Download Tech Notes Mutagenesis of Amplified DNA Sequences Using Ampligase

Tech Notes
Mutagenesis of Amplified DNA Sequences Using Ampligase®
Thermostable DNA Ligase
Debra S. Moore and Scott F. Michael*, Department of Biology and *Department of Microbiology, University of Alabama at Birmingham,
Birmingham, AL 35294
Introduction
Mutagenesis of any region of an amplified DNA sequence can be accomplished
in a single reaction by the combined use
of a thermostable DNA polymerase and
thermostable DNA ligase.1 This technique
relies on the absence of strand displacement activity of the thermostable polymerase which allows annealing of an
internal mutagenic primer to the template
strand. Phosphorylation of the 5´-end of
the mutagenic primer allows thermostable
ligase-mediated incorporation into the
final full-length amplification product.
Two amplified fragments are generally
produced in these reactions: a truncated
product extending from the mutagenic
primer to the downstream primer, and a
full-length product extending between
each of the outer primers (Fig. 1). Since the
mutagenic primer is incorporated directly
into the product strand, which is then used
as template for subsequent rounds, the proportion of full-length product containing
the mutation will increase with each cycle.
Theoretically, for 100% efficient incorporation, only nine rounds of thermocycling are
necessary to generate greater than 99%
mutant product. In practice, this method
generally yields a mutagenesis efficiency of
50% or greater.
This procedure is both fast and costeffective because it uses a single mutagenic oligo in a single reaction to generate
mutants. The use of a single amplification
reaction reduces the incidence of DNA
polymerase errors. Additionally, the mutant
product can be cloned into any plasmid
vector desired, eliminating the need to
construct and use specialized vectors to
perform mutagenesis.
Here we demonstrate this procedure by
using a mutagenic primer to efficiently introduce a 100 base-pair deletion into a 725
base-pair fragment of the yeast gal 1/10
promoter. Ampligase Thermostable DNA
Ligase was used to ligate the phosphorylated, mutagenic primer into the full-length
amplified product. The mutated product
was then separated and visualized on an
ethidium bromide-stained gel (Fig. 2).
www.epicentre.com
Procedure
Phosphorylation of the mutagenic primer
The mutagenic oligo used in the reactions described here was purchased chemically phosphorylated at the 5′ position (GIBCO BRL). Alternately, mutagenic oligos can be enzymatically phosphorylated using T4 Polynucleotide Kinase. Briefly, a reaction consisting of 5 nmol
of mutagenic primer, 10 units of T4 Polynucleotide Kinase (Epicentre), 10 µl of 10X T4 Kinase
Buffer (Epicentre) and 100 nmol of ATP in a total volume of 100 µl yields sufficient phosphorylated primer for approximately five mutagenesis reactions.
Amplification/Mutagenesis reaction
The reaction conditions used to generate the mutant products were as follows:
100 pmol
each outer primer
1 nmol
phosphorylated mutagenic primer
40 nmol
each dNTP
10 µl
10X Taq DNA polymerase buffer
5 mM
MgCl2
1 mM
DTT
1 mM
NAD (Sigma)
1 µl
(5 U) Ampligase Thermostable DNA Ligase (Epicentre
1 µl
Taq DNA polymerase
1 ng
plasmid DNA template
Water to a final volume of 100 µl
Figure 1. Schematic of mutagenesis/
amplification reaction and products. (Primers
are designated by the solid arrows.) An interior
mutagenic primer is incorporated into the final
product by using a thermostable ligase. Two
products are amplified: a full-length product
which should contain the mutation of interest,
and a smaller fragment resulting from extension
from the mutagenic primer to the downstream
primer.
Figure 2. Ethidium bromide-stained 3%
Nu-Sieve® agarose gel of mutagenesis/
amplification reaction products. Lane 1, 1 kb
marker DNA (only small fragments are resolved).
Lane 2, normal amplification reaction using outer
primers to generate 725 base-pair product. Lane
3, mutagenesis/ amplification reaction. Band A
is the full-length wild-type product, band B is
the deletion product produced by incorporation
of the mutagenic primer, and band C is the
truncated product produced by amplification
between the mutagenic primer and the
downstream primer.
[email protected] • (800) 284-8474
Thirty amplification cycles were performed as follows:
94°C, 1 min.
40°C, 1 min.
65°C, 6 min.
(Thermocycling conditions may vary with different primer sets.)
The sequences of the three primers used in the reaction were:
upstream: gcgGAATTCGAATTTTCAAAAATTCTTACT
downstream: GGATCGAAGCTTGCTTGCCA
mutagenic: CATCGCTTCGCTGATGGATCCGcgtgggcgcAATTTTTCCTCTTCATAAC
(Capital letters indicate regions complementary to the template.)
Addition of NAD to the reaction was necessary because it is a cofactor for Ampligase
DNA Ligase. Alternately, the reaction can
be run using the 10X Ampligase Buffer
supplied with the enzyme, which contains
NAD. However, for this particular primer
set, the use of Ampligase Buffer resulted
in increased levels of non-specific ligation.
Thermocycling conditions may need to be
altered for different primer sets. In general,
longer extension times at lower than typical reaction temperatures are necessary for
efficient ligation and polymerization.
Product isolation and cloning
Purification of small, amplified DNA fragments can be accomplished by several
methods including electro-elution, matrix
binding, or spin-filtration. The purified
product of the mutagenesis reaction can
be digested and cloned directly into a
plasmid of choice. However, the full-length
mutant product should be separated
www.epicentre.com
from the smaller, partial fragment produced during the reaction and any other
non-specific amplified products. A highly
sieving agarose gel such as 3% Nu-Sieve®
(FMC) is required to resolve amplified fragments smaller than 1,000 base pairs. After
ethidium bromide staining of the gel, the
correct fragment can be excised and either
used directly in a ligation reaction, or purified from the agarose before ligation.
Summary
This fast and cost-effective procedure allows efficient incorporation of mutations
into any region of amplified DNA. Only a
single reaction is required and mutation
efficiencies of 50% or greater are typically
obtained. Ampligase Thermostable DNA
Ligase can be used in this procedure to
ligate the internal mutagenic primers into
the amplified product.
Results
Fig. 2 shows the results of a mutagenesis/
amplification reaction using Ampligase
Thermostable DNA Ligase. The mutagenic
primer used in this reaction produces a 100
base-pair deletion in the final amplification
product allowing resolution of the mutant
and wild-type products by agarose gel electrophoresis. The relative intensities of bands
A and B indicate that approximately half of
the full-length amplified product contains
the deletion.
References
S.F. Michael (1994) “Mutagenesis by Incorporation of a Phosphorylated Oligo During
PCR Amplification,” BioTechniques 16, 410.
[email protected] • (800) 284-8474