2003 Loss of tolerance and autoimmunity affecting multiple organs in STAT5A/
5B-deficient mice. J Immunol 171:5042–5050
Kazansky AV, Kabotyanski EB, Wyszomierski SL, Manicini MA, Rosen JM
1999 Differential effects of prolactin and src/abl kinases on the nuclear translocation of STAT5b and STAT5a. J Biol Chem 274:22484 –22492
Kabotyanski EB, Rosen JM 2003 Signal transduction pathways regulated by
prolactin and src result in different conformations of activated Stat5b. J Biol
Chem 278:17218 –17227
Klejman A, Schreiner SJ, Nieborowska-Skorska M, Slupianek A, Wilson M,
Smithgall TE, Skorski T 2002 The Src family kinase Hck couples BCR/ABL
to STAT5 activation in myeloid leukemia cells. EMBO J 21:5766 –5774
Guren TK, Odegard J, Abrahamsen H, Thoresen GH, Susa M, Andersson Y,
Ostby E, Christoffersen T 2003 EGF receptor-mediated, c-Src-dependent, activation of Stat5b is downregulated in mitogenically responsive hepatocytes.
J Cell Physiol 196:113–123
Fang et al. • Mutant STAT5b Cannot Function
29. Kloth MT, Catling AD, Silva CM 2002 Novel activation of STAT5b in response
to epidermal growth factor. J Biol Chem 277:8693– 8701
30. Herrington J, Rui L, Luo G, Yu-Lee L-Y, Carter-Su C 1999 A functional DNA
binding domain is required for growth hormone-induced nuclear accumulation of Stat5b. J Biol Chem 274:5138 –5145
31. Zeng R, Aoki Y, Yoshida A, Arai K-I, Watanabe S 2002 Stat5b shuttles between
cytoplasm and nucleus in a cytokine-dependent and -independent manner.
J Immunol 168:4567– 4575
32. Ota N, Brett TJ, Murphy TL, Fremont DH, Murphy KM 2004 N-domaindependent nonphosphorylated STAT4 dimers required for cytokine-driven
activation. Nat Immunol 5:208 –215
33. Chia DJ, Subbian E, Buck TM, Hwa V, Rosenfeld RG, Skach WR, Shinde
U, Rotwein P 2006 Aberrant folding of a mutant STAT5b causes growth
hormone insensitivity and proteasomal dysfunction. J Biol Chem
281:6552– 6558
JCEM is published monthly by The Endocrine Society (http://www.endo-society.org), the foremost professional society serving the
endocrine community.